Acyltransferase mutant with high acetylation activity and application thereof

Abstract

The invention discloses an acyltransferase mutant with high acetylation activity and application of the acyltransferase mutant, and belongs to the technical field of enzyme engineering. The acyltransferase mutant provided by the invention contains one or more mutation sites of the 12th site, the 94th site, the 154th site, the 194th site and the 195th site on the basis of the acyltransferase mutant with the corresponding amino acid sequence shown as SEQ ID NO.1. Compared with an original enzyme before mutation, the acyltransferase mutant obtained by the invention has higher acyltransferase activity and catalytic efficiency, and the yield of N-acetyl-trans-4-hydroxyproline can be increased. Therefore, the acyltransferase mutant disclosed by the invention has important significance in efficient biosynthesis of N-acetyl-trans-4-hydroxyproline, and has a wide application prospect in the fields of biological materials, medicines or cosmetics.

Description

Technical Field

[0001] This invention relates to a mutant acyltransferase with high acetylation activity and its applications, belonging to the field of enzyme engineering technology. Background Technology

[0002] N-acetyl-trans-4-hydroxyproline is an important amino acid derivative widely used in the fields of beauty, skincare, and biomedicine. It is mainly used as an anti-aging, anti-wrinkle, and moisturizing ingredient, as well as for the treatment of osteoarthritis and rheumatoid arthritis.

[0003] Traditional synthetic methods rely on the chemical reaction between trans-4-hydroxy-L-proline and acetylation reagents, which suffers from problems such as complex processes, low efficiency, high production costs, and adverse environmental impacts, limiting their application in large-scale industrial production. Therefore, developing more efficient and environmentally friendly synthetic methods has become a current research focus.

[0004] To overcome the limitations of traditional synthetic methods, bio-enzyme-catalyzed synthesis has gained increasing attention in recent years. This involves utilizing enzymes derived from Mycobacterium smegma (…). Mycobacterium smegmatis The acyltransferase MsAcT catalyzes the synthesis of N-acetyl-trans-4-hydroxyproline, showing promising development potential. The inventors' earlier patent (ZL 202411990785.1) disclosed an acyltransferase mutant D62K, which achieved a yield of 7.27 g / L and a conversion rate of 16.80% in the hydroxyproline reaction. A subsequent patent (ZL 202411990790.2) further increased the yield to 9.27 g / L and the conversion rate to 21.42% by enhancing the hydrophobicity of the substrate binding pocket and optimizing reaction conditions.

[0005] However, the current conversion rate of hydroxyproline is still low, making it difficult to support industrialization, and the catalytic efficiency of the enzyme urgently needs to be significantly improved. Therefore, developing an acyltransferase mutant with high acetylation activity has extremely high practical and economic value. Summary of the Invention

[0006] To further explore the potential of acyltransferase (MsAcT) and improve its enzyme activity, this invention provides an acyltransferase mutant. Compared with the original mutant, the mutant significantly improves the conversion rate of trans-4-hydroxy-L-proline, thereby further increasing the yield of N-acetyl-trans-4-hydroxyproline.

[0007] The first objective of this invention is to provide an acyltransferase mutant, wherein the acyltransferase mutant has an amino acid mutation at histidine position 195, based on the acyltransferase mutant with the corresponding amino acid sequence as shown in SEQ ID NO.1.

[0008] In one embodiment, the nucleotide sequence of the acyltransferase mutant with the amino acid sequence shown in SEQ ID NO.1 is shown in SEQ ID NO.2.

[0009] In one embodiment, the acyltransferase mutant is based on the acyltransferase mutant with the corresponding amino acid sequence as shown in SEQ ID NO.1, wherein the histidine at position 195 is mutated to any one of arginine, asparagine, threonine, tyrosine, alanine, valine, cysteine ​​or proline. Optionally, the histidine at position 195 may be mutated to any one of asparagine, valine, or proline.

[0010] In one embodiment, the acyltransferase mutant also has one or more amino acid mutations at position 94, 154, or 194. Optionally, the asparagine at position 94 is mutated to alanine; Optionally, the phenylalanine at position 154 is mutated to valine; Optionally, isoleucine at position 194 is mutated to alanine.

[0011] In one embodiment, the acyltransferase mutant is based on the acyltransferase mutant with the corresponding amino acid sequence as shown in SEQ ID NO.1, wherein asparagine at position 94 is mutated to alanine, phenylalanine at position 154 is mutated to valine, isoleucine at position 194 is mutated to alanine, and histidine at position 195 is mutated to asparagine, valine, or proline.

[0012] In one embodiment, the acyltransferase mutant is based on the acyltransferase mutant with the corresponding amino acid sequence as shown in SEQ ID NO.1, with the asparagine at position 94 mutated to alanine, the phenylalanine at position 154 mutated to valine, the isoleucine at position 194 mutated to alanine, and the histidine at position 195 mutated to asparagine. The acyltransferase mutant shown is named R5-1, and the amino acid sequence is shown in SEQ ID NO.4.

