Cassava metga9 gene and use thereof

Abstract

This invention belongs to the field of biotechnology, specifically relating to the cassava MeTGA9 gene and its applications. The nucleotide sequence of the cassava MeTGA9 gene is shown in SEQ ID NO:1. Overexpression of the cassava MeTGA9 gene in cassava significantly reduces the plant height and root length of transgenic cassava. The MeTGA9 gene described in this invention is of great significance for cassava genetic improvement, breeding new dwarf cassava varieties, and breeding new cassava varieties suitable for intercropping, providing valuable genetic resources and theoretical basis for breeding new cassava varieties with excellent plant architecture.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to the cassava MeTGA9 gene and its applications. Background Technology

[0002] Cassava (Manihot esculenta Crantz) is a crop of the Euphorbiaceae family, known as the "King of Starch" due to its high light efficiency, high starch yield, drought resistance, and tolerance to poor soil conditions. It is not only the world's sixth largest food crop and one of the three major tuber crops, but also an important industrial and bioenergy raw material.

[0003] TGA transcription factors belong to the D branch of the basic leucine zipper (bZIP) family and have been extensively studied and identified in the plant kingdom. This family of transcription factors plays a crucial role in plant responses to abiotic stresses such as drought, and participates in regulating various biological processes including plant growth and development, signal transduction, hormone homeostasis, and stress defense. Currently, their functions have been extensively reported in major crops such as soybean and maize. This study aims to explore the role of this gene experimentally, providing valuable genetic resources and theoretical basis for breeding new cassava varieties with superior plant architecture. Summary of the Invention

[0004] This invention provides the cassava MeTGA9 gene and its applications.

[0005] The technical solution of this invention is implemented as follows:

[0006] The first aspect of the present invention is to provide a cassava MeTGA9 gene, the nucleotide sequence of which is shown in SEQ ID NO:1.

[0007] A second aspect of the present invention is to provide a protein encoded by the cassava MeTGA9 gene described in the first aspect of the present invention.

[0008] A third aspect of the present invention is to provide a recombinant vector containing the coding region of the cassava MeTGA9 gene as described in the first aspect of the present invention.

[0009] The original vector for the recombinant vector can be a vector commonly used in the field of gene recombination, such as a virus or plasmid. This invention does not limit this. In one specific embodiment of this invention, the original vector is a pGAMBIA1300 expression vector, but it should be understood that other plasmids or viruses can also be used.

[0010] Preferably, the original vector of the recombinant vector is the pGAMBIA1300 expression vector, and the coding region of the cassava MeTGA9 gene is located between the Sal I and BamHI restriction endonuclease sites of the pGAMBIA1300 expression vector.

[0011] A fourth aspect of the invention is to provide a host bacterium containing the coding region of the cassava MeTGA9 gene as described in the first aspect.

[0012] A fifth aspect of the invention is to provide an expression cassette containing the coding region of the cassava MeTGA9 gene as described in the first aspect of the invention.

[0013] The sixth aspect of the present invention is to provide the use of the cassava MeTGA9 gene as described in the first aspect of the present invention, or the protein as described in the second aspect of the present invention, or the recombinant vector as described in the third aspect of the present invention, or the host bacterium as described in the fourth aspect of the present invention, or the expression cassava as described in the fifth aspect of the present invention in reducing cassava plant height and / or reducing cassava root length.

[0014] Furthermore, in the above applications, the cassava MeTGA9 gene is overexpressed.

[0015] The seventh aspect of the present invention is to provide the application of the cassava MeTGA9 gene as described in the first aspect of the present invention, or the protein as described in the second aspect of the present invention, or the recombinant vector as described in the third aspect of the present invention, or the host bacterium as described in the fourth aspect of the present invention, or the expression cassava as described in the fifth aspect of the present invention in the breeding of dwarf cassava varieties.

[0016] The eighth aspect of the present invention is to provide the use of the cassava MeTGA9 gene as described in the first aspect of the present invention, or the protein as described in the second aspect of the present invention, or the recombinant vector as described in the third aspect of the present invention, or the host bacterium as described in the fourth aspect of the present invention, or the expression cassava as described in the fifth aspect of the present invention in screening dwarf cassava varieties and / or breeding transgenic cassava.

[0017] A ninth aspect of the present invention is to provide primer pairs for amplifying the cassava MeTGA9 gene, comprising the following primer pair: Primer F: 5'-CT GTCGAC ATGGCGAGCCACGGGGTTGG-3' and Primer R: 5'-GT GGATCC AAAGTTTGAGAAATGATTTG -3'.

