Codon optimization and methods of use thereof

Abstract

The invention is characterized by a method and application of codon optimization of a gene product. Specifically, the present disclosure features a codon optimization method that promotes the increase in mRNA half-life and stability by reducing the frequency of m6A modification, thereby achieving the purpose of improving protein production. Additional methods of delivering codon optimized gene products are disclosed. The methods of the present disclosure are clinically related to gene and cell therapy as well as vaccine development.

Description

[0001] sequence list This application includes a sequence list that has been electronically submitted in XML format, which is incorporated herein by reference in its entirety. This XML copy was created on March 1, 2024, and is named “51772-004WO4_Sequence_Listing_3_1_24”, with a size of 18,345 bytes. Technical Field

[0002] This disclosure relates to the field of nucleic acid engineering. Specifically, this disclosure provides compositions and methods for modifying the codon sequences of polypeptides encoding nucleic acids in order to improve the expression of desired polypeptides in organisms of interest, such as humans. Background Technology

[0003] N (6)-Methyladenosine (m6A) is the most common mRNA modification in mammals, influencing a wide range of aspects of gene expression in various physiological and pathophysiological processes. The METTL3-METTL14 methyltransferase complex adds m6A methylation to common DRACH sequence motifs on mRNA (D = A, G, or U; R = A or G; H = A, C, or U), but only a small subset (~5%) of DRACH sequences in cellular transcript subsets are selectively methylated. Furthermore, m6A exhibits a distinct regional bias in transcriptome distribution, being highly enriched near abnormally long internal exons and stop codons. Although specific m6A deposition plays a crucial role in m6A-mediated gene regulation, the underlying mechanisms of m6A specificity remain unclear. Compositions and methods utilizing these mechanisms are still needed to improve transgenic expression in organisms of interest. Summary of the Invention

[0004] In a first aspect, this disclosure is characterized by a method for codon optimization of a polynucleotide sequence encoding a polypeptide of interest. The method comprises replacing one or more nucleotides in a DRACH motif within the polynucleotide sequence with an equal amount of alternative nucleotides that eliminate the DRACH motif, wherein the replacement does not alter the amino acid sequence of the encoded polypeptide.

[0005] In some embodiments, the polynucleotide sequence comprises multiple DRACH motifs, and the substitution occurs only in a subset of the DRACH motifs. In some embodiments, the substitution occurs only in DRACH motifs that are at least 10 nucleotides away from the splice junction site within the polynucleotide sequence. In some embodiments, the substitution occurs only in DRACH motifs that are at least 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, or more nucleotides away from the splice junction site within the polynucleotide sequence.

[0006] In some embodiments, the substitution is performed only on the DRACH motif, which is about 10 nucleotides to about 200 nucleotides, about 20 nucleotides to about 190 nucleotides, about 30 nucleotides to about 180 nucleotides, about 40 nucleotides to about 170 nucleotides, about 50 nucleotides to about 160 nucleotides, about 60 nucleotides to about 150 nucleotides, about 70 nucleotides to about 140 nucleotides, about 80 nucleotides to about 130 nucleotides, about 90 nucleotides to about 120 nucleotides, or about 100 nucleotides away from the splice site in the polynucleotide sequence.

[0007] In some embodiments, the substitution is performed on a DRACH motif selected from AGACA, AGACT, GAACC, GAACT, GGACA, GGACT, TGACT, AAACA, AAACC, AAACT, AGACC, GAACA, GGACC, TAACA, TAACC, TAACT, TGACA, and TGACC.

[0008] In some implementations, one or more nucleotides in the DRACH motif are replaced using one or more codon usage guidelines selected from the following: (a) The codon GAC is never used to encode aspartic acid when the DRACH motif is eliminated; (b) The codon GAA encoding glutamate is never used when the DRACH motif is eliminated; (c) Glycine is never encoded by the codon GGA when the DRACH motif is eliminated; (d) When eliminating the DRACH motif, the codon AAA encoding lysine is never used; (e) never using the AAC codon to encode asparagine when eliminating the DRACH motif; and / or (f) The codon ACG is always used to encode threonine when eliminating the DRACH motif.

[0009] In some implementations, codon optimization also includes implementing one or more codon usage guidelines selected from the following throughout the polynucleotide sequence: (a) The codon GAC is never used to encode aspartic acid throughout the entire polynucleotide sequence; (b) The codon GAA is never used to encode glutamic acid throughout the entire polynucleotide sequence; (c) The codon GGA is never used to encode glycine throughout the entire polynucleotide sequence; (d) The codon AAA is never used to encode lysine throughout the entire polynucleotide sequence; (e) The codon AAC is never used to encode asparagine throughout the entire polynucleotide sequence; and / or (f) Threonine is always encoded using the codon ACG throughout the entire polynucleotide sequence.

[0010] In some implementations, prior to replacing one or more nucleotides in the DRACH motif, the polynucleotide sequence has been codon-optimized by replacing one or more nucleotides in the codon with an equal amount of alternative nucleotides that together constitute a synonymous codon that occurs more frequently in the target organism than the unmodified codon.

[0011] In some embodiments, prior to replacing the one or more nucleotides in the DRACH motif, the polynucleotide sequence has been codon-optimized by replacing one or more codons in the polynucleotide sequence with an equal number of synonymous codons that occur more frequently in the target organism than one or more unmodified codons occur in the target organism. In some embodiments, the target organism is a mammal, optionally wherein the mammal is a human.

[0012] In some implementations, the polynucleotide sequence has been codon-optimized using codon optimization network tools, codon optimization software, quantum computing, heuristic scoring methods, neural networks, or combinations thereof, before replacing one or more nucleotides in the DRACH motif.

[0013] In some implementations, the polynucleotide sequence has been codon-optimized by modulating polynucleotide guanine-cytosine (GC) content, polynucleotide secondary structure, mRNA motif, ribosome binding site, and / or translation rate before replacing one or more nucleotides in the DRACH motif.

[0014] In some implementations, the polynucleotide GC content is adjusted to between 50% and 80%. In some implementations, the polynucleotide GC content is adjusted to between 65% and 75%.

[0015] In some implementations, after replacing one or more nucleotides in the DRACH motif, the codon optimization method further includes replacing one or more nucleotides in the codon with an equal amount of alternative nucleotides that together constitute a synonymous codon that occurs more frequently in the target organism than the unmodified codon occurs in the target organism.

[0016] In some embodiments, after replacing one or more nucleotides in the DRACH motif, the codon optimization method further includes replacing one or more codons in a polynucleotide sequence with an equal amount of synonymous codons that occur more frequently in the target organism than one or more unmodified codons occur in the target organism. In some embodiments, the target organism is a mammal, optionally said mammal is a human.

[0017] In some implementations, the method of codon optimization after replacing one or more nucleotides in the DRACH motif also includes codon optimization via codon optimization network tools, codon optimization software, quantum computing, heuristic scoring methods, neural networks, or combinations thereof.

[0018] In some implementations, codon optimization methods, after replacing one or more nucleotides in the DRACH motif, also include modulating polynucleotide GC content, polynucleotide secondary structure, mRNA motif, ribosome binding site, and / or translation rate.

