Molecular marker related to sunflower sclerotiniose resistance gene, primer and application of molecular marker
By using KASP molecular marker technology, specific primer combinations were designed to detect the sunflower genome, which solved the problems of long breeding cycles and low efficiency of sunflower sclerotinia stem rot breeding, and enabled rapid and accurate identification of sclerotinia stem rot genotypes and accelerated the breeding process.
Patent Information
- Application Number
- CN202510825908.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-06-19
- Publication Date
- 2026-01-13
AI Technical Summary
Sunflower sclerotinia stem rot is a devastating disease caused by Sclerotinia stem rot. Traditional breeding methods are time-consuming and inefficient, and chemical control can easily lead to drug resistance in the pathogen. Therefore, it is necessary to develop molecular markers that are closely linked to genes that resist sclerotinia stem rot to accelerate the breeding process.
KASP molecular marker technology was used to design specific primer combinations to detect sunflower genome. Allele-specific forward primers and universal reverse primers were used for KASP marker detection to rapidly identify sclerotinia resistant genotypes.
It enables efficient and accurate identification of sclerotinia resistant genotypes, shortens the breeding cycle, improves selection efficiency, and is suitable for large-scale breeding applications.
Smart Images

Figure CN121320599A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The application belongs to the technical field of sunflower molecular breeding, and particularly relates to a KASP molecular marker related to a sunflower antibacterial sclerotinia gene, a primer and application of the KASP molecular marker and the primer in sunflower disease-resistant breeding. BACKGROUND
[0002] Sunflower sclerotinia is a devastating disease caused by Sclerotinia sclerotiorum, which seriously threatens the yield and quality of sunflower. The disease can infect the stems, leaves, flower discs and other parts of sunflower, causing plant wilting, lodging and seed grain mildew, and leading to serious yield reduction. At present, the prevention and control of sclerotinia mainly relies on chemical agents, but long-term use can easily lead to drug resistance of the pathogenic bacteria, and increase the production cost and environmental burden.
[0003] The sunflower antibacterial sclerotinia trait is a quantitative trait controlled by multiple genes, and the traditional breeding method for breeding disease-resistant varieties has a long cycle and low efficiency. Development of a molecular marker closely linked to the antibacterial sclerotinia gene is of great significance for accelerating the sunflower disease-resistant breeding process. The KASP (Kompetitive Allele Specific PCR) marker technology has the advantages of high throughput, low cost and high accuracy, and is particularly suitable for large-scale application in breeding practice. SUMMARY
[0004] The application provides a KASP molecular marker related to a sunflower antibacterial sclerotinia gene, and application of the KASP molecular marker and a primer in sunflower disease-resistant breeding.
[0005] To achieve the above-mentioned purpose, the technical scheme adopted by the application is as follows:
[0006] A molecular marker related to a sunflower antibacterial sclerotinia gene, wherein the KASP molecular marker related to the sunflower antibacterial sclerotinia gene is the nucleic acid sequence shown in SEQ ID NO. 1.
[0007] The application of the molecular marker related to the sunflower antibacterial sclerotinia gene is characterized in that the molecular marker is applied in screening sunflower carrying the disease-resistant gene.
[0008] The molecular marker is applied in breeding sunflower varieties carrying the antibacterial sclerotinia gene.
[0009] A primer combination for detecting the molecular marker related to the sunflower antibacterial nuclear disease gene, the KASP molecular marker primer combination is two allele-specific forward primers and one universal reverse primer; the nucleotide sequences of the allele-specific forward primers are shown in SEQ ID NO. 2 (GAAGGTGACCAAGTTCATGCTGACTTGGTACCCGAACAAAAACG) and SEQ ID NO. 3 (GAAGGTCGGAGTCAACGGATTGGACTTGGTACCCGAACAAAAACA), and the nucleotide sequence of the universal reverse primer is shown in SEQ ID NO. 4 (ACGGTGGAAACAGGTGGTAGAAGAT).
[0010] The application of the primer combination, the application of the primer combination in breeding sunflower varieties carrying the antibacterial nuclear disease gene.
[0011] Specifically, the genomic DNA of a single sunflower plant in a sample population is extracted, and the KASP marker detection is performed using the primer combination, so that the sample can be distinguished.
