Application of GsRZ1A gene in improvement of alkali resistance of plants
By cloning the GsRZ1A gene and overexpressing it in soybean, the problem of soybean tolerance to high concentrations of NaHCO3 stress was solved, and rapid growth and enhanced antioxidant capacity of soybean under alkaline stress were achieved, thus improving alkali tolerance.
Patent Information
- Application Number
- CN202511881155.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-15
- Publication Date
- 2026-01-09
- Estimated Expiration
- 2045-12-15
AI Technical Summary
Existing technologies are insufficient to effectively improve plant tolerance to salt and alkali stress, especially the tolerance of soybeans to high concentrations of NaHCO3, which affects their growth and yield.
The GsRZ1A gene was cloned and constructed into a soybean expression vector using Agrobacterium-mediated transformation to increase the expression level of the GsRZ1A gene. Soybeans were then transformed to obtain overexpression lines, thereby enhancing the soybean's tolerance to alkaline stress.
GsRZ1A overexpression lines exhibited faster relative growth rate, larger total leaf area and root system under alkaline stress, increased leaf chlorophyll content and relative water content, enhanced antioxidant enzyme activity, reduced oxidative damage, increased soluble sugar accumulation, and significantly improved soybean tolerance to alkaline stress.
Smart Images

Figure CN121294526A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The application belongs to the technical field of genetic engineering, and particularly relates to application of GsRZ1A gene in improving plant alkali tolerance. BACKGROUND
[0002] Soil salinization is one of the main abiotic stresses affecting global agricultural production. According to statistics, the area of land affected by salinization worldwide has exceeded 1.125 billion hectares, which has seriously restricted the growth and yield of crops. High-concentration salt-alkali environment can cause ion imbalance, osmotic stress, water deficiency and active oxygen accumulation in plant cells, and then cause oxidative damage, inhibit plant growth and even cause plant death. Soybean, as an important food and oil crop and economic crop, is particularly sensitive to salt-alkali stress, and its yield and planting area are significantly limited by salt-alkali soil. Therefore, it has become an urgent need of current agricultural production and genetic improvement to mine salt-alkali tolerant gene resources and breed salt-alkali tolerant soybean varieties.
[0003] Wild soybean (Glycine soja) is a close wild relative of cultivated soybean, which has rich genetic diversity and strong environmental adaptability, especially in drought and salt-alkali tolerance. There is no reproductive isolation between wild soybean and cultivated soybean, and the excellent trait genes of wild soybean can be introduced into cultivated soybean through hybridization, which provides valuable gene resources for soybean stress tolerance improvement. In previous studies, an extremely salt-alkali tolerant wild soybean germplasm G07256 was screened from heavy salt-alkali soil in Baicheng City, Jilin Province, China, which laid a material foundation for the mining and function research of alkali-tolerant genes.
[0004] In the process of plant response to stress, post-transcriptional regulation mechanism plays a key role. RNA binding proteins (RBPs) are a class of proteins that can specifically bind to RNA molecules, and are involved in RNA processing, transportation, stability regulation and translation, thereby affecting the final expression level of genes. Therefore, cloning and analyzing GRPs genes responding to alkali stress from extremely salt-alkali tolerant wild soybean not only helps to understand the molecular mechanism of plant alkali tolerance, but also provides potential gene resources and technical approaches for breeding new alkali-tolerant soybean varieties by genetic engineering. SUMMARY
[0005] In view of the problems in the prior art, the purpose of the present application is to provide application of GsRZ1A gene in improving plant alkali tolerance.
[0006] In order to achieve the above purpose, the technical scheme adopted by the present application is as follows: The application of GsRZ1A gene in improving plant alkali tolerance, wherein the amino acid sequence encoded by the GsRZ1A gene is shown in SEQ ID NO: 2.
[0007] Based on the above scheme, the nucleic acid sequence of the GsRZ1A gene is shown in SEQ ID NO:1.
[0008] Based on the above approach, the alkali tolerance of plants can be improved by increasing the expression level of the GsRZ1A gene in plants.