[0019] In some implementations, the polynucleotide GC content is adjusted to between 50% and 80%. In some implementations, the polynucleotide GC content is adjusted to between 65% and 75%.

[0020] In some embodiments, the amino acid sequence of the protein or peptide, after codon optimization, has at least 85% sequence identity with the wild-type amino acid sequence of the protein or peptide. In some embodiments, the amino acid sequence of the protein or peptide, after codon optimization, has 100% sequence identity with the wild-type amino acid sequence of the protein or peptide.

[0021] In some embodiments, the number of DRACH motifs in the polynucleotide sequence is reduced by at least 90%, at least 80%, at least 70%, at least 60%, at least 50%, at least 40%, at least 30%, at least 20%, or at least 10% compared to the corresponding polynucleotide sequence not subjected to this method. In some embodiments, the number of DRACH motifs in the polynucleotide sequence is reduced by 100% compared to the corresponding polynucleotide sequence not subjected to this method.

[0022] In some implementations, codon optimization methods lead to increased mRNA transcript stability or half-life.

[0023] In some implementations, the increase in mRNA transcript stability or half-life is assessed by an increase in concentration or relative abundance compared to the corresponding polynucleotide sequence that has not undergone this method.

[0024] In some implementations, the increase in mRNA transcript concentration or relative abundance compared to mRNA transcripts with natural polynucleotide sequences is measured by RT-PCR, fluorescence assay, colorimetric assay, spectrophotometric analysis, flow cytometry, in situ hybridization, RNA blot analysis, or by using an array of one or more hybrid oligonucleotides or antibodies targeting the mRNA transcript of interest.

[0025] In some implementations, the increase in mRNA transcript stability or half-life is assessed by a decrease in decay rate detected by one or more pulse tracing methods.

[0026] In some implementations, reducing the number of DRACH motifs in the polynucleotide sequence reduces mRNA transcripts compared to the corresponding polynucleotide sequence that has not undergone this method. N The amount of (6)-methyladenosine (m6A) modification.

[0027] In some embodiments, codon optimization leads to increased protein expression or stability compared to proteins encoded by the corresponding polynucleotide sequences that have not undergone this method. In some embodiments, the corresponding polynucleotide sequences are wild-type polynucleotide sequences.

[0028] In some implementations, protein expression or stability is increased by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 100%, or greater than 100% compared to the corresponding polynucleotide sequence that has not undergone this method.

[0029] In some implementations, protein expression or stability is increased by approximately 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, or more than 50 times compared to the corresponding polynucleotide sequence that has not undergone this method.

[0030] In some implementations, the increase in protein expression is measured by mass spectrometry, Western blotting, enzyme-linked immunosorbent assay (ELISA), immunoprecipitation, flow cytometry, fluorescence, colorimetry, spectrophotometry, or by using an array of aptamers or antibodies against the protein of interest.

[0031] In another aspect, this disclosure is characterized by polynucleotides produced by any of the foregoing aspects or embodiments of this disclosure.

[0032] In another aspect, this disclosure describes a method for delivering a polynucleotide sequence encoding a polypeptide to a host cell, the method comprising (i) replacing one or more nucleotides in the DRACH motif within the polynucleotide sequence with an equal amount of alternative nucleotides that eliminate the DRACH motif, wherein the replacement does not alter the amino acid sequence of the encoded polypeptide, and (ii) providing the resulting polynucleotide sequence to the host cell.

[0033] In another aspect, this disclosure is characterized by a method for expressing an mRNA transcript of a polynucleotide sequence encoding a polypeptide in a host cell, the method comprising (i) replacing one or more nucleotides in the DRACH motif within the polynucleotide sequence with an equal amount of alternative nucleotides that eliminate the DRACH motif, wherein the replacement does not alter the amino acid sequence of the encoded polypeptide, and (ii) providing the polynucleotide sequence to the host cell.

[0034] In another aspect, this disclosure is characterized by a method for expressing a protein from a polynucleotide sequence encoding a protein in a host cell, the method comprising (i) replacing one or more nucleotides in the DRACH motif within the polynucleotide sequence with an equal amount of alternative nucleotides that eliminate the DRACH motif, wherein the replacement does not alter the amino acid sequence of the encoded protein, and (ii) providing the polynucleotide sequence to the host cell.

[0035] In another aspect, this disclosure is characterized by a method for delivering a polynucleotide sequence encoding a polypeptide to a subject, the method comprising (i) replacing one or more nucleotides in the DRACH motif within the polynucleotide sequence with an equal amount of alternative nucleotides that eliminate the DRACH motif, wherein the replacement does not alter the amino acid sequence of the encoded polypeptide, and (ii) providing the subject with the obtained polynucleotide sequence.

[0036] In another aspect, this disclosure is characterized by a method for expressing an mRNA transcript of a polynucleotide sequence encoding a polypeptide in a subject, the method comprising (i) replacing one or more nucleotides in the DRACH motif within the polynucleotide sequence with an equal amount of a substitute nucleotide that eliminates the DRACH motif, wherein the replacement does not alter the amino acid sequence of the encoded polypeptide, and (ii) providing the subject with the polynucleotide sequence.

[0037] In another aspect, this disclosure is characterized by a method for expressing a protein from a polynucleotide sequence encoding a protein in a subject, the method comprising (i) replacing one or more nucleotides in the DRACH motif within the polynucleotide sequence with an equal amount of alternative nucleotides that eliminate the DRACH motif, wherein the replacement does not alter the amino acid sequence of the encoded protein, and (ii) providing the subject with the polynucleotide sequence.

[0038] In some embodiments of any of the foregoing aspects of this disclosure, the substitution is performed on a DRACH motif selected from AGACA, AGACT, GAACC, GAACT, GGACA, GGACT, TGACT, AAACA, AAACC, AAACT, AGACC, GAACA, GGACC, TAACA, TAACC, TAACT, TGACA, and TGACC. In some embodiments, the substitution is performed on a DRACH motif selected from AGACA, AGACT, GAACC, GAACT, GGACA, GGACT, and TGACT.

[0039] In some implementations, one or more nucleotides in the DRACH motif are replaced using one or more codon usage guidelines selected from the following: (a) The codon GAC is never used to encode aspartic acid when the DRACH motif is eliminated; (b) The codon GAA encoding glutamate is never used when the DRACH motif is eliminated; (c) The codon GGA encoding glycine is never used when eliminating the DRACH motif; (d) When eliminating the DRACH motif, the codon AAA encoding lysine is never used; (e) never using the AAC codon to encode asparagine when eliminating the DRACH motif; and / or (f) The codon ACG is always used to encode threonine when eliminating the DRACH motif.

[0040] In some implementations, codon optimization also includes implementing one or more codon usage guidelines selected from the following throughout the polynucleotide sequence: (a) The codon GAC is never used for aspartic acid throughout the entire polynucleotide sequence; (b) The codon GAA is never used for glutamate throughout the entire polynucleotide sequence; (c) The codon GGA is never used for glycine throughout the entire polynucleotide sequence; (d) The codon AAA is never used for lysine throughout the entire polynucleotide sequence; (e) The codon AAC is never used for asparagine throughout the entire polynucleotide sequence; and / or (f) The codon ACG is always used for threonine throughout the polynucleotide sequence.