[0013] In one embodiment, the acyltransferase mutant is based on the acyltransferase mutant with the corresponding amino acid sequence as shown in SEQ ID NO.1, with the asparagine at position 94 mutated to alanine, the phenylalanine at position 154 mutated to valine, the isoleucine at position 194 mutated to alanine, and the histidine at position 195 mutated to valine. The acyltransferase mutant shown is named R5-2, and the amino acid sequence is shown in SEQ ID NO.5.

[0014] In one embodiment, the acyltransferase mutant is based on the acyltransferase mutant with the corresponding amino acid sequence as shown in SEQ ID NO.1, with the asparagine at position 94 mutated to alanine, the phenylalanine at position 154 mutated to valine, the isoleucine at position 194 mutated to alanine, and the histidine at position 195 mutated to proline. The acyltransferase mutant shown is named R5-3, and the amino acid sequence is shown in SEQ ID NO.6.

[0015] A second object of the present invention is to provide a gene encoding any of the above-described acyltransferase mutants or a recombinant vector carrying the gene of the said acyltransferase mutant; Optionally, the recombinant vector includes pET-28a(+), pET-32a(+), pET-21a(+), pET-22b(+), pET-50b(+), etc.

[0016] A third object of the present invention is to provide recombinant cells expressing any of the above-described acyltransferase mutants or carrying the above-described genes or recombinant vectors; Optionally, the recombinant cells use bacteria or fungi as expression hosts.

[0017] Optionally, the host of the recombinant cells is E. coli-BL21 (DE3), Rosetta (DE3), E. coli-BL21 (DE3) Star, E. coli-BL21 (DE3) pLysS, etc.

[0018] A fourth object of the present invention is a catalyst containing any of the above-described acyltransferase mutants; Optionally, the catalyst is: Culture recombinant expression transformants, isolate transformant cells expressing recombinant enzymes containing any of the above-mentioned acyltransferase mutant sequences, and obtain the recombinant enzyme catalyst; Optionally, the catalyst is: The recombinant expression transformant is cultured, and the transformant cells expressing the recombinant enzyme containing any of the above-mentioned acyltransferase mutant sequences are isolated. The transformant cells expressing the recombinant enzyme are lysed to obtain cell lysate, and the recombinant enzyme catalyst is obtained. Optionally, the catalyst is: The recombinant expression transformant is cultured, and the transformant cells expressing the recombinant enzyme containing any of the above-mentioned acyltransferase mutant sequences are isolated. The transformant cells expressing the recombinant enzyme are lysed to obtain cell lysate, and the cell lysate is freeze-dried to obtain lyophilized enzyme powder, thus obtaining the recombinant enzyme catalyst.

[0019] A fourth object of the present invention is to provide the application of any of the above-described acyltransferase mutants, or the above-described recombinant cells, or the above-described recombinase catalysts in the fields of biomaterials, pharmaceuticals, or cosmetics.

[0020] Optionally, the application is in the catalytic preparation of N-acetyl-trans-4-hydroxyproline from the substrate trans-4-hydroxy-L-proline.

[0021] The fourth objective of this invention is to provide a method for the catalytic synthesis of N-acetyl-trans-4-hydroxyproline, characterized in that any of the above-mentioned acyltransferase mutants, the above-mentioned recombinant cells, or the above-mentioned recombinase catalysts are added to a reaction system containing trans-4-hydroxy-L-proline and an acyl donor to prepare N-acetyl-trans-4-hydroxyproline. Optionally, the acyl donor is vinyl acetate; Optionally, the reaction system also contains phosphate buffer; Optionally, the reaction system also contains a surfactant; Optionally, the surfactant is PEG 4000, Triton-X 100, Tween 20, AEO-9 or DMSO; Optionally, the surfactant is PEG 4000 and DMSO; Optionally, the application involves adding the acyltransferase mutant, the recombinant cell, or the recombinase catalyst to a reaction system containing trans-4-hydroxy-L-proline, vinyl acetate, PEG 4000, and DMSO to prepare N-acetyl-trans-4-hydroxyproline. Optionally, the amount of trans-4-hydroxy-L-proline added is 5~300 mM, the amount of vinyl acetate added is 2~20 %v / v, the amount of PEG 4000 added is 1~2 g / L, and the amount of DMSO added is 1~4 g / L.

[0022] The fifth objective of this invention is to provide a method for increasing the yield or conversion rate of N-acetyl-trans-4-hydroxyproline, characterized in that any of the above-mentioned acyltransferase mutants, recombinant cells, or recombinase catalysts are added to a reaction system containing trans-4-hydroxy-L-proline and an acyl donor to prepare N-acetyl-trans-4-hydroxyproline. Optionally, the acyl donor is vinyl acetate; Optionally, the reaction system also contains phosphate buffer; Optionally, the reaction system also contains a surfactant; Optionally, the surfactant is PEG 4000, Triton-X 100, Tween 20, AEO-9 or DMSO; Optionally, the surfactant is PEG 4000 and DMSO; Optionally, the application involves adding the acyltransferase mutant, the recombinant cell, or the recombinase catalyst to a reaction system containing trans-4-hydroxy-L-proline, vinyl acetate, PEG 4000, and DMSO to prepare N-acetyl-trans-4-hydroxyproline. Optionally, the amount of trans-4-hydroxy-L-proline added is 5~300 mM, the amount of vinyl acetate added is 2~20 %v / v, the amount of PEG 4000 added is 1~2 g / L, and the amount of DMSO added is 1~4 g / L.