[0009] Based on the above approach, the expression level of the GsRZ1A gene in plants was increased by constructing the GsRZ1A gene into a plant expression vector and transforming the plants.
[0010] Based on the above scheme, the method of transforming plant bodies is one of Agrobacterium-mediated transformation, gene gun transformation, electroporation transformation, PEG transformation, and liposome transformation.
[0011] Based on the above scheme, the Agrobacterium is Agrobacterium tumefaciens or Agrobacterium rhizogenes.
[0012] Based on the above scheme, the plant mentioned is soybean.
[0013] Based on the above scheme, the alkali resistance is at least resistant to 50 mM NaHCO3.
[0014] Advantages of the technical solution of this invention This invention cloned the gene GsRZ1A, associated with plant alkali tolerance, from wild soybean. The expression level of this gene significantly increased after alkali stress treatment. Transgenic lines were obtained by constructing an overexpression vector of the GsRZ1A gene and transforming it into soybean. Alkali stress treatment of the transgenic lines showed that the soybean lines overexpressing GsRZ1A exhibited a faster relative growth rate, with higher total leaf area, leaf chlorophyll content, and relative water content than the control lines transfected with an empty vector. The total root length and total root surface area were also significantly greater than the control group, indicating that GsRZ1A can improve the alkali tolerance of soybean. Stress physiological indicators of the treatment groups were measured, revealing that GsRZ1A enhances the tolerance of soybean to alkali stress by increasing the activity of antioxidant enzymes, reducing the accumulation of superoxide anions and malondialdehyde, and increasing the accumulation of osmotic regulators such as soluble sugars.
[0015] In summary, the GsRZ1A gene originates from wild soybean germplasm with strong alkali tolerance. It is not only closely related to cultivated soybean and easy to hybridize, facilitating gene introduction and trait integration in subsequent breeding, but it can also be applied to the genetic improvement of alkali tolerance in soybeans and other crops, providing key gene resources for breeding new varieties adapted to saline-alkali land. It has significant breeding and production application value. Attached Figure Description
[0016] Figure 1 Expression analysis of GsRZ1A in different tissues of wild soybean; Figure 2 Relative expression of GsRZ1A in Glycine soja under salt stress; Figure 3 Relative expression of GsRZ1A in Glycine soja under alkali stress; Figure 4 Relative expression of GsRZ1A in Glycine soja under abscisic acid (ABA) treatment; Figure 5 Relative expression of GsRZ1A in Glycine soja under methyl jasmonate (MeJA) treatment; Figure 6 Subcellular localization analysis diagram of GsRZ1A; Figure 7 Relative expression of GsRZ1A in empty vector and overexpression plants; Figure 8 Leaf phenotype diagram of different plant types under normal treatment and alkali stress treatment; Figure 9 Root phenotype diagram of different plant types under normal treatment and alkali stress treatment; Figure 10 Change of total leaf area size under normal conditions and alkali stress treatment; Figure 11 Change of total chlorophyll content under normal conditions and alkali stress treatment; Figure 12 Change of leaf relative water content under normal conditions and alkali stress treatment; Figure 13 Change of relative growth under normal conditions and alkali stress treatment; Figure 14 Change of total root length under normal conditions and alkali stress treatment; Figure 15 Change of total root surface area size under normal conditions and alkali stress treatment; Figure 16 Change of malondialdehyde (MDA) content under normal conditions and alkali stress treatment; Figure 17 Change of soluble sugar content under normal conditions and alkali stress treatment; Figure 18 Change of superoxide anion (O2 - ) content under normal conditions and alkali stress treatment; Figure 19 Change of peroxidase (POD) activity under normal conditions and alkali stress treatment; Figure 20 Change of superoxide dismutase (SOD) activity under normal conditions and alkali stress treatment; Figure 21 Change of catalase (CAT) activity under normal conditions and alkali stress treatment.