[0041] In some implementations, prior to replacing one or more nucleotides in the DRACH motif, the polynucleotide sequence has been codon-optimized by replacing one or more nucleotides in the codon with an equal amount of alternative nucleotides that together constitute a synonymous codon that occurs more frequently in the target organism than the unmodified codon.

[0042] In some embodiments, prior to replacing the one or more nucleotides in the DRACH motif, the polynucleotide sequence has been codon-optimized by replacing one or more codons in the polynucleotide sequence with an equal number of synonymous codons that occur more frequently in the target organism than one or more unmodified codons occur in the target organism. In some embodiments, the target organism is a mammal, optionally wherein the mammal is a human.

[0043] In some implementations, the polynucleotide sequence has been codon-optimized using codon optimization network tools, codon optimization software, quantum computing, heuristic scoring methods, neural networks, or combinations thereof, before replacing one or more nucleotides in the DRACH motif.

[0044] In some implementations, the polynucleotide sequence has been codon-optimized by modulating polynucleotide GC content, polynucleotide secondary structure, mRNA motif, ribosome binding site, and / or translation rate before replacing one or more nucleotides in the DRACH motif.

[0045] In some implementations, the polynucleotide GC content is adjusted to between 50% and 80%. In some implementations, the polynucleotide GC content is adjusted to between 65% and 75%.

[0046] In some embodiments, after replacing one or more nucleotides in the DRACH motif, the method further includes replacing one or more nucleotides in the codon with an equal amount of alternative nucleotides, the alternative nucleotides collectively constituting a synonymous codon that occurs more frequently in the target organism than the unmodified codon occurs in the target organism.

[0047] In some embodiments, after replacing one or more nucleotides in the DRACH motif, the method further includes replacing one or more codons in the polynucleotide sequence with an equal amount of synonymous codons, which occur more frequently in the target organism than one or more unmodified codons occur in the target organism. In some embodiments, the target organism is a mammal, optionally said mammal is a human.

[0048] In some implementations, after replacing one or more nucleotides in the DRACH motif, the method further includes codon optimization using codon optimization network tools, codon optimization software, quantum computing, heuristic scoring methods, neural networks, or combinations thereof.

[0049] In some implementations, codon optimization methods, after replacing one or more nucleotides in the DRACH motif, also include modulating polynucleotide GC content, polynucleotide secondary structure, mRNA motif, ribosome binding site, and / or translation rate.

[0050] In some implementations, the polynucleotide GC content is adjusted to between 50% and 80%. In some implementations, the polynucleotide GC content is adjusted to between 65% and 75%.

[0051] In some implementations, the amino acid sequence of a protein or peptide, after codon optimization, has at least 85% sequence identity with the wild-type amino acid sequence of the protein or peptide.

[0052] In some implementations, the amino acid sequence of a protein or polypeptide, after codon optimization, has 100% sequence identity with the wild-type amino acid sequence of the protein or polypeptide.

[0053] In some implementations, the number of DRACH motifs in the polynucleotide sequence is reduced by at least 90%, at least 80%, at least 70%, at least 60%, at least 50%, at least 40%, at least 30%, at least 20%, or at least 10% compared to the corresponding polynucleotide sequence that has not undergone this method.

[0054] In some implementations, the number of DRACH motifs in the polynucleotide sequence is reduced by 100% compared to the corresponding polynucleotide sequence that has not undergone this method.

[0055] In some implementations, the method leads to an increase in mRNA transcript stability or half-life.

[0056] In some implementations, the increase in mRNA transcript stability or half-life is assessed by an increase in concentration or relative abundance compared to the corresponding polynucleotide sequence that has not undergone this method.

[0057] In some implementations, the increase in mRNA transcript concentration or relative abundance compared to mRNA transcripts with natural polynucleotide sequences is measured by RT-PCR, fluorescence assay, colorimetric assay, spectrophotometric analysis, flow cytometry, in situ hybridization, RNA blot analysis, or by using an array of one or more hybrid oligonucleotides or antibodies targeting the mRNA transcript of interest.

[0058] In some implementations, the increase in mRNA transcript stability or half-life is assessed by a decrease in decay rate detected by one or more pulse tracing methods.

[0059] In some implementations, reducing the number of DRACH motifs in the polynucleotide sequence reduces mRNA transcripts compared to the corresponding polynucleotide sequence that has not undergone this method. N The amount of (6)-methyladenosine (m6A) modification.

[0060] In some implementations, the method results in increased protein expression or stability compared to proteins encoded by the corresponding polynucleotide sequences that have not undergone the method.

[0061] In some implementations, the corresponding polynucleotide sequence is a wild-type polynucleotide sequence.

[0062] In some implementations, protein expression or stability is increased by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 100%, or greater than 100% compared to the corresponding polynucleotide sequence that has not undergone this method.

[0063] In some implementations, protein expression or stability is increased by approximately 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, or more than 50 times compared to the corresponding polynucleotide sequence that has not undergone this method.

[0064] In some implementations, the increase in protein expression is measured by mass spectrometry, Western blotting, enzyme-linked immunosorbent assay (ELISA), immunoprecipitation, flow cytometry, fluorescence, colorimetry, spectrophotometry, or by using an array of aptamers or antibodies against the protein of interest.

[0065] In some implementations, polynucleotides are delivered to the host cell by contacting the host cell with a medium containing polynucleotides.

[0066] In some implementations, polynucleotides are delivered to the subject by administering a medium containing polynucleotides.

[0067] In some implementations, the medium is selected from lipid nanoparticles, liposomes, viral genomes, and viral vectors.

[0068] In some implementations, the viral vector is adeno-associated virus (AAV), adenovirus, retrovirus, or lentivirus.

[0069] In some embodiments, the viral vector is AAV. In some embodiments, the AAV is pseudotyped. In some embodiments, the AAV contains an inverted terminal repeat (ITR) sequence and a capsid protein from different serotypes.

[0070] In some implementations, delivery to host cells occurs in vivo, in vitro, or outside the body.

[0071] In some implementations, delivery to the subject is carried out by (i) administering the polynucleotide in vivo to the subject, or (ii) expressing the polynucleotide in a host cell in vitro and then administering the host cell to the subject.

[0072] In some implementations, the method is used to treat subjects who have a disease or are at risk of having a disease characterized by low protein expression or activity.

[0073] In another aspect, this disclosure describes a method for treating a subject who has a disease or is at risk of developing a disease, the method comprising (i) replacing one or more nucleotides in a polynucleotide sequence encoding a disease-related polypeptide with an equal amount of an alternative nucleotide that eliminates the DRACH motif, wherein the replacement does not alter the amino acid sequence of the encoded polypeptide, and (ii) administering the polynucleotide sequence to the subject.