[0012] In the KASP marker detection, if the detection result is the allele CC type, it is determined that the sample carries the antibacterial nuclear disease gene; if the detection result is the allele TT type, it is determined that the sample does not carry the antibacterial nuclear disease gene, and if the detection result is the CT type, it is determined that the sample is an intermediate type and the phenotype is susceptible.
[0013] The KASP reaction system comprises: 2.0 μL of the DNA to be detected, 5.0 μL of 2x KASP Master Mix, 0.14 μL of a primer mixture (containing two allele-specific primers each at 12 μM and one universal reverse primer at 30 μM);
[0014] The KASP reaction conditions are: denaturation at 94℃ for 15 min; denaturation at 94℃ for 20 s, annealing and extension at 61℃ for 60 s (the annealing temperature is reduced by 0.6℃ for each cycle), for a total of 10 cycles; denaturation at 94℃ for 20 s, annealing and extension at 55℃ for 60 s, for a total of 26 cycles.
[0015] In the step, the double-stranded concentration of the extracted DNA is greater than 25 ng / μL (dye detection); the concentration detected by the ultraviolet spectrophotometer is 100 ng / μL or more.
[0016] The present application has the following advantages:
[0017] The KASP molecular marker provided by the present application can quickly and accurately identify the sunflower antibacterial nuclear disease genotype, and provides an effective molecular tool for disease-resistant breeding; specifically
[0018] 1. The KASP molecular marker provided by this invention is closely linked to the sclerotinia rot resistance trait in sunflowers, and has high detection accuracy.
[0019] 2. The KASP technology has the advantages of high throughput, low cost and easy operation, making it suitable for large-scale breeding applications.
[0020] 3. Testing can be conducted during the seedling stage, greatly shortening the breeding cycle and improving selection efficiency.
[0021] 4. It provides an effective molecular tool for breeding disease-resistant sunflowers, which helps to accelerate the breeding process of disease-resistant varieties. Attached Figure Description
[0022] Figure 1 The following diagram illustrates the fine mapping and candidate gene analysis of the major QTL qSCL2.3 for sunflower resistance to Sclerotinia stem rot provided in this embodiment of the invention. A shows the distribution of QTLs for leaf lesion area, stem lesion length, and disease severity on chromosome 2; B shows the genotyping of recombinants using the BC1F3 population; C shows the visible lesions on leaves of different recombinants 72 hours after infection with Sclerotinia stem rot; D shows the gene annotations for the qSCL2.3 fine mapping interval; E shows the gene structure and allelic variation of the candidate gene HaWRKY48; and F shows the change in the expression level of the HaWRKY48 gene in resistant and susceptible varieties after infection with Sclerotinia stem rot. Detailed Implementation
[0023] The following examples further illustrate specific embodiments of the present invention. It should be noted that the specific embodiments described herein are merely for illustration and explanation and are not intended to limit the scope of the present invention.
[0024] Example 1: Development of molecular markers closely linked to the anti-sclerotinia stem cell gene
[0025] This invention utilizes a population of recombinant inbred lines derived from the hybridization of the resistant sclerotinia sunflower restorer line C6 (zhao et al., 2024) and the susceptible sunflower maintainer line B728 (zhao et al., 2024). Two markers, r02:140692594 and r02:141515372, with genotypes identical to C6 and other polymorphic markers largely identical to B728, were selected from this population. This single line R5 was backcrossed with B728 and then self-crossed, yielding 3133 BC1F3 generation plants. Based on the polymorphic loci between the parents within the initial localization region, 11 KASP markers were developed, and the genotypes of each individual plant were analyzed to determine the genetic background within the initial localization region and to identify individuals undergoing recombination within that region. Five recombinants (RT1-RT5) were identified in the BC1F3 generation population. By analyzing leaf susceptibility to sclerotinia rot, the qSCL2 region was further shortened to 226.7 kb. Only one ORF (LOC110907968), HaWRKY48, was found within this region. This gene exhibited seven nonsense mutations in resistant and susceptible parents, along with different expression patterns, leading to the conclusion that HaWRKY48 is a candidate gene for sclerotinia rot resistance in sunflower.
[0026] Resequencing of C6 and B728 using next-generation resequencing technology yielded sequencing data with an average coverage depth greater than 30×. Sequence alignment of the two varieties revealed the nucleotide sequence shown in SEQ ID NO. 1 for the resistant Sclerotinia stem rot sunflower variety. This molecular marker is located on chromosome 2 of the sunflower and is a KASP molecular marker tightly linked to the major QTL for Sclerotinia stem rot resistance.