[0023] Optionally, the amount of trans-4-hydroxy-L-proline added is 5~30 mM, and the amount of vinyl acetate added is 10~15% v / v.

[0024] Beneficial effects of the present invention This invention successfully obtained a MsAcT mutant with high acetylation activity by rationally designing catalytic residues and using PCR to perform saturation mutagenesis.

[0025] Compared to the original enzyme MsAcT (S11C / L12A), this mutant exhibits higher acetylation activity and catalytic efficiency. Among them, mutant R5-3 performed best, achieving a yield of 1.76 g / L of N-acetyl-trans-4-hydroxyproline with a conversion rate of 50.94% when catalyzing the substrate alone, which is 6.52 times higher than the original enzyme. After adding a surfactant, its yield of N-acetyl-trans-4-hydroxyproline was further increased to 2.07 g / L with a conversion rate of 59.64%.

[0026] The acyltransferase mutant of the present invention is of great significance in the efficient biosynthesis of N-acetyl-trans-4-hydroxyproline and shows broad application prospects in the fields of biomaterials, medicine and cosmetics. Attached Figure Description

[0027] Figure 1 This is an SDS-PAGE image of a single mutant.

[0028] Figure 2 This is an SDS-PAGE plot of multiple mutants. Detailed Implementation

[0029] The technical solutions described below will be clearly and completely described with reference to the embodiments of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention. Unless otherwise specified, the materials and reagents used in the embodiments can be obtained commercially.

[0030] Culture media and buffer solutions involved in the examples: LB solid medium (1 L): 10 g tryptone, 5 g yeast extract, 10 g NaCl, 17 g agar powder.

[0031] LB liquid medium: 10 g tryptone, 5 g yeast extract, 10 g NaCl, dissolved in deionized water and brought to a final volume of 1000 mL.

[0032] Binding Buffer: Dissolve 17.54 g of NaCl and 6.00 g of NaH2PO4 in deionized water and bring the volume to 1000 mL. Adjust the pH to 8 with NaOH solution.

[0033] Elution buffers for different concentrations of imidazole: NaCl 29.22 g, Tris 2.42 g, imidazole 0.68 / 27.23 g (2 / 400 mM) were dissolved in deionized water and brought to a final volume of 1000 mL. The pH was then adjusted to 8 with hydrochloric acid.

[0034] trans-4-hydroxy-L-proline, surfactants, reagents, consumables, and competent cells were all purchased from Sangon Biotech (Shanghai) Co., Ltd.

[0035] Detection methods N-acetyl-trans-4-hydroxyproline production Add 4 times the volume of methanol to the reacted sample and mix well. After the mixture is allowed to stand at -20 °C for 4 h, it is centrifuged at 12000 rpm for 5 min at 4 °C. The supernatant is then collected for detection by high performance liquid chromatography.

[0036] HPLC detection conditions: A Waters ultra-high performance liquid chromatograph was used for liquid phase separation via a Hypercarb column (2.5 × 180 mm). The flow rate was 0.5 mL / min, mobile phase A was 0.2% formic acid aqueous solution, and mobile phase B was 2% formic acid acetonitrile solution. The column temperature was set at 40 ℃, the detection wavelength was 200 nm, and the run time for each sample was 12 minutes.

[0037] The conversion rate of N-acetyl-trans-4-hydroxyproline is calculated as follows: N-acetyl-trans-4-hydroxyproline conversion rate = (Actual molar amount of N-acetyl-trans-4-hydroxyproline in the system) / (Amount of trans-4-hydroxy-L-proline added in the system) × 100%.

[0038] Example 1: Acyltransferase-catalyzed saturation mutation of residue H195 1. Construction of mutant recombinant plasmids (1) The gene encoding the acyltransferase mutant MsAcT (S11C / L12A) with the amino acid sequence shown in SEQ ID NO.1 was chemically synthesized (the nucleotide sequence of the gene is shown in SEQ ID NO.2); wherein MsAcT (S11C / L12A) is obtained by mutating serine at position 11 to cysteine ​​and leucine at position 12 to alanine in the amino acid sequence of wild-type acyltransferase MsAcT. (2) Construction of the recombinant vector: Using the primers in Table 1, the acyltransferase MsAcT-S11C / L12A sequence was ligated to the commercial plasmid pET22b as the backbone. Using the 22b(+) vector as the template for the target gene, linearization amplification was performed using PCR technology. After linearization amplification, the target gene MsAcT(S11C / L12A) was ligated into the pET22b vector using One Step Seamless Cloning Mix homologous recombinase at 50℃ for 30 min, resulting in the recombinant vector pET. 22b(+)-MsAcT(S11C / L12A); Table 1 Primer Sequences