[0017] In the above figures, different lower case letters indicate significant differences (P < 0.05), and different upper case letters indicate extremely significant differences (P < 0.01). DETAILED DESCRIPTION
[0018] The terms used in the present application have the meanings generally understood by those of ordinary skill in the art, unless otherwise specified. The present application is described in further detail below in conjunction with specific examples and with reference to the data. The following examples are merely intended to illustrate the present application and not to limit the scope of the present application in any way.
[0019] The experimental methods in the following examples are all conventional methods, and are performed according to the techniques or conditions described in the literature in the art or according to the product instructions, unless otherwise specified. The experimental materials, reagents, and medicines used in the following examples can be purchased through general channels, unless otherwise specified.
[0020] In the following examples, Glycine max G07256: Northeastern Glycine max Alkali-Tolerant Variety 'G07256', which was gifted by the Plant Biotechnology Lab of Northeast Agricultural University; pMD19-T vector: purchased from Bao Biological Engineering (Dalian) Co., Ltd; Escherichia coli DH5α: purchased from Nanjing Novizen Biological Technology Co., Ltd; Agrobacterium rhizogenes K599: Beijing Coolab Technology Co., Ltd; Plant expression vector pSuper1300: gifted by China Agricultural University; Glycine max Williams 82 was gifted by Northeast Agricultural University.
[0021] Example 1 Cloning GsRZ1A gene (1) Total RNA of Glycine max G07256 was extracted using RNAsimple total RNA extraction kit (Tiangen, China). cDNA was synthesized using FastKing cDNA first-strand synthesis kit (Tiangen, China), and the cDNA stock solution was diluted five times and stored at -20°C for standby.
[0022] (2) The total cDNA of Glycine max synthesized above was used as a template, and PCR amplification was performed using specific primers of GsRZ1A and KOD HotStart DNA polymerase (Toyobo, Japan).
[0023] The PCR reaction system consisted of: 2 μL 10× Buffer, 2 μL dNTP mix (2 mM each), 0.8 μL MgSO4 (25 mM), 0.6 μL 5' PCR Primer (10 μM), 0.6 μL 3' PCR Primer (10 μM), 0.5 μL cDNA template, 0.2 μL KOD Hot Start DNA Polymerase, and 13.3 μL ddH2O to make up the volume (total volume 20 μL).
[0024] The PCR reaction conditions were: 94℃ 2min → [94℃ 15s → 60℃ 30s → 68℃ 31s] × 30 → 4℃.
[0025] The PCR products were detected by 1% agarose gel electrophoresis. The target band was recovered using the EZNA® Gel Extraction Kit (Omega Bio-tek Inc., USA) and ligated into the pMD19-T vector. The ligation product was transformed into E. coli DH5α, plated on LB agar plates containing ampicillin, and single colonies were picked for identification. Based on the colony PCR results, the identified positive clones were sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing.
[0026] The nucleic acid sequence of the GsRZ1A gene obtained by sequencing is shown in SEQ ID NO:1, and the amino acid sequence it encodes is shown in SEQ ID NO:2.
