GPC3 thermally dissociative aptamer composite magnetic beads based on magnetosomes, their preparation method and application

Abstract

This invention discloses a magnetosome-based GPC3 thermally dissociative aptamer composite magnetic bead, relating to the field of biomedical technology. The magnetosome-based GPC3 thermally dissociative aptamer composite magnetic bead comprises a temperature-sensitive thermally dissociative nucleic acid aptamer that specifically recognizes GPC3 protein, a magnetosome, and a bifunctional reagent. This invention also provides a method for preparing the above-mentioned magnetosome-based GPC3 thermally dissociative aptamer composite magnetic bead and its applications. The magnetosome-based GPC3 thermally dissociative aptamer composite magnetic bead prepared by the method provided by this invention can specifically bind to GPC3 at 37°C and dissociate from GPC3 at 46°C, thereby achieving effective drug release in magnetothermal therapy and effectively solving the problem of the lack of thermally dissociative nucleic acid aptamers that can specifically bind to GPC3 protein in the prior art.

Description

Technical Field

[0001] This invention relates to the field of biomedical technology, specifically to a GPC3 thermal dissociation aptamer composite magnetic bead based on magnetosomes, its preparation method, and its application. Background Technology

[0002] Phosphatidylinositol proteoglycan 3 (GPC3) is a membrane protein highly expressed in hepatocellular carcinoma (HCC) tissues. Its gene encodes a 70 kD core protein, which, after cleavage by the proprotein convertase Furin, produces a 40 kD amino-terminal subunit and a 30 kD carboxyl-terminal subunit with two heparan sulfate (HS) chains. GPC3 is anchored to the cell membrane via glycosylphosphatidylinositol anchoring protein (GPI). GPC3 is one of the most promising potential biomarkers for the diagnosis of hepatocellular carcinoma (HCC) discovered in recent years. GPC3 is mainly present during the embryonic period, preventing excessive growth of tissues and organs through negative regulation of cell growth and regulation of cell differentiation and morphogenesis. GPC3 can be detected in embryonic cells during the 18th-30th week of hepatocyte development, but is not expressed in normal adult hepatocytes. GPC3 is also expressed at low levels in melanoma, ovarian clear cell carcinoma, yolk sac tumor (YST), neuroblastoma, hepatoblastoma, nephroblastoma cells, testicular non-seminomatous tumors, liposarcoma, and a specific population of GPC3-GC in gastric cancer. Recent studies have shown that GPC3 can affect the synthesis of junctional proteins between cancer cells, reduce the adhesion between cancer cells, provide a prerequisite for cancer cell metastasis, and play a role in promoting cancer cell proliferation. The GPC3 expression profile makes it a promising drug target. Therefore, developing specific recognition technologies targeting GPC3 is of great significance for the diagnosis and treatment of liver cancer.

[0003] Aptamers are single-stranded oligonucleotides obtained through in vitro screening that can specifically recognize and bind to target molecules. DNA aptamers, in particular, exhibit higher stability and a longer half-life compared to RNA aptamers. Notably, thermally dissociative aptamers can alter their binding state with target proteins at specific temperatures, offering unique applications for drug delivery and magnetothermal therapy. However, current technologies lack thermally dissociative nucleic acid aptamers that specifically bind to the GPC3 protein.

[0004] Magnetosomes (BMPs) are biomembrane-coated magnetic nanocrystals composed of Fe3O4 or Fe3S4, synthesized intracellularly by magnetotactic bacteria. As a type of magnetic nanomaterial, they possess excellent magnetic responsiveness and biocompatibility, and have broad application value in tumor therapy, molecular imaging, and magnetic separation. However, there are still some problems to be solved in practical applications. For example, many studies utilize the high permeability and retention effect (EPR) of BMPs at solid tumor sites for MRI imaging. For tumor types that do not exhibit EPR, there is a lack of suitable methods for precise targeting. Current research focuses on coupling chemotherapeutic drugs to the surface of BMPs, but existing technologies lack efficient coupling methods that ensure the drug is released only after accurately reaching the tumor tissue. Furthermore, how to utilize BMPs to simultaneously achieve two or more therapeutic modalities to enhance anti-tumor effects is also an unresolved issue. Combining magnetosomes with aptamers can construct magnetically responsive and highly specific complexes, providing higher spatial resolution and sensitivity, and offering possibilities for integrated tumor diagnosis and treatment. Summary of the Invention

[0005] To address the aforementioned shortcomings in the prior art, this invention provides a GPC3 thermally dissociative aptamer composite magnetic bead based on magnetosomes, its preparation method, and its application, effectively solving the problem of the lack of thermally dissociative nucleic acid aptamers that can specifically bind to GPC3 protein in the prior art.