[0039] (3) Using recombinant plasmid pET 22b(+) Using the nucleotide sequence of MsAcT(S11C / L12A) as a template, primers containing mutation sites were designed. The histidine at position 195 of the acyltransferase mutant MsAcT(S11C / L12A, or the S11C / L12A mutant), whose amino acid sequence is shown in SEQ ID NO.1, was mutated to the basic amino acids arginine and lysine, respectively. This yielded the recombinant plasmid pET encoding MsAcT(S11C / L12A / H195R, or the H195R mutant) and MsAcT(S11C / L12A / H195K, or the H195K mutant). 22b(+) MsAcT (S11C / L12A / H195R), pET 22b(+) MsAcT (S11C / L12A / H195K); The recombinant plasmid pET was obtained by mutating MsAcT (S11C / L12A / H195S, or H195S mutant), MsAcT (S11C / L12A / H195T, or H195T mutant), MsAcT (S11C / L12A / H195N, or H195N mutant), and MsAcT (S11C / L12A / H195Q, or H195Q mutant) to the polar amino acids serine, threonine, asparagine, and glutamine, respectively. 22b(+) MsAcT (S11C / L12A / H195S), pET 22b(+) MsAcT (S11C / L12A / H195T), pET 22b(+) MsAcT (S11C / L12A / H195N), pET 22b(+) MsAcT (S11C / L12A / H195Q); The amino acids phenylalanine, tyrosine, and tryptophan were mutated to obtain recombinant plasmid pET encoding MsAcT (S11C / L12A / H195F, or H195F mutant), MsAcT (S11C / L12A / H195Y, or H195Y mutant), and MsAcT (S11C / L12A / H195W, or H195W mutant). 22b(+) MsAcT (S11C / L12A / H195F), pET 22b(+) MsAcT (S11C / L12A / H195Y), pET 22b(+) MsAcT (S11C / L12A / H195Q); The nonpolar amino acids alanine, valine, leucine, isoleucine, and methionine were mutated to obtain recombinant plasmid pET encoding MsAcT (S11C / L12A / H195A, or H195A mutant), MsAcT (S11C / L12A / H195V, or H195V mutant), MsAcT (S11C / L12A / H195L, or H195L mutant), MsAcT (S11C / L12A / H195I, or H195I mutant), and MsAcT (S11C / L12A / H195M, or H195M mutant). 22b(+) MsAcT (S11C / L12A / H195A), pET 22b(+) MsAcT (S11C / L12A / H195V), pET 22b(+) MsAcT (S11C / L12A / H195L), pET 22b(+) MsAcT (S11C / L12A / H195I), pET 22b(+) MsAcT (S11C / L12A / H195M); The mutation to the sulfur-containing amino acid cysteine ​​yielded the recombinant plasmid pET encoding MsAcT (S11C / L12A / H195C, or the H195C mutant). 22b(+) MsAcT (S11C / L12A / H195C); The amino acids aspartic acid and glutamic acid were mutated respectively to obtain recombinant plasmid pET encoding MsAcT (S11C / L12A / H195D, or H195D mutant) and MsAcT (S11C / L12A / H195E, or H195E mutant). 22b(+) MsAcT (S11C / L12A / H195D), pET 22b(+) MsAcT (S11C / L12A / H195E); The mutation to the highly flexible amino acid glycine yielded the recombinant plasmid pET encoding MsAcT (S11C / L12A / H195G, or the H195G mutant). 22b(+) MsAcT (S11C / L12A / H195G); The mutation to the conformation-restricting amino acid proline yielded the recombinant plasmid pET encoding MsAcT (S11C / L12A / H195P, or the H195P mutant). 22b(+) MsAcT (S11C / L12A / H195P), primer sequences are shown in Table 2.

[0040] The PCR reaction system is shown in Table 3. The PCR reaction conditions are 95 ℃ for 30 s; 95 ℃ for 10 s, 58 ℃ for 5 s, 72 ℃ for 3 min, for a total of 30 cycles; 72 ℃ for 5 min; and stored at 4 ℃.

[0041] PCR products were detected by 1% agarose gel electrophoresis. The PCR products were transformed into E. coli BL21(DE3) competent cells, positive transformants were picked, plasmids were extracted, and sequenced for verification. Finally, recombinant plasmids encoding 19 mutants were successfully constructed.

[0042] Table 2 Primer List

[0043] Table 3 PCR reaction system

[0044] Example 2: Expression Analysis and Purification of Acyltransferase Mutant Proteins 1. Acyltransferase mutant protein induced expression The 20 recombinant plasmids obtained in Example 1 were transformed into Escherichia coli BL21(DE3) competent cells using the heat shock method to construct recombinant Escherichia coli, which contained recombinant plasmids or mutant plasmids.

[0045] Twenty successfully constructed recombinant *E. coli* strains were inoculated into 4 mL of LB liquid medium containing ampicillin (100 μg / mL) and cultured at 37 °C and 200 rpm for 12 hours to activate the cells. Subsequently, the activated bacterial culture was inoculated into 50 mL of LB liquid medium at a 2% (v / v) inoculation rate and cultured at 37 °C and 220 rpm for 1–2 hours until OD (dose dispersibility) was reached. 600The concentration was increased to 0.6-0.8. After induction, the fermentation broth was centrifuged at 4℃ and 5000 rpm for 5 min to collect the cells. The cells were resuspended in 20 mL Binding Buffer (50 mM NaH2PO4, 300 mM NaCl, pH 8.0) and sonicated in an ice-water bath (55% power, 3 s sonication, 2 s interval, total duration 25 min). The lysed sample was centrifuged at 4℃ and 10000 rpm for 40 min, and the supernatant was collected. After filtration through a 0.22 μm filter membrane, the supernatant was used as the crude enzyme solution and stored at 4℃.