[0027] SEQ ID NO:1 (5'→3') ATGTCTGACGTGGAAGAGTATCGTTGTTTCATTGGTGGCCTTGCGTGGTCAACATCTGATAGAAAGTTAAAGGATACGTTTGAAAAGTTTGGCAAGCTTATTGAGGCAAAGGTGGTTGTTGACAAGTTCTCTGGGCGTTCTCGTGGTTTTGGATTTGTCACATTTGATGACAAGAAAGCAATGGACGAGGCTATTGATGCTATGAATGGGATGGATTTAGACGGGCGAACTATTACTGTTGATAGAGCTCAGCCTCAACAAGGATCAACTAGAGGTGATGGTGATCGCTACCGGGATCGTGGTCGTGATCGTGACCGAGATCATGGAGGTGGAGGTGGCCGAGGATCTAATGGTGGTGAATGCTTTAAGTGTGGAAAACCTGGTCATTTTGCTAGGGAGTGCCCTAGTGAAGGGTCCAGGGGAGGAAAGTATGGTGGTAGGGAAAGTAGATATGGTGGAAGCAGTGGTGGTGGTTATGGACCAGATAGAGCAGATCGTTCTTCAGGGGGGCGCAGCAGGGGATGGTGGTAG SEQ ID NO:2 MSDVEEYRCFIGGLAWSTSDRKLKDTFEKFGKLIEAKVVVDKFSGRSRGFGFVTFDDKKAMDEAIDAMNGMDLDGRTITVDRAQPQQGSTRGDGDRYRDRGRDRDRDHGGGGGRGSNGGECFKCGKPGHFARECPSEGSRGGKYGGRESRYGGSSGGGYGPDRADRSSGGRSRGWW The specific primer sequences of GsRZ1A are as follows: GsRZ1A-F: 5'-ATGTCTGACGTGGAAGAGTATCGTTG-3' (SEQ ID NO:3); GsRZ1A-R: 5'-CCACCATCCCCTGCTGCG-3' (SEQ ID NO:4); Example 2 (1)Analysis of tissue expression characteristics of GsRZ1A gene Soak plump, disease-free wild soybean seeds (G07256) in concentrated H2SO4 for 8-10 minutes to remove the mud film. Then, pour off the concentrated H2SO4, rinse 3-4 times with sterile water, and inoculate the seeds onto 1 / 2 MS solid medium (pH 5.8). Incubate in the dark at 25°C, and after germination, place them in sunlight for growth. When the seedlings have grown for 3 weeks, collect their roots, stems, leaves, and cotyledons, and flash-freeze them with liquid nitrogen, then store them at -80°C.
[0028] Real-time quantitative PCR (qRT-qPCR) was used to analyze the expression specificity of the GsRZ1A gene in different tissues of soybean (root, stem, leaf, and cotyledon). Total RNA was extracted from the roots, stems, leaves, and cotyledons of soybean and reverse transcribed into cDNA, which was then used as a template. Real-time quantitative PCR (qRT-qPCR) was performed using SYBR Green PCR Master Mix (Toyobo, Japan) on a CFX96 Touch™ real-time PCR detection system (Bio-Rad, USA) to detect the relative expression levels in different tissues. The glyceraldehyde-3-phosphate dehydrogenase (GAPDH) gene was selected as an internal control gene because it showed stable expression under alkaline stress. Two [units of data were used]. -ΔΔCt The method involves relative quantitative analysis of the data, and all samples were subjected to three biological and technical replicate experiments.
[0029] The real-time quantitative primers for the GsRZ1A gene are as follows: RT-GsRZ1A-F: 5'-GCTCAGCCTCAACAAGGATCAA-3' (SEQ ID NO: 5); RT-GsRZ1A-R: 5'-TTTCCACACTTAAAGCATTCACC-3' (SEQ ID NO: 6); The real-time quantitative primers for the internal control GAPDH gene are as follows: RT-GsGAPDH-F: 5'-GACTGGTATGGCATTCCGTGT-3' (SEQ ID NO: 7), RT-GsGAPDH-R: 5'-GCCCTCTGATTCCTCCTTGA-3' (SEQ ID NO: 8).
[0030] The results are as follows Figure 1 As shown, the GsRZ1A gene is expressed in the roots, stems, leaves and cotyledons of wild soybean, with the highest expression level in the cotyledons. There is no significant difference in the relative expression level between the roots and leaves, while the relative expression level is the lowest in the stems.
[0031] (2) Analysis of the expression characteristics of GsRZ1A gene under salt and alkali stress When the wild soybean seedlings grew to 3 weeks, the soybean roots were immersed in 100 mM NaCl and 50 mM NaHCO3, respectively. Total RNA was extracted from the roots and leaves of wild soybean at 0 h, 1 h, 3 h, 6 h and 12 h after treatment, and reverse transcribed into cDNA. Using cDNA as a template, the relative expression level of the GsRZ1A gene after salt and alkali stress was analyzed by real-time quantitative PCR (qRT-qPCR), using the same method as above.