[0027] Simultaneously, the expression level of the HaWRKY48 gene in susceptible and resistant varieties after infection with Sclerotinia sclerotiorum was measured. The results showed that the expression level of the HaWRKY48 gene in susceptible varieties increased significantly with the extension of infection time, while the expression level of the HaWRKY48 gene in resistant varieties showed no significant difference. (See...) Figure 1 (and Table 1).
[0028] Table 1 Marking Location Information
[0029]
[0030]
[0031] Furthermore, a primer pair was designed based on the sequences at both ends of the molecular marker site closely linked to the anti-sclerotinia gene obtained above. The nucleotide sequences of the allele-specific forward primer are shown in SEQ ID NO.2 and SEQ ID NO.3, and the nucleotide sequence of the universal reverse primer is shown in SEQ ID NO.4.
[0032] Using the primer pairs obtained above, PCR amplification was performed on the genomic DNA of sunflower varieties C6 and B728. The concentration of extracted double-stranded DNA was greater than 25 ng / μL (detected by dye); the concentration detected by UV spectrophotometer was greater than 100 ng / μL. The KASP reaction system consisted of: 2.0 μL of the DNA to be tested, 5.0 μL of 2×KASP Master Mix, and 0.14 μL of primer mixture (containing two allele-specific primers, each at 12 μM, and one universal reverse primer at 30 μM). The KASP reaction conditions were: denaturation at 94℃ for 15 min; denaturation at 94℃ for 20 s, annealing and extension at 61℃ for 60 s (annealing temperature decreased by 0.6℃ per cycle), for a total of 10 cycles; and denaturation at 94℃ for 20 s, annealing and extension at 55℃ for 60 s, for a total of 26 cycles.
[0033] If the test result is CC type, the sample is determined to carry the anti-sclerotinia gene; if the result is TT type, the sample is determined not to carry the anti-sclerotinia gene.
[0034] Table 2 Information on HeS900011_K02 marker primers
[0035] HeS900011_K02 Primer sequence Forward GAAGGTGACCAAGTTCATGCTGACTTGGTACCCGAACAAAAACG Reverse GAAGGTCGGAGTCAACGGATTGGACTTGGTACCCGAACAAAAACA Common ACGGTGGAAACAGGTGGTAGAAGAT
[0036] Example 2: Validation of KASP molecular markers closely linked to the anti-sclerotinia gene
[0037] Twenty-one inbred lines were selected as test materials to identify whether the selected varieties contained disease resistance genes. Using the KASP molecular marker provided in this invention, the genotypes of these 21 materials were identified. It was found that the disease-resistant materials all had the CC allele, the susceptible materials all had the TT allele, and the heterozygous CT genotype also showed susceptibility.
[0038] The specific experiment is as follows:
[0039] Using 21 sunflower varieties as test materials, the extracted DNA double-strand concentration was greater than 25 ng / μL (detected by dye); the concentration detected by UV spectrophotometer was greater than 100 ng / μL. The KASP reaction system consisted of: 2.0 μL of the test DNA, 5.0 μL of 2×KASPMaster Mix, and 0.14 μL of primer mixture (containing two allele-specific primers, each at 12 μM, and one universal reverse primer at 30 μM). The KASP reaction conditions were: denaturation at 94℃ for 15 min; denaturation at 94℃ for 20 s, annealing and extension at 61℃ for 60 s (annealing temperature decreased by 0.6℃ per cycle), for a total of 10 cycles; and denaturation at 94℃ for 20 s, annealing and extension at 55℃ for 60 s, for a total of 26 cycles.
[0040] If the test result is the CC allele, the sample is determined to carry the anti-sclerotinia gene and the phenotype is disease-resistant; if the test result is the TT allele, the sample is determined not to carry the anti-sclerotinia gene and the phenotype is disease-susceptible; if the test result is the CT allele, the sample is determined to be intermediate and the phenotype is disease-susceptible (see Table 3).
[0041] Table 3. Validation of KASP molecular markers closely linked to sclerotinia rot resistance genes in 21 sunflower varieties.