[0046] 2. Protein purification The crude enzyme obtained in step 1 was loaded onto a pre-equilibrated nickel column. First, non-specifically bound proteins were eluted with 10 column volumes of low-concentration elution buffer (2 mM imidazole). Then, the target protein was eluted with 3 column volumes of high-concentration elution buffer (400 mM imidazole). The eluent containing the target protein was collected and dialyzed overnight with ultrapure water at 4 °C to remove imidazole. After dialyzing, the solution was concentrated using an ultrafiltration tube to obtain purified enzyme solutions of different mutants, which were stored at 4 °C for later use. Finally, the protein concentration was determined using the Bradford method, and the protein purity was detected by 10% SDS-PAGE gel electrophoresis. The results are shown below. Figure 1 As shown.

[0047] Example 3: Acyltransferase mutant catalyzes the synthesis of N-acetyl-trans-4-hydroxyproline The purified mutant enzyme solutions obtained in Example 2 were used to test their catalytic synthesis effects, as detailed below: The reaction volume is 200 mL; Experimental group: trans-4-hydroxy-L-proline and 10% (v / v) vinyl acetate were added to 50 mM phosphate buffer (pH 8.0) to a final concentration of 20 mM, followed by the addition of purified enzyme solutions of different mutants to a final concentration of 1 mg / mL. Control group: trans-4-hydroxy-L-proline and 10% (v / v) vinyl acetate were added to 100 mM phosphate buffer (pH 7.0) to a final concentration of 250 mM, without adding enzyme solution.

[0048] The above solution was reacted at 37 °C for 12 h, and samples were taken to detect the concentration of N-acetyl-trans-4-hydroxyproline in the samples after the reaction.

[0049] The N-acetyl-trans-4-hydroxyproline yields of different mutants are shown in Table 4. The results show that, compared with the original enzyme MsAcT (S11C / L12A), the N-acetyl-trans-4-hydroxyproline yields of three mutants were significantly increased, with yields greater than 0.5 g / L. These mutants were H195N, H195V, and H195P, with N-acetyl-trans-4-hydroxyproline yields of 1.11 g / L, 0.76 g / L, and 0.69 g / L, respectively, and conversion rates of 31.96%, 22.19%, and 20.02%. Compared with MsAcT (S11C / L12A), the catalytic efficiencies were increased by 3.97 times, 2.75 times, and 2.48 times, respectively.

[0050] Table 4. Determination of N-acetyl-trans-4-hydroxyproline yield in acyltransferase mutants

[0051] Example 4: Construction, expression, purification, and catalytic synthesis of N-acetyl-trans-4-hydroxyproline from a combinatorial mutant 1. Construction strategy of combined mutants Based on the results of Examples 1-3 above, mutants H195N, H195V, and H195P can all significantly improve MsAcT acetylation activity and increase N-acetyl-trans-4-hydroxyproline.

[0052] Previous studies have identified a mutant (S11C / L12A / N94A / F154V / I194A; amino acid sequence as shown in SEQ ID NO.3, named R4-2) that alters the microenvironment of the active pocket. This mutant yields 1.44 g / L of N-acetyl-trans-4-hydroxyproline with a conversion rate of 40.95%, demonstrating significant potential for enhancing acetylation activity.

[0053] The three superior H195 mutants mentioned above were further superimposed on R4-2 in order to produce a cumulative or synergistic effect on catalytic activity. Therefore, the following three combined mutants were constructed: Based on the acyltransferase mutant R4-2 with the amino acid sequence shown in SEQ ID NO.3, histidine at position 195 was mutated to asparagine, valine, and proline, respectively, to obtain MsAcT (S11C / L12A / N94A / F154V / I194A / H195N, named R5-1, amino acid sequence shown in SEQ ID NO.4), MsAcT (S11C / L12A / N94A / F154V / I194A / H195V, named R5-2, amino acid sequence shown in SEQ ID NO.5), and MsAcT (S11C / L12A / N94A / F154V / I194A / H195P, named R5-3, amino acid sequence shown in SEQ ID NO.6) mutants.

[0054] 2. Construction, expression, and purification of combinatorial mutants The recombinant plasmid pET obtained earlier 22b(+) Using MsAcT (S11C / L12A / N94A / F154V / I194A) as a template, the above mutants were constructed by amplifying the primer sequences shown in Table 5.

[0055] PCR products were detected by 1% agarose gel electrophoresis. The recombinant plasmid pET, which was successfully sequenced and verified, was then analyzed. 22b(+) MsAcT (S11C / L12A / N94A / F154V / I194A / H195N), pET 22b(+) MsAcT (S11C / L12A / N94A / F154V / I194A / H195V) and pET respectively 22b(+) The specific implementation method for transforming MsAcT (S11C / L12A / N94A / F154V / I194A / H195P) into Escherichia coli BL21(DE3) chemocompetent cells, inducing expression, and purifying the protein is the same as in Example 2.

[0056] SDS PAGE electrophoresis was used to detect protein expression. All mutant combinations were able to achieve soluble expression, and the proteins were successfully purified by nickel column affinity chromatography.