[0032] The relative expression levels of the GsRZ1A gene in soybean leaves and roots under 100 mM NaCl stress at different time points were analyzed using qRT-PCR. The results are as follows: Figure 2 As shown, the relative expression level of the GsRZ1A gene did not change significantly under NaCl stress treatment.
[0033] The relative expression levels of the GsRZ1A gene in soybean leaves and roots under 50 mM NaHCO3 stress at different time points were analyzed using qRT-PCR. The results are as follows: Figure 3 As shown, under NaHCO3 stress, the relative expression level of GsRZ1A in roots was slightly downregulated at 1 h, significantly upregulated at 6 h, and peaked at 12 h, reaching 6 times the expression level at 0 h. In leaves, GsRZ1A expression showed continuous upregulation, peaking at 12 h, reaching 9 times the expression level at 0 h. These results indicate that GsRZ1A expression is significantly induced by alkali stress and may play an important role in the response of wild soybean to alkali stress.
[0034] (3) Analysis of the expression characteristics of GsRZ1A gene under stress-related hormone treatment When the wild soybean seedlings reached 3 weeks of growth, the leaves of wild soybean were sprayed with 100 μM ABA (abscisic acid) and 50 μM MeJA (methyl jasmonate), respectively. Total RNA was extracted from the roots and leaves of wild soybean at 0 h, 1 h, 3 h, 6 h and 12 h after treatment, and reverse transcribed into cDNA. Using cDNA as a template, the relative expression level of the GsRZ1A gene after treatment with stress-related hormones was analyzed by real-time quantitative PCR (qRT-qPCR), using the same method as above.
[0035] The relative expression levels of the GsRZ1A gene in soybean leaves and roots under different time points of 100 μM ABA treatment were analyzed by qRT-PCR. The results are as follows: Figure 4 As shown, under 100 μM ABA treatment, the relative expression level of GsRZ1A in soybean roots was slightly upregulated, with the highest expression level at 12 h; while in leaves, the relative expression level was slightly upregulated at 3 h and significantly upregulated at 12 h, more than 6 times higher than at 0 h.
[0036] The relative expression levels of the GsRZ1A gene in soybean leaves and roots at different time points after treatment with 50 μM MeJA were analyzed using qRT-PCR. The results are as follows: Figure 5 As shown, GsRZ1A expression was not significantly induced in leaves under MeJA treatment, but its expression was consistently upregulated in roots, with the expression level being 2.5 times that of the untreated group after 12 h of treatment.
[0037] Example 3 Subcellular localization of GsRZ1A protein Based on the polyclonal restriction sites of the plant expression vector pSuper1300 carrying the GFP subcellular localization tag, specific amplification primers with restriction sites (Xba I and Kpn I) for GsRZ1A to remove the stop codon were designed: The upstream is 5'-GCTCTAGAATGTCTGACGTGGAAGAGTATCGTTG-3' (SEQ ID NO:9). The downstream component is 5'-GGGGTACCCCACCATCCCCTGCTGCG-3' (SEQ ID NO:10).
[0038] Using the correctly sequenced GsRZ1A-pMD19-T gene as a template, the target gene with restriction enzyme sites was obtained by high-fidelity cloning. The target gene was run on a 1% agarose gel, and after gel recovery, it was ligated into the pMD19-T vector and sent for sequencing. The correctly sequenced pMD19-T-GsRZ1A and pSuper1300 vectors were double-digested with Xba I and Kpn I, respectively. The target gene fragments with restriction sites were recovered and ligated into the pSuper1300 linearized vector, which was then transformed into E. coli. Positive pSuper1300-GsRZ1A-GFP subcellular localization vectors were obtained by colony PCR and restriction enzyme digestion identification. These vectors were then transformed into Agrobacterium rhizogenes K599. Following the published genetic transformation method for soybean hairy roots [Fan, Y.-l., et al., One-step generation of compositesoybean plants with transgenic roots by Agrobacterium rhizogenes-mediated transformation. BMC Plant Biology, 2020. 20(1): p. 208.], Williams was infected. 82 soybeans were used to obtain soybean hairy root material transgenic with GsRZ1A-GFP protein. The expression of the fluorescent protein was observed using a laser confocal microscope at an excitation wavelength of 488 nm to determine the subcellular localization of the target protein. A single GFP transgenic line was used as a control.