[0074] In another aspect, this disclosure describes a method for treating a subject who has a disease or is at risk of developing a disease, the method comprising administering to the subject a polynucleotide sequence encoding a disease-related polypeptide, wherein prior to administration, one or more nucleotides in the DRACH motif within the polynucleotide sequence have been replaced by an equal amount of alternative nucleotides that eliminate the DRACH motif, wherein the replacement does not alter the amino acid sequence of the encoded polypeptide.

[0075] In some embodiments, the substitution is performed on a DRACH motif selected from AGACA, AGACT, GAACC, GAACT, GGACA, GGACT, TGACT, AAACA, AAACC, AAACT, AGACC, GAACA, GGACC, TAACA, TAACC, TAACT, TGACA, and TGACC.

[0076] In some implementations, one or more nucleotides in the DRACH motif are replaced using one or more codon usage guidelines selected from the following: (a) The codon GAC is never used to encode aspartic acid when the DRACH motif is eliminated; (b) The codon GAA encoding glutamate is never used when the DRACH motif is eliminated; (c) Glycine is never encoded by the codon GGA when the DRACH motif is eliminated; (d) When eliminating the DRACH motif, the codon AAA encoding lysine is never used; (e) never using the AAC codon to encode asparagine when eliminating the DRACH motif; and / or (f) The codon ACG is always used to encode threonine when eliminating the DRACH motif.

[0077] In some implementations, prior to application, the polynucleotide sequence has been codon-optimized by methods including implementing one or more codon usage guidelines selected from the following across the entire polynucleotide sequence: (a) The codon GAC is never used to encode aspartic acid throughout the entire polynucleotide sequence; (b) The codon GAA is never used to encode glutamic acid throughout the entire polynucleotide sequence; (c) The codon GGA is never used to encode glycine throughout the entire polynucleotide sequence; (d) The codon AAA is never used to encode lysine throughout the entire polynucleotide sequence; (e) The codon AAC is never used to encode asparagine throughout the entire polynucleotide sequence; and / or (f) Threonine is always encoded using the codon ACG throughout the entire polynucleotide sequence.

[0078] In some implementations, prior to replacing one or more nucleotides in the DRACH motif, the polynucleotide sequence has been codon-optimized by replacing one or more nucleotides in the codon with an equal amount of alternative nucleotides that together constitute a synonymous codon that occurs more frequently in the target organism than the unmodified codon.

[0079] In some embodiments, prior to replacing the one or more nucleotides in the DRACH motif, the polynucleotide sequence has been codon-optimized by replacing one or more codons in the polynucleotide sequence with an equal number of synonymous codons that occur more frequently in the target organism than one or more unmodified codons occur in the target organism. In some embodiments, the target organism is a mammal, optionally wherein the mammal is a human.

[0080] In some implementations, the polynucleotide sequence has been codon-optimized using codon optimization network tools, codon optimization software, quantum computing, heuristic scoring methods, neural networks, or combinations thereof, before replacing one or more nucleotides in the DRACH motif.

[0081] In some implementations, the polynucleotide sequence has been codon-optimized by modulating polynucleotide guanine-cytosine (GC) content, polynucleotide secondary structure, mRNA motif, ribosome binding site, and / or translation rate before replacing one or more nucleotides in the DRACH motif.

[0082] In some implementations, the polynucleotide GC content is adjusted to between 50% and 80%. In some implementations, the polynucleotide GC content is adjusted to between 65% and 75%.

[0083] In some embodiments, after replacing one or more nucleotides in the DRACH motif, the method further includes replacing one or more nucleotides in the codon with an equal amount of alternative nucleotides, the alternative nucleotides collectively constituting a synonymous codon that occurs more frequently in the target organism than the unmodified codon occurs in the target organism.

[0084] In some embodiments, after replacing one or more nucleotides in the DRACH motif, the method further includes replacing one or more codons in the polynucleotide sequence with an equal amount of synonymous codons, which occur more frequently in the target organism than one or more unmodified codons occur in the target organism. In some embodiments, the target organism is a mammal, optionally said mammal is a human.

[0085] In some implementations, after replacing one or more nucleotides in the DRACH motif, the method further includes codon optimization using codon optimization network tools, codon optimization software, quantum computing, heuristic scoring methods, neural networks, or combinations thereof.

[0086] In some implementations, after replacing one or more nucleotides in the DRACH motif, the method further includes regulating the polynucleotide GC content, polynucleotide secondary structure, mRNA motif, ribosome binding site, and / or translation rate.

[0087] In some implementations, the polynucleotide GC content is adjusted to between 50% and 80%. In some implementations, the polynucleotide GC content is adjusted to between 65% and 75%.

[0088] In some implementations, the amino acid sequence of a protein or peptide, after codon optimization, has at least 85% sequence identity with the wild-type amino acid sequence of the protein or peptide.

[0089] In some implementations, the amino acid sequence of a protein or polypeptide, after codon optimization, has 100% sequence identity with the wild-type amino acid sequence of the protein or polypeptide.

[0090] In some implementations, the number of DRACH motifs in the polynucleotide sequence is reduced by at least 90%, at least 80%, at least 70%, at least 60%, at least 50%, at least 40%, at least 30%, at least 20%, or at least 10% compared to the corresponding polynucleotide sequence that has not undergone this method.

[0091] In some implementations, the number of DRACH motifs in the polynucleotide sequence is reduced by 100% compared to the corresponding polynucleotide sequence that has not undergone this method.

[0092] In some implementations, the method leads to an increase in mRNA transcript stability or half-life.

[0093] In some implementations, the increase in mRNA transcript stability or half-life is assessed by an increase in concentration or relative abundance compared to a reference.

[0094] In some implementations, the increase in mRNA transcript concentration or relative abundance compared to mRNA transcripts with natural polynucleotide sequences is measured by RT-PCR, fluorescence assay, colorimetric assay, spectrophotometric analysis, flow cytometry, in situ hybridization, RNA blot analysis, or by using an array of one or more hybrid oligonucleotides or antibodies targeting the mRNA transcript of interest.

[0095] In some implementations, reducing the number of DRACH motifs in the polynucleotide sequence reduces mRNA transcripts compared to the corresponding polynucleotide sequence that has not undergone this method. N The amount of (6)-methyladenosine (m6A) modification.

[0096] In some implementations, this method results in increased protein expression or stability compared to a reference.

[0097] In some implementations, the corresponding polynucleotide sequence is a wild-type polynucleotide sequence.

[0098] In some implementations, the reference is a sample obtained from a subject who has never received treatment or a sample obtained from a subject before treatment.

[0099] In some implementations, protein expression or stability is increased by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 100%, or greater than 100% compared to a reference.

[0100] In some implementations, protein expression or stability is increased by approximately 5-fold, 6-fold, 7-fold, 8-fold, 9-fold, 10-fold, 15-fold, 20-fold, 25-fold, 30-fold, 35-fold, 40-fold, 45-fold, 50-fold, or greater than 50-fold compared to a reference.

[0101] In some implementations, the increase in protein expression is measured by mass spectrometry, Western blotting, enzyme-linked immunosorbent assay (ELISA), immunoprecipitation, flow cytometry, fluorescence, colorimetry, spectrophotometry, or by using an array of aptamers or antibodies against the protein of interest.