[0018] The beneficial effects of this invention are:

[0019] This study, through transcriptome data analysis, screened a TGA family gene—MeTGA9—closely related to growth and development in cassava. Overexpression of the MeTGA9 gene in cassava significantly affects plant growth and development, particularly plant height and root development, noticeably reducing plant height and root length in transgenic cassava. Given that plant height and root system are key agronomical traits determining cassava yield and quality, reduced plant height improves lodging resistance and enhances ornamental value; reduced root length facilitates intercropping with other plants. Therefore, the MeTGA9 gene described in this invention is of great significance for cassava genetic improvement, the development of dwarf cassava varieties, and the cultivation of suitable intercropping cassava varieties, providing valuable genetic resources and theoretical basis for developing new cassava varieties with superior plant architecture. Attached Figure Description

[0020] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0021] Figure 1 This shows the growth of genetically modified cassava potted plants after 3 months.

[0022] Figure 2 This shows the growth of genetically modified cassava after transplanting to the field. Detailed Implementation

[0023] Example 1: Obtaining the Cassava MeTGA9 Gene

[0024] RNA was extracted from the stems and leaves of potted cassava seedlings using the TIANGEN Plant Polysaccharide and Polyphenol RNA Extraction Kit to obtain total RNA that met the requirements for subsequent experiments. Reverse transcription was performed according to the instructions of the reverse transcription kit (Fastking gDNA Dispelling RTSuperMix, TIANGEN) to obtain cDNA. Using the obtained cDNA as a template, Primer F: 5'-CT was used for... GTCGAC ATGGCGAGCCACGGGGTTGG-3' and Primer R: 5'-GT GGATCCUsing AAAGTTTGAGAAATGATTTG-3' as primers, high-fidelity PCR amplification (PrimeSTAR Max DNA Polymerase, TAKARA) was performed. The PCR product was recovered and verified by sequencing to obtain the correct cassava MeTGA9 gene, the sequence of which is shown in SEQ ID No:1 (containing restriction enzyme sites of Sal I and BamHI).

[0025] The PCR amplification reaction system is as follows:

[0026]

[0027] PCR amplification procedure:

[0028]

[0029] Example 2: Functional Verification of Cassava MeTGA9 Gene

[0030] (1) Construction of overexpression vector

[0031] The nucleotide sequence of the cassava MeTGA9 gene was double-digested with Sal I and BamHI restriction endonucleases on the target fragment and the pCAMBIA1300 vector plasmid, respectively. The digested target fragment and the plant expression vector pCAMBIA1300 fragment were recovered, ligated, transformed, and sequenced to verify their correctness, thus obtaining the pGAMBIA1300-MeTGA9-35s:eGFP overexpression vector.

[0032] (2) Genetic transformation of cassava

[0033] In this experiment, Agrobacterium-mediated transformation was used to transform the pGAMBIA-MeTGA9-1300-35s:eGFP overexpression vector into embryogenic fragile callus cells of the cassava cultivar cv.60444, thereby obtaining transgenic cassava plants.

[0034] The specific steps are as follows:

[0035] The pGAMBIA-MeTGA9-1300-35s:eGFP plasmid was transferred into Agrobacterium GV3101 competent cells using a heat shock method (i.e., 100 μL of competent Agrobacterium cells were placed in a pre-cooled centrifuge tube, 0.1-1 μg of plasmid DNA was added, the centrifuge tube was quickly placed in liquid nitrogen for 5 minutes, the centrifuge tube was quickly removed from the liquid nitrogen and immediately placed in a 37°C water bath for 5 minutes for heat shock). Agrobacterium cells were then spread on solid YEP medium supplemented with kanamycin and rifampicin antibiotics. After colonies grew, PCR identification was performed. PCR-positive colonies were shaken and preserved for subsequent plant infection.