[0057] Three purified enzyme solutions were finally obtained: one for mutant R5-1, one for mutant R5-2, and one for mutant R5-3. The results are as follows: Figure 2 As shown.

[0058] Table 5 Primer List

[0059] Example 5: Synthesis of N-acetyl-trans-4-hydroxyproline catalyzed by combinatorial mutants The purified enzyme solutions of the combined mutants R5-1, R5-2 and R5-3 obtained in Example 4 were used to determine the yield of N-acetyl-trans-4-hydroxyproline catalyzed by the combined mutants. The determination method was the same as in Example 3.

[0060] The results of synthesizing N-acetyl-trans-4-hydroxyproline using trans-4-hydroxy-L-proline and vinyl acetate as substrates are shown in Table 6. Among them, R5-3 had the highest yield of 1.76 g / L, which was 123% higher than that of the R4-2 mutant and 159% higher than that of the H195N mutant.

[0061] Table 6. Determination of N-acetyl-trans-4-hydroxyproline yield in acyltransferase mutants.

[0062] Example 6: Optimization of Synthetic Parameters for N-acetyl-trans-4-hydroxyproline 1. Concentration of trans-4-hydroxy-L-proline The purified enzyme solution of R5-3 obtained in Example 4 was used to detect the effect of trans-4-hydroxy-L-proline concentration on the synthesis of N-acetyl-trans-4-hydroxyproline, as detailed below: Based on Example 3, the reaction system was: 50 mM phosphate buffer (pH 8.0), 10% (v / v) vinyl acetate, and 1 mg / mL purified enzyme solution; the final concentration of trans-4-hydroxy-L-proline was changed to 5 mM, 10 mM, 20 mM, 50 mM, 100 mM, 150 mM, 200 mM, or 300 mM, while the other steps remained the same, and the yield of N-acetyl-trans-4-hydroxyproline was detected.

[0063] The results are shown in Table 7. The highest conversion rate, reaching 50.36%, was achieved when the concentration of trans-4-hydroxy-L-proline was 20 mM.

[0064] Table 7. Yield determination of N-acetyl-trans-4-hydroxyproline by different amounts of trans-4-hydroxy-L-proline.

[0065] 2. Vinyl acetate concentration Based on Example 3, the reaction system consisted of 50 mM phosphate buffer (pH 8.0), 20 mM trans-4-hydroxy-L-proline, and 1 mg / mL enzyme solution. The concentration of vinyl acetate was changed to 2% (v / v), 5% (v / v), 8% (v / v), 10% (v / v), 15% (v / v), and 20% (v / v), while the other steps remained the same. The yield of N-acetyl-trans-4-hydroxyproline was then measured.

[0066] The results are shown in Table 8. The results indicate that when the concentration of vinyl acetate added is greater than 10% (v / v), the conversion rate increases significantly but decreases further, and when it exceeds 15% (v / v), the conversion rate begins to decline. Considering both economic factors and subsequent separation and purification, a vinyl acetate concentration of 10% is preferred.

[0067] Table 8. Yield determination of N-acetyl-trans-4-hydroxyproline synthesized with different vinyl acetate addition amounts

[0068] 3. Types of surfactants Based on Example 3, the reaction system consisted of: 50 mM phosphate buffer (pH 8.0), 20 mM trans-4-hydroxy-L-proline, 10% (v / v) vinyl acetate, and 1 mg / mL purified enzyme solution; PEG 4000, DMSO, Triton-X 100, Tween 20, or AEO 9 were added to a final concentration of 1 g / L, respectively, and the yield of N-acetyl-trans-4-hydroxyproline was detected.

[0069] The results are shown in Table 9. The results indicate that the addition of PEG 4000 and DMSO had the most significant effects on the synthesis of N-acetyl-trans-4-hydroxyproline.

[0070] Table 9. Yield determination of N-acetyl-trans-4-hydroxyproline synthesized with different surfactants

[0071] Example 9: Synthesis of N-acetyl-trans-4-hydroxyproline by adding PEG 4000 and DMSO 4. PEG 4000 and DMSO blending ratio Based on Example 3, the reaction system consisted of: 50 mM phosphate buffer (pH 8.0), 20 mM trans-4-hydroxy-L-proline, 10% (v / v) vinyl acetate, and 1 mg / mL purified enzyme solution; PEG4000 and DMSO as shown in Table 10 were added additionally to detect the yield of N-acetyl-trans-4-hydroxyproline.

[0072] The results are shown in Table 11. The results indicate that the addition of 1.5 g / L PEG 4000 and 3 g / L DMSO had the most significant impact on the synthesis of N-acetyl-trans-4-hydroxyproline, with the yield of N-acetyl-trans-4-hydroxyproline reaching 2.07 g / L, which was 112% and 114% higher than that of adding PEG 4000 and DMSO alone, respectively; the conversion rate of trans-4-hydroxy-L-proline reached 59.64%.

[0073] Table 10. PEG 4000 and DMSO compound ratio

[0074] Table 11. Complexation of PEG 4000 and DMSO into N-acetyl-trans-4-hydroxyproline

[0075] The results in summary indicate that the optimal conditions for the synthesis of N-acetyl-trans-4-hydroxyproline are: 50 mM phosphate buffer (pH 8.0), 20 mM trans-4-hydroxy-L-proline, 10% (v / v) vinyl acetate, 1 mg / mL purified enzyme solution, 1.5 g / L PEG 4000 and 3 g / L DMSO.