[0102] In some implementations, the polynucleotide is administered to the subject by exposing the subject to a medium containing the polynucleotide.

[0103] In some embodiments, the medium is selected from lipid nanoparticles, liposomes, viral genomes, and viral vectors. In some embodiments, the viral vector is adeno-associated virus (AAV), adenovirus, retrovirus, lentivirus, or double-stranded DNA virus. In some embodiments, the viral vector is AAV. In some embodiments, the AAV is pseudotyped. In some embodiments, the AAV comprises an inverted terminal repeat (ITR) sequence and capsid proteins from different serotypes.

[0104] In some implementations, administration is performed by directly delivering the polynucleotide to the subject in vivo, or by expressing the polynucleotide in host cells in vitro and subsequently administering the host cells to the subject.

[0105] In some implementations, delivery is made via intramuscular, subcutaneous, intradermal, intravenous, intraperitoneal, intraarterial, intraventricular, intranasal, intraorbital, intracranial, or intraosseous administration.

[0106] In some implementations, the treatment is a single therapy. In some implementations, the method is combined with the administration of one or more additional therapeutic agents.

[0107] In another aspect, this disclosure features a kit comprising a packaging insert instructing a user to perform a method of codon optimization, the method comprising modifying a polynucleotide sequence encoding a polypeptide by replacing one or more nucleotides in a DRACH motif in a polynucleotide sequence without altering the amino acid sequence of the encoded polypeptide, thereby eliminating one or more DRACH motifs.

[0108] In another aspect, this disclosure features a kit comprising a packaging insert instructing the user to perform any of the methods described above or in any of the embodiments of this disclosure.

[0109] In some embodiments, the kit includes means for administering the polynucleotide sequence to a subject. In some embodiments, the kit contains one or more binding molecules to detect the expression of an mRNA transcript encoding the polypeptide or the expression or activity of the polypeptide. Attached Figure Description

[0110] The accompanying drawings are used to illustrate embodiments of this disclosure and to further understand its implementation.

[0111] Figure 1 This is a schematic diagram showing the pAAV ZsGreen1 plasmid map features.

[0112] Figure 2AThis is a bar graph showing the relative ZsGreen fluorescent protein production of the all-best codon-optimized open reading frames (ORFs) with or without DRACH motif removal. HEK293T cells were transfected 1:4 with a plasmid containing the all-best codon-optimized ORF at 2 or 3 days post-transfection by flow cytometry, where all codons were replaced with the most frequently used synonyms according to Table 1. "+m6A" indicates the presence of 14 DRACH motifs in the transfected ORF. Samples marked "-m6A" were further modified according to the six-codon usage rule to eliminate all present DRACH motifs in the coding sequence prior to transfection.

[0113] Figure 2B This is a bar graph showing the relative ZsGreen fluorescent protein production of the fully optimally codon-optimized ORF with and without DRACH motif removal. HEK293T cells were transfected 1:16 with a plasmid containing the fully optimally codon-optimized ORF two days later by flow cytometry, where all codons were replaced with the most frequently used synonyms according to Table 1. "+m6A" indicates the presence of 14 DRACH motifs in the transfected ORF, and "-m6A" indicates that the ORF was further modified according to the six-codon usage rule to eliminate all DRACH motifs present in the coding sequence prior to transfection.

[0114] Figure 3A This is a bar graph showing the relative ZsGreen fluorescent protein production of the ORF with proportional codon optimization, with or without DRACH motif removal. Flow cytometry measurements were performed on HEK293T cells 2 or 3 days after 1:4 transfection with a plasmid containing proportionally codon-optimized ORFs, where codons are represented according to the reporter frequencies shown in Table 1. "+m6A" indicates the presence of 16 DRACH motifs in the transfected ORF, and "-m6A" indicates that the ORF was further modified according to a six-codon usage rule to eliminate all DRACH motifs present in the coding sequence prior to transfection.

[0115] Figure 3B This is a bar graph showing the relative ZsGreen fluorescent protein production of the codon-optimized ORF with or without DRACH motif removal. Flow cytometry measurements of HEK293T cells were performed 2 days after transfection with a plasmid containing the codon-optimized ORF, at a ratio of 1:16, where codons are represented based on their reported frequencies as shown in Table 1. “+m6A” indicates the presence of 16 DRACH motifs in the transfected ORF, while “-m6A” indicates that the ORF was further modified with a six-codon usage rule prior to transfection to eliminate all present DRACH motifs in the coding sequence.

[0116] Figure 4 This is a bar graph showing the relative GLP-1-Fc protein secretion in ORFs codon-optimized using commercially available codon optimization network tools, with or without further modifications to remove the DRACH motif. ORFs with the DRACH motif removed are labeled "-m6A". Protein secretion was measured by enzyme-linked immunosorbent assay (ELISA).

[0117] Figure 5 This is a bar graph showing the relative secretion of GLP-1-Fc protein, measured using HEK293T cells transfected with AAV containing an ORF codon-optimized using four different strategies. "CH" indicates that the GLP-1-Fc ORF has been codon-optimized by replacing each codon with the most frequently used synonym. "IDT" indicates that the GLP-1-Fc ORF has been codon-optimized using a commercially available codon optimization network tool. "-m6A" further indicates that the ORF has been further modified to remove the DRACH sequence according to the indicated codon optimization strategy. Protein concentration was measured by ELISA.

[0118] Figure 6A This indicates that a low dose (1 x 10⁻⁶ per mouse) was administered intramuscularly to mice. 9 A graph showing serum GLP-1-Fc protein levels detectable at different days after AAV for GLP-1-Fc ORFs containing the native ORF or those codon-optimized using one of four different strategies (genome copies). "CH" indicates that the GLP-1-Fc ORF has been codon-optimized by replacing each codon with the most frequently used synonym. "IDT" indicates that the GLP-1-Fc ORF has been codon-optimized using a commercially available codon optimization network tool. "m6A" indicates that the ORF has been further modified to remove the DRACH sequence according to the indicated codon optimization strategy. Protein concentration was measured by ELISA.

[0119] Figure 6B This indicates that a high dose (1 x 10⁻⁶ per mouse) was administered intramuscularly to mice. 10 A graph showing serum GLP-1-Fc protein levels detectable at different days after AAV for GLP-1-Fc ORFs containing the native ORF or those codon-optimized using one of four different strategies. "CH" indicates that the GLP-1-Fc ORF has been codon-optimized by replacing each codon with the most frequently used synonym. "IDT" indicates that the GLP-1-Fc ORF has been codon-optimized using a commercially available codon optimization network tool. "m6A" further indicates that the ORF has been further modified to remove the DRACH sequence according to the indicated codon optimization strategy. Protein concentration was measured by ELISA.