[0006] To achieve the above objectives, the technical solution adopted by the present invention to solve its technical problem is: to provide a GPC3 thermally dissociative aptamer composite magnetic bead based on a magnetosome, comprising a temperature-sensitive thermally dissociative nucleic acid aptamer that specifically recognizes GPC3 protein, a magnetosome, and a bifunctional reagent.

[0007] Furthermore, the nucleotide sequence of the temperature-sensitive thermally dissociative nucleic acid aptamer that specifically recognizes the GPC3 protein is shown in SEQ ID NO.1.

[0008] Furthermore, magnetosomes are prepared by the following method: magnetotactic bacteria are cultured to the logarithmic growth phase, centrifuged, and the resulting bacterial cells are suspended in phosphate buffer. The cells are then broken up, and magnetosomes and cell debris are separated. The mixture is then beaten, adsorbed, and washed. Finally, it is washed and dried to obtain magnetosomes.

[0009] Furthermore, the bacterial cells were suspended in phosphate buffer at a ratio of 1:9-11 (m / v).

[0010] Furthermore, the bacterial cells were suspended in phosphate buffer at a ratio of 1:10 (m / v).

[0011] Furthermore, the cells were disrupted using an ultrasonic cell disruptor under ice bath conditions.

[0012] Furthermore, the ultrasound was performed at a power of 90-110W, with a fragmentation time of 9-11 seconds, an interval of 9-11 seconds, and repeated 49-51 times.

[0013] Furthermore, the ultrasound was performed at a power of 100W, with a fragmentation time of 10 seconds, a 10-second interval, and repeated 50 times.

[0014] Furthermore, neodymium iron boron magnets and magnetic frames were used to separate magnetosomes and cell debris.

[0015] Furthermore, it is struck with ultrasonic waves.

[0016] Furthermore, it can be attracted using a magnet.

[0017] Next, wash with PBS.

[0018] Repeat this process 3-4 times.

[0019] Continue until the supernatant is clear.

[0020] Further, wash 3-4 times with sterile deionized water.

[0021] The beneficial effect of taking the above-mentioned further measures is the removal of salt ions.

[0022] Furthermore, the bifunctional reagents are 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide and N-hydroxysuccinimide.

[0023] The above-mentioned method for preparing GPC3 thermally dissociative aptamer composite magnetic beads based on magnetosomes includes the following steps: mixing a temperature-sensitive thermally dissociative nucleic acid aptamer that specifically recognizes GPC3 protein with magnetosomes, dispersing by sonication, and incubating overnight; then adding 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide and N-hydroxysuccinimide, oscillating by sonication, and incubating overnight; after adsorption and rinsing, GPC3 thermally dissociative aptamer composite magnetic beads based on magnetosomes are obtained.

[0024] Furthermore, the molar ratio of temperature-sensitive thermally dissociative nucleic acid aptamers to magnetosomes that specifically recognize GPC3 proteins is 100:1.

[0025] Furthermore, the molar ratio of temperature-sensitive thermally dissociative nucleic acid aptamers to magnetosomes that specifically recognize GPC3 proteins is 99-101:1.

[0026] Furthermore, it is dispersed by ultrasonic waves in the dark.

[0027] Furthermore, the mass of 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide is 3-4 times that of the magnetosome.

[0028] Furthermore, the mass of 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide is 3 times that of the magnetosome.

[0029] Furthermore, the mass of N-hydroxysuccinimide is 3-4 times that of the magnetosome.

[0030] Furthermore, the mass of N-hydroxysuccinimide is three times that of the magnetosome.

[0031] Furthermore, ultrasonic oscillation was performed at room temperature.

[0032] Furthermore, it is adsorbed using neodymium iron boron magnets.

[0033] Further, rinse 3-4 times with 90-110 mM phosphate buffer.

[0034] Further, rinse three times with 100 mM phosphate buffer.

[0035] The beneficial effects of taking the above-mentioned further measures are: removal of unreacted 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide and N-hydroxysuccinimide.

[0036] The above-mentioned application of GPC3 thermal dissociation aptamer composite magnetic beads based on magnetosomes in the capture, purification and detection of GPC3 protein.

[0037] The above-mentioned GPC3 thermally dissociated aptamer composite magnetic beads based on magnetosomes are used in the preparation of drugs for treating melanoma, ovarian clear cell carcinoma, yolk sac tumor, neuroblastoma, hepatoblastoma, nephroblastoma, testicular non-seminomatous cell tumor, liposarcoma, and gastric cancer.