[0042] Number Stalk (3d) Stalk (6d) Disease resistance rating KASP typing 2005-8R 0 0 Resistant C:C 2005A 0 0 Resistant C:C 55A 0 0 Resistant C:C 105R 0 0 Resistant C:C 2158A 0 0 Resistant C:C 266R 0 0 Resistant C:C HS55A 1.73 7.67 Intermediate C:T 204R 1.8 7.67 Intermediate C:T 9805A 1.8 7.67 Intermediate C:T 2002-8R 1.83 7.67 Intermediate C:T 2010-4A 1.93 7.67 Intermediate C:T 2010-7R 1.93 7.67 Intermediate C:T 131A 2.1 7.67 Intermediate C:T 1189R 2.2 7.83 Intermediate C:T 183A 7.93 15.33 Susceptible T:T 1264R 7.97 15.5 Susceptible T:T 207A 8 15.67 Susceptible T:T TOR 8.1 15.67 Susceptible T:T HYZA 8.2 16 Susceptible T:T S009R 8.33 16 Susceptible T:T 412A 8.37 16.33 Susceptible T:T
[0043] The results of the examples show that primer combinations can accurately screen for plants carrying the sclerotinia resistant gene, with a screening efficiency of 100%. The results of the examples show that the development of this marker will accelerate the process of breeding sunflower varieties resistant to sclerotinia resistant.
Claims
1. A molecular marker associated with a sunflower sclerotinia stem rot resistance gene, characterized in that: The KASP molecular marker associated with the sunflower sclerotinia resistance gene is the nucleic acid sequence shown in SEQ ID NO.
1.
2. The application of the molecular marker associated with the sunflower sclerotinia stem rot resistance gene as described in claim 1, characterized in that: The application of the molecular markers in screening sunflowers carrying disease-resistant genes.
3. The application of the molecular marker related to the sunflower sclerotinia resistance gene according to claim 2, characterized in that: The application of the molecular markers in the selection and breeding of sunflower varieties carrying the sclerotinia resistant gene.
4. A primer combination for detecting the molecular marker associated with the sunflower sclerotinia resistance gene as described in claim 1, characterized in that: The KASP molecular marker primer combination consists of two allele-specific forward primers and one universal reverse primer; the nucleotide sequences of the allele-specific forward primers are shown in SEQ ID NO.2 (GAAGGTGACCAAGTTCATGCTGACTTGGTACCCGAACAAAAACG) and SEQ ID NO.3 (GAAGGTCGGAGTCAACGGATTGGACTTGGTACCCGAACAAAAACA), and the nucleotide sequence of the universal reverse primer is shown in SEQ ID NO.4 (ACGGTGGAAACAGGTGGTAGAAGAT).
5. An application of the primer combination according to claim 4, characterized in that: The application of the primer combination in the selection and breeding of sunflower varieties carrying the sclerotinia resistant gene.
6. The application of the primer combination according to claim 5, characterized in that: Genomic DNA can be extracted from individual sunflower plants in the sample population and KASP marker detection can be performed using the primer combination described in claim 4 to distinguish the samples.
7. The application of the primer combination according to claim 6, characterized in that: The KASP marker detection results are as follows: if the allele is CC, the sample is determined to carry the anti-sclerotinia gene; if the allele is TT, the sample is determined not to carry the anti-sclerotinia gene; if the result is CT, the sample is determined to be intermediate and the phenotype is susceptible.
8. The application of the primer combination according to claim 6, characterized in that: The KASP reaction system includes: 2.0 μL of the DNA to be tested, 5.0 μL of 2×KASP Master Mix, and 0.14 μL of primer mixture (containing two allele-specific primers, each at 12 μM, and one universal reverse primer at 30 μM). The KASP reaction conditions are: 94℃ denaturation for 15 min; 94℃ denaturation for 20 s, 61℃ annealing and extension for 60 s (annealing temperature decreases by 0.6℃ per cycle), for a total of 10 cycles; 94℃ denaturation for 20 s, 55℃ annealing and extension for 60 s, for a total of 26 cycles.
Citation Information
Patent Citations
Kit for rapid identification of purity of new sunflower No.19 of oil sunflower
CN104164513A
New method for identifying sclerotiniose resistance level of sunflower
CN107488702A
Marqueur de resistance a sclerotinia sclerotiorum
FR2761361A1
Molecular markers associated with orobanche resistance in sunflower
US20190085413A1