[0076] The sequence involved in this invention is shown below: SEQ ID NO.1: MAKRILCFGDCATWGWVPVEDGAPTERFAPDVRWTGVLAQQLGADFEVIEEGLSARTTNIDDPTDPRLNGASYLPSCLATHLPLDLVIIMLGTNDTKAYFRRTPLDIALGMSVLVTQVLTSAGGVGTTYPAPKVLVVSPPPLAPMPHPWFQLIFEGGEQKTTELARVYSALASFMKVPFFDAGSVISTDGVDGIHFTEANNRDLGVALAEQVRSLL SEQ ID NO.2: ATGGCCAAACGCATCTTATGTTTCGGAGACtgcGCGACTTGGGGATGGGTTCCCGTGGAAGACGGTGCTCCTACTGAACGCTTTGCGCCAGATGTACGCTGGACCGGCGTATTAGCTCAGCAGTTAGGCGCTGACTTTGAAGTCATTGAGGAAGGTTTGTCT GCCCGTACGACAAACATCGATTCCCCACCGACCCGGTTTGAATGGAGCGAGCTATCTTCCCTCGTGCCTGGCAACTCACTTACCGCTGGATCTTGTTTATTATCATGTTGGGCACAAACGACACCAAGGCGTATTTCCGCCGCCACACCCCTTGATATTGCA CTTGGGATGTCGGTGCTTGTCACACAGGTCTTGACATCCGCGGGGGGAGTAGGCACGACATATCCCGCACCGAAAGTATTAGTCGTCTCGCCTCCTCCCTTGGCACCCATGCCTCACCCCTGGTTTCAACTGATTTTTGAGGGCGGAGAAACAAAAGACAACGGAACTTGCCCGTGTGATTCAGCCTGGCTTCGTTTATGAAAGTCCCGTTCTTTGATGCCGGTAGCGTGATCAGTACAGACGGCGTAGATGGTATCACTTTACGGAGGCCAATAACCGTGATCTGGGGTGGCACTGGCGGACAAGTTCGCTCACTTT SEQ ID NO.3: MAKRILCFGDCATWGWVPVEDGAPTERFAPDVRWTGVLAQQLGADFEVIEEGLSARTTNIDDPTDPRLNGASYLPSCLATHLPLDLVIIMLGTADTKAYFRRTPLDIALGMSVLVTQVLTSAGGVGTTYPAPKVLVVSPPPLAPMHPWFQLIVEGGEQKTTELARVYSALASFMKVPFFDAGSVISTDGVDGAHFTEANNRDLGVALAEQVRSLL SEQ ID NO.4: MAKRILCFGDCATWGWVPVEDGAPTERFAPDVRWTGVLAQQLGADFEVIEEGLSARTTNIDDPTDPRLNGASYLPSCLATHLPLDLVIIMLGTADTKAYFRRTPLDIALGMSVLVTQVLTSAGGVGTTYPAPKVLVVSPPPLAPMPHPWFQLIVEGGEQKTTELARVYSALASFMKVPFFDAGSVISTDGVDGANFTEANNRDLGVALAEQVRSLL SEQ ID NO.5: MAKRILCFGDCATWGWVPVEDGAPTERFAPDVRWTGVLAQQLGADFEVIEEGLSARTTNIDDPTDPRLNGASYLPSCLATHLPLDLVIIMLGTADTKAYFRRTPLDIALGMSVLVTQVLTSAGGVGTTYPAPKVLVVSPPPLAPMPHPWFQLIVEGGEQKTTELARVYSALASFMKVPFFDAGSVISTDGVDGAVFTEANNRDLGVALAEQVRSLL SEQ ID NO.6: MAKRILCFGDCATWGWVPVEDGAPTERFAPDVRWTGVLAQQLGADFEVIEEGLSARTTNIDDPTDPRLNGASYLPSCLATHLPLDLVIIMLGTADTKAYFRRTPLDIALGMSVLVTQVLTSAGGVGTTYPAPKVLVVSPPPLAPMPHPWFQLIVEGGEQKTTELARVYSALASFMKVPFFDAGSVISTDGVDGAPFTEANNRDLGVALAEQVRSLL Although the present invention has been disclosed above with reference to preferred embodiments, it is not intended to limit the present invention. Anyone skilled in the art can make various modifications and alterations without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be determined by the claims.

Claims

1. An acyltransferase mutant, characterized in that, The acyltransferase mutant has an amino acid mutation at histidine position 195, based on the acyltransferase mutant with the corresponding amino acid sequence as shown in SEQ ID NO.

1.

2. The acyltransferase mutant according to claim 1, characterized in that, The acyltransferase mutant is based on the acyltransferase mutant with the corresponding amino acid sequence as shown in SEQ ID NO.1, with the histidine at position 195 mutated to any one of arginine, asparagine, threonine, tyrosine, alanine, valine, cysteine ​​or proline. Optionally, the histidine at position 195 may be mutated to any one of asparagine, valine, or proline.