[0038] In summary, the present invention has the following beneficial effects:

[0039] 1. Thermal dissociation properties: It can specifically recognize GPC3 at 37℃ and dissociate from GPC3 at 46℃, achieving precise drug release. It has potential for combination therapy effects (the combination of magnetothermal therapy and chemotherapy can improve drug efficacy and reduce drug resistance), providing a new strategy for the treatment of liver cancer and other related cancers.

[0040] 2. High specificity: The above-mentioned Fe3O4-aptamer composite magnetic beads can bind specifically and efficiently to GPC3 protein, and can be used for GPC3 protein capture, in vitro and in vivo detection or clinical diagnosis of GPC3-related diseases. It has broad application prospects and solves the problem that there are no nucleic acid aptamers that can specifically bind to GPC3 protein in the existing technology. The nucleic acid aptamers themselves can be prepared artificially in large quantities. The method is simple and low cost, which is conducive to market promotion.

[0041] 3. Good magnetic responsiveness: This complex uses magnetosomes as carriers and has the characteristics of uniform size, high chemical purity, biomembrane coating, and low cytotoxicity. It also has good biocompatibility and can be used in fields such as nuclear magnetic resonance imaging, magnetothermal therapy and targeted therapy, with broad application prospects. Attached Figure Description

[0042] Figure 1 Graph showing absorbance values ​​of nucleic acid aptamers at different concentrations;

[0043] Figure 2 The graph shows the positive rates of SP-BMPs binding to different proteins. Detailed Implementation

[0044] The principles and features of this invention are described below. The examples given are for illustrative purposes only and are not intended to limit the scope of the invention. Unless otherwise specified in the examples, conventional conditions or conditions recommended by the manufacturer should be followed. Reagents or instruments whose manufacturers are not specified are all commercially available products.

[0045] Example 1: Screening of thermally dissociated DNA aptamers

[0046] To screen for nucleic acid aptamers with thermal dissociation capabilities, this invention first synthesizes a DNA library with known sequences at both ends and containing 40 random bases in the middle. The initial random library was chemically synthesized with the following sequence: ATCGAGAGTCACGCAGCA-N40-TGGAGACGCTGGCTTAGT, where N40 represents 40 random oligonucleotides. Using GPC3 protein as the target protein, SELEX technology was employed to screen for DNA aptamers with high affinity and specificity. Flow cytometry was used to identify the affinity and specificity of the aptamers for the target protein, yielding aptamer sequences exhibiting high affinity and specificity for GPC3 protein at 37°C.

[0047] The specific screening process is as follows:

[0048] 1. Add 50 pmol of GPC3 protein containing a 6×His tag to a 1 nmol library and incubate at 37°C for 30 min. Then add 50 μL of His-Mag magnetic beads and incubate at 37°C for 30 min. The His-Mag magnetic beads (His Mag Sepharose, sourced from GE) and protein mixture was washed three times with Western blotting solution (137 mM NaCl, 2.7 mM KCl, 10 mM Na₂HPO₄, 2 mM KH₂PO₄, 5 mM MgCl₂, 5 mM imidazole, 0.02% Tween-20), 1 mL each time. Then add 50 μL of Western blotting solution to the His-Mag magnetic beads and protein mixture, heat to 46°C, maintain for 10 min, and magnetically separate the supernatant.

[0049] 2. The product (i.e., the supernatant) was pre-amplified for 6 cycles in a 500 μL PCR system, and then the optimal number of cycles was determined using a cycle number gradient experiment. Using the pre-amplified product as a template, five 50 μL PCR systems were prepared, and amplification was performed for 6 cycles, 8 cycles, 10 cycles, 12 cycles, and 14 cycles, respectively. Amplification primer S1: ATCGAGAGTCACGCAGCA, amplification primer S2: 5'phosphorylation-ACTAAGCCACCGTGTCCA.

[0050] 3. Electrophoresis was performed on the amplified products. The optimal cycle number was selected, and the screened products were amplified to prepare double strands. The amplified products were purified and quantified using a Nanodrop microsystem. 5 μL of 10× restriction enzyme buffer and 1 μL of lambda exonuclease were added to every 2 μg of amplified product, and water was added to bring the volume to 50 μL. The amplified products were digested at 37°C for 30 min to obtain a secondary library for the next round of screening. A total of six rounds of screening were performed.