[0120] Figure 7 This was shown in mice receiving a low dose (1 x 10⁻⁶ per mouse). 9 A bar graph showing serum GLP-1-Fc protein levels detectable 14 days after intramuscular administration of AAV (one genome copy), where AAV contains either the native ORF or an ORF codon-optimized using one of two different codon optimization strategies. "CH" indicates that the GLP-1-Fc ORF was codon-optimized by replacing each codon with a synonymous codon with the highest usage rate. "m6A" indicates that after codon optimization, the ORF was further modified to remove the DRACH sequence. Protein concentration was measured by ELISA.

[0121] Figure 8A This was shown in mice receiving a low dose (1 x 10⁻⁶ per mouse). 9 Bar graph of serum GLP-1-Fc protein levels detectable 28 days after intramuscular administration of AAV (one genome copy), wherein the AAV contains an ORF codon-optimized using a commercially available codon optimization network tool, wherein the DRACH motif is either unmodified (+m6A) or removed by further substitution (-m6A). Protein concentration was measured by ELISA.

[0122] Figure 8B This was shown in mice receiving a low dose (1 x 10⁻⁶ per mouse). 9 Bar graph of serum GLP-1-Fc protein levels detectable 28 days after intramuscular administration of AAV (one genome copy), where AAV contains a codon-optimized ORF by replacing each codon with the most frequently used synonymous codon, where the DRACH motif is either unmodified (+m6A) or removed by further substitution (-m6A). Protein concentration was measured by ELISA.

[0123] Figure 8C This is shown in mice receiving high doses (1 x 10⁻⁶ per mouse). 10 Bar graph of serum GLP-1-Fc protein levels detectable 28 days after intramuscular administration of AAV (one genome copy), wherein the AAV contains an ORF codon-optimized using a commercially available codon optimization network tool, wherein the DRACH motif is either unmodified (+m6A) or removed by further substitution (-m6A). Protein concentration was measured by ELISA.

[0124] Figure 8D This is shown in mice receiving high doses (1 x 10⁻⁶ per mouse). 10Bar graph of serum GLP-1-Fc protein levels detectable 28 days after intramuscular administration of AAV (one genome copy), where AAV contains a codon-optimized ORF by replacing each codon with the most frequently used synonymous codon, where the DRACH motif is either unmodified (+m6A) or removed by further substitution (-m6A). Protein concentration was measured by ELISA.

[0125] Figure 9A This is shown to be the result of receiving a low dose (1 x 10⁻⁶ per mouse). 9 Bar graph showing relative GLP-1-Fc mRNA transcript levels in mouse muscle tissue 60 days after intramuscular administration of AAV (one genome copy), wherein the AAV contains an ORF codon-optimized using a commercially available codon optimization network tool, wherein the DRACH motif is either unmodified (+m6A) or removed by further substitution (-m6A). Transcript levels were measured by qPCR.

[0126] Figure 9B This is shown to be the result of receiving a low dose (1 x 10⁻⁶ per mouse). 9 Bar graph showing the relative levels of GLP-1-Fc mRNA transcripts in mouse muscle tissue 60 days after intramuscular administration of AAV (one genome copy), wherein the AAV contains an ORF codon-optimized by replacing each codon with a synonymous codon with the highest usage rate, wherein the DRACH motif is unmodified (+m6A) or removed by further substitution (-m6A). Transcript levels were measured by qPCR.

[0127] Figure 9C This is shown to be the result of receiving a high dose (1 x 10⁻⁶ per mouse). 10 Bar graph showing the relative levels of GLP-1-Fc mRNA transcripts in mouse muscle tissue 60 days after intramuscular administration of AAV (one genome copy), wherein the AAV contains an ORF codon-optimized using a commercially available codon optimization network tool, wherein the DRACH motif is either unmodified (+m6A) or removed by further substitution (-m6A). Transcript levels were measured by qPCR.

[0128] Figure 9D This is shown to be the result of receiving a high dose (1 x 10⁻⁶ per mouse). 10 Bar graph showing the relative levels of GLP-1-Fc mRNA transcripts in mouse muscle tissue 60 days after intramuscular administration of AAV (containing a genome copy of 1), wherein the AAV contains a codon-optimized ORF, the codon optimization being performed by replacing each codon with a synonymous codon with the highest usage rate, wherein the DRACH motif was either unmodified (+m6A) or removed by further substitution (-m6A). Transcript levels were measured by qPCR.

[0129] Figure 10A This is shown to be the result of receiving a low dose (1 x 10⁻⁶ per mouse). 9 Bar graph showing relative GLP-1-Fc mRNA transcript levels in mouse liver tissue 60 days after intramuscular administration of AAV (one genome copy), wherein the AAV contains an ORF codon-optimized using a commercially available codon optimization network tool, wherein the DRACH motif is either unmodified (+m6A) or removed by further substitution (-m6A). Transcript levels were measured by qPCR.

[0130] Figure 10B This is shown to be the result of receiving a low dose (1 x 10⁻⁶ per mouse). 9 Bar graph showing the relative levels of GLP-1-Fc mRNA transcripts in mouse liver tissue 60 days after intramuscular administration of AAV (one genome copy), wherein the AAV contains an ORF codon-optimized by replacing each codon with a synonymous codon with the highest usage rate, wherein the DRACH motif is either unmodified (+m6A) or removed by further substitution (-m6A). Transcript levels were measured by qPCR.

[0131] Figure 10C This is shown to be the result of receiving a high dose (1 x 10⁻⁶ per mouse). 10 Bar graph showing the relative levels of GLP-1-Fc mRNA transcripts in mouse liver tissue 60 days after intramuscular administration of AAV (one genome copy), wherein the AAV contained an ORF codon-optimized using a commercially available codon optimization network tool, wherein the DRACH motif was either unmodified (+m6A) or removed by further substitution (-m6A). Transcript levels were measured by qPCR.

[0132] Figure 10D This is shown to be the result of receiving a high dose (1 x 10⁻⁶ per mouse). 10 Bar graph showing the relative levels of GLP-1-Fc mRNA transcripts in mouse liver tissue 60 days after intramuscular administration of AAV (one genome copy), wherein the AAV contains an ORF codon-optimized by replacing each codon with a synonymous codon with the highest usage rate, wherein the DRACH motif is either unmodified (+m6A) or removed by further substitution (-m6A). Transcript levels were measured by qPCR.

[0133] definition Unless otherwise defined herein, the scientific and technical terms used herein have the meanings commonly understood by one of ordinary skill in the art. In the event of any potential ambiguity, the definitions provided herein take precedence over any dictionary or external definitions. Furthermore, unless the context requires otherwise, singular terms shall include plural and plural terms shall include singular. Unless otherwise stated, the use of “or” means “and / or”. The use of the term “including” and other forms such as “includes” and “included” is not restrictive.

[0134] As used herein, the term “about” applied to one or more values ​​of interest means a value that falls within 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1% or less in any direction of the reference value, unless otherwise stated or clearly apparent from the context (unless the value exceeds 100% of the possible value).