3. The acyltransferase mutant according to claim 1 or 2, characterized in that, The acyltransferase mutant also has one or more amino acid mutations at position 94, 154, or 194; Optionally, the asparagine at position 94 is mutated to alanine; Optionally, the phenylalanine at position 154 is mutated to valine; Optionally, isoleucine at position 194 is mutated to alanine.

4. The acyltransferase mutant according to any one of claims 1 to 3, characterized in that, The acyltransferase mutant is based on the acyltransferase mutant with the corresponding amino acid sequence as shown in SEQ ID NO.1, wherein asparagine at position 94 is mutated to alanine, phenylalanine at position 154 is mutated to valine, isoleucine at position 194 is mutated to alanine, and histidine at position 195 is mutated to any one of asparagine, valine, or proline.

5. A gene encoding the acyltransferase mutant of any one of claims 1 to 4, or a recombinant vector carrying the gene of the acyltransferase mutant; Optionally, the recombinant vector includes pET-28a(+), pET-32a(+), pET-21a(+), pET-22b(+), and pET-50b(+).

6. A recombinant cell expressing the acyltransferase mutant of any one of claims 1 to 4 or carrying the gene or recombinant vector of claim 5; Optionally, the recombinant cells include E. coli-BL21 (DE3), Rosetta (DE3), E. coli-BL21 (DE3)Star, and E. coli-BL21 (DE3)pLysS.

7. A catalyst containing the acyltransferase mutant according to any one of claims 1 to 4; Optionally, the catalyst is: Cultivate recombinant expression transformants, isolate transformant cells expressing recombinant enzymes containing the acyltransferase mutant sequence of any one of claims 1 to 4, and obtain the recombinant enzyme catalyst; Optionally, the catalyst is: The recombinant expression transformant is cultured, and the transformant cells expressing the recombinant enzyme containing the acyltransferase mutant sequence of any one of claims 1 to 4 are isolated. The transformant cells expressing the recombinant enzyme are lysed to obtain cell lysate and the recombinant enzyme catalyst is obtained. Optionally, the catalyst is: The recombinant expression transformant is cultured, and the transformant cells expressing the recombinant enzyme containing the acyltransferase mutant sequence of any one of claims 1 to 4 are isolated. The transformant cells expressing the recombinant enzyme are lysed to obtain cell lysate, and the cell lysate is freeze-dried to obtain lyophilized enzyme powder, thereby obtaining the recombinant enzyme catalyst.

8. The application of the acyltransferase mutant according to any one of claims 1 to 4, the recombinant cell according to claim 6, or the recombinase catalyst according to claim 7 in the fields of biomaterials, medicine, or cosmetics; Optionally, the application is in the catalytic preparation of N-acetyl-trans-4-hydroxyproline from the substrate trans-4-hydroxy-L-proline.

9. A method for the catalytic synthesis of N-acetyl-trans-4-hydroxyproline, characterized in that, The acyltransferase mutant of any one of claims 1 to 4, the recombinant cell of claim 6, or the recombinase catalyst of claim 7 is added to a reaction system containing trans-4-hydroxy-L-proline and an acyl donor to prepare N-acetyl-trans-4-hydroxyproline. Optionally, the acyl donor is vinyl acetate; Optionally, the reaction system also contains phosphate buffer; Optionally, the reaction system also contains a surfactant; Optionally, the surfactant is PEG 4000, Triton-X 100, Tween 20, AEO-9 or DMSO; Optionally, the surfactant is PEG 4000 and DMSO; Optionally, the application involves adding the acyltransferase mutant, the recombinant cell, or the recombinase catalyst to a reaction system containing trans-4-hydroxy-L-proline, vinyl acetate, PEG 4000, and DMSO to prepare N-acetyl-trans-4-hydroxyproline. Optionally, the amount of trans-4-hydroxy-L-proline added is 5~300 mM, the amount of vinyl acetate added is 2~20% v / v, the amount of PEG 4000 added is 1~2 g / L, and the amount of DMSO added is 1~4 g / L.

10. A method for increasing the yield or conversion rate of N-acetyl-trans-4-hydroxyproline, characterized in that, The acyltransferase mutant of any one of claims 1 to 4, the recombinant cell of claim 6, or the recombinase catalyst of claim 7 is added to a reaction system containing trans-4-hydroxy-L-proline and an acyl donor to prepare N-acetyl-trans-4-hydroxyproline. Optionally, the acyl donor is vinyl acetate; Optionally, the reaction system also contains phosphate buffer; Optionally, the reaction system also contains a surfactant; Optionally, the surfactant is PEG 4000, Triton-X 100, Tween 20, AEO-9 or DMSO; Optionally, the surfactant is PEG 4000 and DMSO; Optionally, the application involves adding the acyltransferase mutant, the recombinant cell, or the recombinase catalyst to a reaction system containing trans-4-hydroxy-L-proline, vinyl acetate, PEG 4000, and DMSO to prepare N-acetyl-trans-4-hydroxyproline. Optionally, the amount of trans-4-hydroxy-L-proline added is 5~300 mM, the amount of vinyl acetate added is 2~20% v / v, the amount of PEG 4000 added is 1~2 g / L, and the amount of DMSO added is 1~4 g / L.

Images