[0036] Embryogenic fragile callus from cassava cultivar cv.60444 was used as recipient material. Agrobacterium tumefaciens containing the pGAMBIA-MeTGA9-1300-35S:eGFP plasmid with an OD of approximately 0.8 was collected by centrifugation, washed twice with MS antibiotic-free medium, and resuspended in an equal volume of MS medium supplemented with 200 mmol / L acetylsyringone. A small amount of embryogenic fragile callus was added and suspended at room temperature for 40 min. After centrifugation, the bacterial suspension was removed, and the callus cells were placed on MS solid medium supplemented with 100 mmol / L acetylsyringone and cultured in the dark at 22°C for 3 days. After repeatedly washing the callus cells with sterile water, the callus cells were placed on GD solid medium supplemented with 500 mg / L carbenicillin and 5 mg / L hygromycin and cultured at 26°C under light for 2 weeks. Cells that did not successfully transform were eliminated and resistant callus cells were induced. The callus cells were then transferred to embryo induction medium supplemented with 500 mg / L carbenicillin and 5 mg / L hygromycin to obtain resistant transgenic plants.

[0037] (3) Results statistics

[0038] After three months of pot cultivation, the plant height and root length of the genetically modified cassava were measured. The results are shown in Tables 1 and 2. Figure 1-2 The results showed that the plant height and root length of the genetically modified cassava were significantly reduced, and significantly lower than those of the wild type.

[0039] Table 1 Comparison of cassava plant height

[0040]

[0041] Table 2 Comparison of root length of cassava plants

[0042]

[0043] The potted cassava plants were transplanted to the field on July 4, 2025. Plant height was measured 15 days (July 19) and 30 days (August 3) after transplanting. The results are as follows: Figure 2 The results showed that after transplanting to the field, the plant height of the genetically modified cassava was significantly lower than that of the wild type.

[0044] The above results indicate that the MeTGA9 gene can affect the growth and development of cassava plants, with a particularly significant impact on plant height and root development.

[0045] Dwarf cassava varieties exhibit strong lodging resistance, and the MeTGA9 gene significantly reduces cassava plant height, providing a new candidate gene for breeding dwarf, lodging-resistant cassava varieties. Furthermore, with the promotion of intercropping in forests, dwarf cassava varieties are also suitable for intercropping. In this invention, the root length of MeTGA9-transgenic cassava plants is also significantly reduced, minimizing nutrient competition with other crops during intercropping or understory cultivation, making them more suitable for intercropping with other plants. Therefore, this invention provides valuable genetic resources for breeding new cassava varieties with excellent plant architecture.

[0046] The specific embodiments of the present invention have been described in detail above, but they are merely examples, and the present invention is not limited to the specific embodiments described above. For those skilled in the art, any equivalent modifications and substitutions to the present invention are also within the scope of the present invention. Therefore, all equivalent transformations and modifications made without departing from the spirit and scope of the present invention should be covered within the scope of the present invention.

Claims

1. The application of the cassava MeTGA9 gene, or the protein encoded by the cassava MeTGA9 gene, or a recombinant vector, host bacterium, or expression cassava containing the coding region of the cassava MeTGA9 gene, in reducing cassava plant height and / or reducing cassava root length, wherein the nucleotide sequence of the cassava MeTGA9 gene is shown in SEQ ID NO:1, and overexpression of the cassava MeTGA9 gene in cassava reduces cassava plant height and / or reduces cassava root length.

2. The application of the cassava MeTGA9 gene, or the protein encoded by the cassava MeTGA9 gene, or a recombinant vector, host bacterium, or expression cassette containing the coding region of the cassava MeTGA9 gene, in the breeding of dwarf cassava varieties, wherein the nucleotide sequence of the cassava MeTGA9 gene is shown in SEQ ID NO:1, and dwarf cassava varieties are obtained by overexpressing the cassava MeTGA9 gene in cassava.

3. The application as described in claim 1 or 2, characterized in that, The original vector of the recombinant vector was the pGAMBIA1300 expression vector, and the coding region of the cassava MeTGA9 gene was located between the Sal I and BamHI restriction endonuclease sites of the pGAMBIA1300 expression vector.

4. The application of the cassava MeTGA9 gene, or the protein encoded by the cassava MeTGA9 gene, or a recombinant vector, host bacterium, or expression cassava containing the coding region of the cassava MeTGA9 gene, in screening dwarf cassava varieties and / or breeding transgenic cassava, wherein the nucleotide sequence of the cassava MeTGA9 gene is shown in SEQ ID NO:1, and the cassava MeTGA9 gene is overexpressed in dwarf cassava varieties.

5. The application as described in claim 4, characterized in that, The original vector of the recombinant vector was the pGAMBIA1300 expression vector, and the coding region of the cassava MeTGA9 gene was located between the Sal I and BamHI restriction endonuclease sites of the pGAMBIA1300 expression vector.

Images