[0135] As used herein, the term "codon optimization" refers to the process of altering the codons of a given gene or coding sequence to increase the expression of the encoded polypeptide without altering the polypeptide's amino acid sequence. This process utilizes the redundancy of the genetic code, where multiple tribase pair codon combinations encode a single amino acid. Codons that differ in their nucleic acid sequences but encode the same amino acid are referred to herein as "synonymous codons." As a non-limiting example, the amino acid leucine can be encoded by any of the following six codons: UUA, UUG, CUA, CUG, CUU, or CUC, all of which are synonymous with each other. Codon optimization processes typically improve the efficiency of mRNA expression, mRNA stability, and / or polypeptide synthesis compared to unmodified gene or coding sequences. Codon optimization generally improves the expression of target genes by modifying codon sequences in a manner that takes into account the abundance of tRNA in the cell type or organism, secondary structural elements in the polynucleotide sequence, and / or the binding interactions of the polynucleotide sequence with one or more binding partners (e.g., ribosomes, methyltransferases, tRNA molecules, and other binding partners known in the art). In codon optimization, "alternative nucleotides" or "alternative codons" refer to different nucleotides or codons that ultimately encode the same amino acid sequence of the polypeptide or protein of interest.

[0136] As used herein, the terms “codon usage table,” “codon bias table,” and “codon frequency lookup table” are used interchangeably and refer to a table that associates each codon that can be used to encode a specific amino acid with the frequency with which that codon encodes its corresponding amino acid in a specific context. This setup can be, for example, (i) a specific organism (e.g., a mammalian subject, such as a human), (ii) a specific class of genes in a given organism, or (iii) one or more synthetic polynucleotides. Hybrid codon usage tables or hybrid codon bias tables can also be constructed by combining two or more codon usage tables according to a variety of possible rules.

[0137] As used herein, “organism” or “target organism” when referring to codon optimization means an organism intended to receive delivery of one or more polynucleotides (e.g., one or more codon-optimized polynucleotides) as described herein.

[0138] As used herein, a “coding sequence” refers to an open reading frame (ORF) in a nucleic acid that, upon expression, produces a polypeptide or protein. An ORF is a continuous DNA or RNA sequence that begins with a start codon (e.g., methionine (ATG in a DNA sequence or AUG in an RNA sequence)) and ends with a stop codon (e.g., TAA, TAG, or TGA in a DNA sequence, or UAA, UAG, or UGA in an RNA sequence). ORFs typically encode proteins. It should be understood that the sequences disclosed herein may also include additional elements, such as 5' and 3' untranslated regions (UTRs), but unlike ORFs, these elements are not necessarily present in the RNA polynucleotides (e.g., mRNA transcripts) disclosed herein.

[0139] As used herein in the context of target protein products, the terms “expression level” or “expression level” are used interchangeably to refer to the amount of protein product in a subject or biological sample. The term “expression of desired protein” as used herein refers to the entire process of processing the gene of interest (e.g., in a subject, in a cell, or in vitro via one or more enzymes or organelles obtained from a cell) to produce a protein product. Specifically, the term “expression” may be used to describe one or more of the following events: (1) the generation of an RNA template from a DNA sequence (e.g., by transcription); (2) the processing of RNA transcripts (e.g., by splicing, editing, 5' cap formation, and / or 3' end processing); (3) the translation of RNA into a polypeptide or protein; and (4) post-translational modifications of the polypeptide or protein. Therefore, genes expressed using the compositions and methods described herein include genes transcribed into polynucleotides (e.g., mRNA) and then translated into polypeptides or proteins, as well as genes transcribed into RNA polynucleotides but not translated into polypeptides (e.g., transfer RNA and ribosomal RNA). Fragments of transcribed polynucleotides, translated polypeptides, or polynucleotides and / or polypeptide modifications (e.g., post-translational modifications of polypeptides) should also be considered as expressed, regardless of whether they originate from transcripts produced by alternative splicing or degraded transcripts, or from post-translational processing of polypeptides, such as by proteolysis.

[0140] The expression of the gene of interest in the subject can be demonstrated, for example, by detecting an increase in the number or concentration of mRNA encoding the corresponding protein (e.g., assessed using RNA detection procedures described herein or known in the art, such as quantitative polymerase chain reaction (qPCR), RT-PCR, and RNA seq techniques), an increase in the number or concentration of the corresponding protein (e.g., assessed using protein detection methods described herein or known in the art, such as enzyme-linked immunosorbent assay (ELISA), mass spectrometry, Western blot analysis, flow cytometry, immunofluorescence, colorimetric assay, or arrays of targeting antibodies or hybrid nucleotides, etc.), and / or an increase in the activity of the corresponding protein (e.g., in the case of an enzyme, assessed using enzyme activity assays known in the art) in samples obtained from the subject.

[0141] As used herein, the term "polynucleotide" or "nucleic acid" refers to a polymer of nucleotides of any length, including DNA and / or RNA. Nucleotides can be deoxyribonucleotides, ribonucleotides, modified nucleotides (e.g., containing modified nucleobases), and / or nucleotide analogs that can be incorporated into the polymer by DNA or RNA polymerases or through synthetic reactions. Thus, for example, polynucleotides as defined herein include, but are not limited to, single-stranded and double-stranded DNA, DNA comprising single-stranded and double-stranded regions, single-stranded and double-stranded RNA, and RNA comprising single-stranded and double-stranded regions, hybrid molecules comprising DNA and RNA that may be single-stranded, or more typically double-stranded, or comprising single-stranded and double-stranded regions. Furthermore, as used herein, the term "polynucleotide" refers to a triple-stranded region comprising RNA or DNA, or RNA and DNA. The strands in the region may originate from the same or different molecules. The region may include the entirety of one or more molecules, but more typically only the region of some molecules. One of the molecules with the triple-helix region is typically an oligonucleotide.

[0142] The term "polynucleotide" specifically includes complementary DNA (cDNA). In some embodiments, the polynucleotide is a codon-optimized gene product, wherein the polynucleotide (e.g., a polynucleotide encoding a protein of interest) undergoes one or more codon optimization methods described herein.