[0039] The results are as follows Figure 6 As shown, GFP protein is expressed in all organelles of soybean root cells, while the GsRZ1A-GFP fusion protein is located in the nucleus, indicating that GsRZ1A is a nuclear localization protein.
[0040] Example 4 Application of GsRZ1A gene in improving plant alkali tolerance (1) Construction of GsRZ1A gene overexpression vector Design primers for full-length specific amplification of GsRZ1A gene with restriction enzyme sites (Xba I and Kpn I): OE-GmRZ1A-F: 5'-GCTCTAGAATGTCTGACGTGGAAGAGTATCGTTG-3' (SEQ ID NO: 11), OE-GmRZ1A-R: 5'-GGGGTACCCTACCACCATCCCCTGCTGCG-3' (SEQ ID NO: 12), The target gene was amplified by high-fidelity PCR and recovered by gel extraction. It was then inserted into the plant overexpression vector pSuper1300 through double restriction sites of Xba I and Kpn I, thus obtaining the GsRZ1A gene overexpression vector pSuper1300-GsRZ1A.
[0041] (2) Obtaining soybean hairy root lines transgenic with GsRZ1A gene Transgenic soybean hairy root lines were obtained by transforming Agrobacterium rhizogenes K599 with the GsRZ1A gene overexpression vector pSuper1300-GsRZ1A and infecting Williams 82 soybeans. The hairy root lines were obtained by using the empty vector pSuper1300 as a control.
[0042] GsRZ1A overexpressing soybean lines and empty vector soybean lines (OE-EV) were obtained through Agrobacterium rhizogenes-mediated soybean hairy root genetic transformation. Real-time quantitative PCR was used to detect GsRZ1A gene expression levels in each transformed line, revealing two lines with significantly higher GsRZ1A expression levels than the empty vector transformed lines OE-GsRZ1A-2 and OE-GsRZ1A-5. Figure 7 ).
[0043] (3) Alkali tolerance test of transgenic soybean hairy root lines Two transgenic lines and an empty vector control line were cultured in Hoagland solutions containing 0 and 50 mmol / L NaHCO3, respectively, for 7 days. Phenotypic images of roots and leaves for each treatment group were acquired using an LA-S plant image analyzer system (Wanshen, China). The results are as follows: Figure 8 and Figure 9As shown, under normal conditions, there was no significant difference between the GsRZ1A overexpression line and the empty vector line. Under 50 mmol / L NaHCO3 alkaline stress treatment, the leaf scanning images showed that the leaves of OE-EV were smaller than those of OE-GsRZ1A and also lighter in color. Figure 8 The root scan clearly shows that the roots of OE-EV are sparse due to alkali stress, while the roots of the overexpression lines are much denser. Figure 9 ).
[0044] Image analysis of GsRZ1A overexpressing lines and empty vector lines before and after alkali stress treatment yielded total root length, total root surface area, and total leaf area. Chlorophyll content, relative water content, and relative growth of the GsRZ1A overexpressing lines and empty vector lines before and after alkali stress treatment were also measured. The results are as follows: Figures 10 to 15 As shown, under normal conditions, there were no significant differences in total leaf area, chlorophyll content, relative leaf water content, total root length, total root surface area, and relative plant growth between the GsRZ1A overexpressing lines and the empty vector lines. Under 50 mmol / L NaHCO3 alkaline stress treatment, all indicators were significantly lower than those of the control, but the indicators of the OE-GsRZ1A lines were significantly higher than those of the OE-EV control group, indicating that GsRZ1A has a positive regulatory effect on alleviating alkaline stress.