[0051] The screened secondary libraries were then subjected to TA cloning and first-generation sequencing. The most abundant sequence was selected from all sequences to obtain DNA aptamers with the following nucleotide sequences, as shown below:

[0052] 5'

[0053] -ACTAAGCCACCGTGTCCATAACCATGATCCGGAACGGTCGCTAGCGGGCGGTCGTTCGTGCTGCGTCACTCTGGAT-3'.

[0054] Example 2: Extraction of Magnetoids

[0055] First, it should be noted that the strain Magnetospirillum mgryphiswaldense (MSR-1) used in this invention is existing technology and can be obtained by those skilled in the art through public channels or by cultivating it themselves. The cultivation method of the strain will not be described in detail in this invention.

[0056] Magnetotactic bacteria were cultured to the logarithmic growth phase. The collected cells were collected by centrifugation and resuspended in phosphate-buffered saline (PBS) at a ratio of 1:10 (m / v). The cells were then disrupted using an ultrasonic cell disruptor (100W power, 10s disruption, 10s interval, repeated 50 times) under ice bath conditions. Magnetosomes and cell debris were separated using neodymium iron boron magnets and a magnetic rack. The cells were then gently agitated with ultrasound, attracted by the magnets, and washed with PBS. This process was repeated approximately three times until the supernatant was visually clear. The cells were then washed three times with sterile deionized water to remove salt ions, and then freeze-dried under vacuum to obtain lyophilized magnetosomes, which were stored at low temperature for later use.

[0057] Example 3: Construction of SP-BMPs Complex

[0058] Weigh 187.5 mg of EDC (innochem) and 187.5 mg of NHS (adamas) and dissolve them in 7.5 mL of 100 mM pH 7.4 PBS solution, mixing thoroughly. Suspend the magnetically separated bacterial magnetosomes in 1 mL of 100 mM pH 7.4 PBS solution to prepare a bacterial magnetosome suspension with a concentration of 1 mg / mL.

[0059] The previously prepared improved aptamer (5'-HOOC-ACTAAGCCACCGTGTCCATAACCATGATCCGGAACGGTCGCTAGCGGGCGGTCGTTCGTGCTGCGTCACTCTGGAT-3') was dispersed with the magnetosomes extracted and purified in Example 2 by ultrasonication in the dark and incubated overnight; NHS / EDC (mass three times that of the magnetosomes) coupling agent and activator were added sequentially, and the mixture was incubated by ultrasonic vibration at room temperature overnight; unreacted NHS / EDC was removed by adsorption with a neodymium iron boron magnet and rinsing three times with PBS (100mM) to finally obtain SP-BMPs, which were then dissolved in PBS for later use.

[0060] Example 4 SP Affinity Identification

[0061] Enzyme-linked aptamer adsorption assay (ELASA)

[0062] (1) Dilute GPC3 protein in PBS (pH=7.4) to a final concentration of 500 ng / mL; coat 50 μL of each well of a 96-well plate with half a volume of ELISA clear microplate, seal the plate and incubate overnight at 4°C. Wash the plate by hand (discard the liquid in the well, fill each well with washing buffer, let stand for 10 seconds, shake dry, repeat four times and then pat dry on absorbent paper).

[0063] (2) Set up 15 concentrations (starting from 500 nM, halved and diluted 14 times, i.e., 500 nM, 250 nM, 125 nM, 62.5 nM…0.061 nM, 0.030 nM). Serially dilute the biotin-labeled GPC3 aptamer SP in binding buffer, and perform replicates for each concentration. Add 50 μL of the different concentrations of aptamer dilution to different wells, and include blank control wells and BSA (bovine serum albumin) control wells. Seal the plate and incubate at 37°C for 2 hours. Repeat the manual plate washing procedure.

[0064] (3) Add 50 μL of SA-HRP enzyme-labeled reaction solution to each well, seal the plate, and incubate at 37°C for 1 hour.

[0065] (4) Wash the plate by hand again, add 50 μL of TMB colorimetric solution to each well, seal the plate and incubate at 37°C for 20 minutes.

[0066] (5) Add 50 μL of 0.5 M H2SO4 stop solution to each well and mix well. Read the OD value of each well using an ELISA reader at a wavelength of 450 nm (reference wavelength 630 nm).

[0067] The results are as follows Figure 1 As shown, from Figure 1 The results show that the nucleic acid aptamer has a high affinity for the GPC3 protein, and its equilibrium dissociation constant Kd is 0.5473 nM. Figure 1 Using the OD value detected by the ELISA reader as the ordinate and the logarithm of the nucleic acid aptamer concentration as the abscissa, the dissociation constant was obtained by simulating the curve using the equation Y=Bmax*X / (Kd+X). The dissociation constant being in the nM range demonstrates that the aptamer has a strong binding affinity to the target protein.

[0068] Example 5: Specificity of SP-BMPs Binding to GPC3 Protein

[0069] Flow cytometry

[0070] (1) Purchase GPC3 protein with the carboxyfluorescein (FAM) tag and prepare bovine serum albumin (BSA), alpha-fetoprotein (AFP), Golgi protein 73 (GP73), and abnormal prothrombin (DCP) with the same FAM tag as controls.

[0071] (2) The prepared SP-BMPs complex was resuspended in PBS and diluted to 10 mg / mL. 20 μL of the resuspended solution was taken and an excess of 10 μmol GPC3 protein was added to it. Similarly, the same concentration of control protein was added to other groups. GPC3 protein was coupled and hybridized at 37℃ and 46℃ for 1 h, respectively. Other proteins were coupled and hybridized at 37℃ for 1 h. The supernatant was removed by magnetic separation, and after washing, magnetic separation was performed again to retain BMPs. The mixture was resuspended in 300 μL of PBS.

[0072] (3) Fluorescence signals were collected under the conditions of 488 nm excitation light and 525 nm emission light in the flow cytometer, and the positive rate was statistically analyzed.

[0073] The results are as follows Figure 2 As shown, at 37℃, 93% of SP-BMPs bound to the GPC3 target protein, while the binding rate decreased to 9.7% at 46℃, indicating that 46℃ is the sensitive dissociation temperature of this SP-BMPs complex. Furthermore, the binding efficiency of this complex to several other proteins was less than 10%, demonstrating the high binding specificity of SP-BMPs to the GPC3 protein.

[0074] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A composite magnetic bead based on a GPC3 thermally dissociative aptamer using magnetic particles, characterized in that, The invention includes a temperature-sensitive thermally dissociative nucleic acid aptamer that specifically recognizes the GPC3 protein, a magnetosome, and a bifunctional reagent. The nucleotide sequence of the temperature-sensitive thermally dissociative nucleic acid aptamer that specifically recognizes the GPC3 protein is shown below: ACTAAGCCACCGTGTCCATAACCATGATCCGGAACGGTCGCTAGCGGGCGGTCGTTCGTGCTGCGTCACTCTGGAT.

2. The GPC3 thermally dissociative aptamer composite magnetic bead based on magnetic particles as described in claim 1, characterized in that, The magnetosomes are prepared by the following method: magnetotactic bacteria are cultured to the logarithmic growth phase, centrifuged, and the resulting bacterial cells are suspended in phosphate buffer. The cells are then broken up, and the magnetosomes and cell debris are separated. The mixture is then beaten, adsorbed, and washed. Finally, it is washed and dried to obtain the magnetosomes.

3. The GPC3 thermally dissociative aptamer composite magnetic bead based on magnetic particles as described in claim 1, characterized in that, The bifunctional reagent is 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide and N-hydroxysuccinimide.

4. The method for preparing GPC3 thermally dissociative aptamer composite magnetic beads based on magnetic particles according to any one of claims 1-3, characterized in that, Includes the following steps: Temperature-sensitive thermally dissociative nucleic acid aptamers that specifically recognize GPC3 protein were mixed with magnetosomes, dispersed by sonication, and incubated overnight. Then, 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide and N-hydroxysuccinimide were added, and the mixture was incubated overnight by sonication. After adsorption and rinsing, GPC3 thermally dissociative aptamer composite magnetic beads based on magnetosomes were obtained.

5. The method for preparing GPC3 thermally dissociated aptamer composite magnetic beads based on magnetic particles as described in claim 4, characterized in that, The molar ratio of the temperature-sensitive thermally dissociative nucleic acid aptamer to the magnetosome that specifically recognizes the GPC3 protein is 99-101:

1.

6. The preparation method of GPC3 thermal dissociation aptamer composite magnetic beads based on magnetic particles as described in claim 4, characterized in that, The amount of 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide added is 3-4 times that of the magnetosomes.

7. The method for preparing GPC3 thermally dissociated aptamer composite magnetic beads based on magnetic particles as described in claim 4, characterized in that, The amount of N-hydroxysuccinimide added is 3-4 times that of the magnetosomes.

8. The application of the GPC3 thermal dissociation aptamer composite magnetic beads based on magnetosomes as described in claim 1 for capturing, purifying, and detecting GPC3 protein for non-disease diagnostic and therapeutic purposes.

Images