[0045] Oxidation-related physiological parameters of GsRZ1A overexpressing lines and empty vector lines before and after alkali stress treatment were determined: malondialdehyde (MDA), soluble sugars, and superoxide anions (O2). - The levels of [unspecified substance] and the activities of peroxidase (POD), superoxide dismutase (SOD), and catalase (CAT) were measured using corresponding kits (Solepro Technology Co., Ltd., Beijing). Results are as follows: Figures 16 to 21 As shown, under normal growth conditions, overexpression of GsRZ1A has an effect on malondialdehyde (MDA), soluble sugars, and superoxide anions (O2) in soybean plants. - The content of malondialdehyde (MDA) and the activity of antioxidant protective enzymes were not affected. Under alkaline stress, overexpression of GsRZ1A could inhibit the increase of malondialdehyde (MDA) and superoxide anion content to a certain extent. Compared with the empty vector transformed lines, the activities of peroxidase (POD), superoxide dismutase (SOD), and catalase (CAT) in the GsRZ1A overexpression lines were stronger under alkaline stress, increasing by 26.03%, 17.16%, and 31.34%, respectively. In addition, under alkaline stress, the soluble sugar content of the GsRZ1A overexpression lines was 17.1% higher than that of the empty vector transformed lines. These results indicate that GsRZ1A can alleviate the toxicity of alkaline stress on soybeans by improving antioxidant capacity and the content of isotonic regulators such as saccharides under alkaline stress.
[0046] The above description is merely a preferred embodiment of the present invention and is not intended to limit the invention in any other way. Any person skilled in the art may make changes or modifications to the above-disclosed technical content to create equivalent embodiments. However, any simple modifications, equivalent changes, and modifications made to the above embodiments based on the technical essence of the present invention without departing from the scope of the present invention shall still fall within the protection scope of the present invention.
Claims
1. The application of the GsRZ1A gene in improving plant alkali tolerance, characterized in that, The amino acid sequence encoded by the GsRZ1A gene is shown in SEQ ID NO:
2.
2. The application of the GsRZ1A gene according to claim 1 in improving plant alkali tolerance, characterized in that, The nucleic acid sequence of the GsRZ1A gene is shown in SEQ ID NO:
1.
3. The application of the GsRZ1A gene according to claim 1 in improving plant alkali tolerance, characterized in that, Plant alkali tolerance can be improved by increasing the expression level of the GsRZ1A gene in plants.
4. The application of the GsRZ1A gene according to claim 3 in improving plant alkali tolerance, characterized in that, By constructing the GsRZ1A gene into a plant expression vector and transforming the plant, the expression level of the GsRZ1A gene in the plant can be increased.
5. The application of the GsRZ1A gene according to claim 4 in improving plant alkali tolerance, characterized in that, The method of transforming the plant is one of Agrobacterium-mediated transformation, gene gun transformation, electroporation transformation, PEG transformation, or liposome transformation.
6. The application of the GsRZ1A gene according to claim 5 in improving plant alkali tolerance, characterized in that, The Agrobacterium is Agrobacterium tumefaciens or Agrobacterium rhizogenes.
7. The application of the GsRZ1A gene according to any one of claims 1-6 in improving plant alkali tolerance, characterized in that, The plant in question is soybean.
8. The application of the GsRZ1A gene according to claim 7 in improving plant alkali tolerance, characterized in that, The alkali resistance is at least 50 mM NaHCO3.
Citation Information
Patent Citations
Combination therapy with controlled-release CNP agonists
CN109843295A
Application of splicing factor protein GmRSZ22 in improving alkali resistance of plants
CN117510603A
Novel method for identifying and using upstream open reading frame
CN120077140A
Gshsp gene and uses thereof for improving salt tolerance of soybean and increasing content of isoflavone in soybean seedlings
JP2024102799A
Gene gmerf416 for plant yield increase and / or salt tolerance / saline-alkali tolerance and use thereof
WO2025232902A1
Cited By
Multi-gene tandem plant expression vector for improving alkali resistance of soybeans as well as construction method and application of multi-gene tandem plant expression vector
CN122168674A
A multi-gene tandem plant expression vector for improving alkali tolerance in soybeans, its construction method and application
CN122168674B