[0143] Polynucleotides can contain modified nucleotides, such as methylated nucleotides and their analogues. Modification of the nucleotide structure, if present, can be performed before or after polymer assembly. Non-nucleotide components may be intercalated into the nucleotide sequence. Polynucleotides can be further modified post-synthesized, such as by conjugation with tags. Other types of modifications include, for example, “capping”, replacing one or more naturally occurring nucleotides with analogues, internucleotide modifications such as those with uncharged linkages (e.g., methyl phosphonate, triphosphate, phosphatamide, carbamate, etc.) and charged linkages (e.g., thiophosphate, dithiophosphate, etc.), those containing side chain portions such as, for example, proteins (e.g., nucleases, toxins, antibodies, signal peptides, poly-L-lysine, etc.), those with intercalating agents (e.g., acridine, psoralen, etc.), those containing chelating agents (e.g., metals, radioactive metals, boron, metal oxides, etc.), those containing alkylating agents, those with modified linkages (e.g., α-anomeric nucleic acids), and the unmodified form of the polynucleotide. Furthermore, any hydroxyl groups typically present in the sugar can be replaced, for example, by phosphonate groups, phosphate groups, protected by standard protecting groups, or activated to prepare additional linkages with additional nucleotides, or conjugated to a solid or semi-solid support. The 5' and 3' terminal OH groups can be phosphorylated or partially replaced by amines or organic end-capping groups containing 1 to 20 carbon atoms. Other hydroxyl groups can also be derived as standard protecting groups. The polynucleotide can also contain similar forms of ribose or deoxyribose known in the art, including, for example, 2'-O-methyl-, 2'-O-allyl-, 2'-fluoro-, or 2'-azido-ribose, carbocyclic sugar analogs, α-terminal isomers, epimeric sugars (such as arabinose, xylose, or lythose), pyranoses, furans, sedoheptulose, acyclic analogs, and debased nucleoside analogs (such as methyl nucleosides). One or more phosphodiester linkages can be replaced by alternative linking groups. These alternative linking groups include, but are not limited to, embodiments in which the phosphate ester is replaced by P(O)S (“thioester”), P(S)S (“dithioester”), (O)NR2 (“amid”), P(O)R, P(O)OR', CO, or CH2 (“methylacetal”), wherein each R or R' is independently H or a substituted or unsubstituted alkyl group (1-20 C), optionally containing an ether (-O-) linker, aryl, alkenyl, cycloalkyl, cycloalkenyl, or araldyl group. The links in the polynucleotide need not all be identical. The foregoing description applies to all polynucleotides mentioned herein, including RNA and DNA.

[0144] As used herein, the terms "adenine" and "adenosine" are interchangeable terms for nucleotides containing an adenine base. As used herein, the terms "cytosine" and "cytidine" are interchangeable terms for nucleotides containing a cytosine base. As used herein, the terms "guanine" and "guanidine" are interchangeable terms for nucleotides containing a guanine base. As used herein, the terms "thymine" and "thymidine" are interchangeable terms for nucleotides containing a thymine base. As used herein, the terms "uracil" and "uridine" are interchangeable terms for nucleotides containing a uracil base.

[0145] As used herein, the term "splicing junction" refers to the boundary region between introns and exons of a gene within a nucleic acid (e.g., DNA or RNA) sequence. The characteristics of splicing junctions or "splicing sites" and the splicing mechanisms have been described in the art, for example, by Roca et al. Genes Dev.27 (2):129-144, 2013, which is incorporated herein by reference.

[0146] As used herein, “messenger RNA,” “mRNA,” or “mRNA transcript” is any RNA molecule that encodes (at least one) polypeptide or a fragment thereof and can be translated in vitro, in vivo, in situ, or ex vivo to produce the encoded polypeptide or a fragment thereof. The structural and topological features of mRNAs, as well as their post-transcriptional modifications, are described herein and are well known in the art.

[0147] As used herein, the term “peptide” refers to a polymer containing multiple amino acid monomers (or analogs thereof) and having a length of 50 amino acids or less (e.g., about 5, 10, 15, 20, 25, 30, 35, 40, 45 or 50 amino acid lengths).

[0148] As used herein, the term "peptide" refers to a polymer of amino acid residues linked together by peptide bonds. The term encompasses peptides of any size, structure, or function. Therefore, peptides include gene products, naturally occurring peptides, synthetic peptides, homologs, orthologs, paralogs, fragments, and other equivalents, variants, and analogs of the foregoing. Peptides can be single molecules or multi-molecular complexes, such as dimers, trimers, or tetramers. The term "peptide" may also apply to amino acid polymers in which one or more amino acid residues are artificial chemical analogs of the corresponding naturally occurring amino acids.

[0149] As used herein, the term "protein" refers to a sequence of amino acids or amino acid residues. Generally, proteins have a specific function. However, proteins also include polypeptides and smaller sequences of continuous amino acids that do not possess functional activity. Examples of functional proteins include, but are not limited to, enzymes (e.g., dehydrogenases, hydrolases, oxidoreductases, transferases, lyases, and ligases), receptors, receptor ligands, cytokines, antibodies, immunomodulatory molecules, signaling molecules, or labeled or modified proteins (e.g., for diagnostic or other clinical applications). General classes of useful enzymes include, but are not limited to, proteases, cellulases, lipases, hemicellulases, laccases, amylases, glucosylamylases, esterases, lactases, polygalacturonases, galactosidases, ligninases, oxidases, peroxidases, glucose isomerases, nitrile hydrolases, hydroxylases, polymerases, and depolymerases. In addition to enzymes, the encoded proteins that can be used in this invention include, but are not limited to, transcription factors, antibodies, receptors, growth factors (any one of PDGF, EGF, FGF, SCF, HGF, TGF, TNF, insulin, IGF, LIF, oncokinase, and CSF), immunomodulators, peptide hormones, cytokines, integrins, interleukins, adhesion molecules, thrombotic regulatory molecules, protease inhibitors, angiostatin, defensins, differentiation cluster antigens, interferons, chemokines, antigens including those from infectious viruses and organisms, oncogene products, thrombopoietin, erythropoietin, tissue plasminogen activators, and any other bioactive proteins desired for use in a clinical setting. This also includes deletion mutants of such proteins, single domains of such proteins, fusion proteins made from such proteins, and mixtures of such proteins; proteins with increased half-life and / or increased activity are particularly useful.

[0150] As used herein, the term "DRACH motif" refers to a short, five-base-pair common sequence of nucleic acids, where "D" in the DRACH common sequence represents guanine, adenine, or uracil; "R" represents guanine or adenine; "A" represents adenine; "C" represents cytosine; and "H" represents adenine, uracil, or cytosine. DRACH motifs can be present in polynucleotide sequences, such as RNA molecules (e.g., mRNA transcripts). As described herein, the presence of one or more DRACH motifs in a polynucleotide sequence can reduce the half-life of the polynucleotide (e.g., mRNA transcripts), thereby reducing the concentration of the translated protein or polypeptide encoded by that polynucleotide. Without being bound by any particular theory, DRACH motifs may exhibit characteristics such as a motif via the third adenine base. N(6)-Methyladenosine (“m6A”) modification increases the likelihood of modification. This modification can reduce the half-life of the modified mRNA transcript in cells or samples containing the mRNA transcript. One or more DRACH motifs in a nucleic acid sequence (e.g., a polynucleotide sequence; e.g., an mRNA sequence) can be removed or eliminated by replacing one or more nucleotides in one or more DRACH motifs, thereby providing a synonymous codon to replace the codon that forms part of the DRACH motif while preserving the amino acid sequence of the encoded polypeptide product. For the purpose of DRACH motifs, the terms “removal” or “elimination” and their variants should be understood as interchangeable.

[0151] As used herein, the term "antibody" refers to a molecule that specifically binds to or reacts with a particular antigen, and includes at least a heavy chain variable region, typically including at least the heavy chain and light chain variable regions of an immunoglobulin. Antibodies and their antigen-binding fragments, variants, or derivatives include, but are not limited to, polyclonal, monoclonal, multispecific, human, humanized, primate-derived, or chimeric antibodies, single-chain antibodies, epitope-binding fragments such as Fab, Fab', and F(ab')2, Fd, Fvs, single-chain Fvs (scFv), single-chain antibodies, disulfide-linked Fvs (sdFv), and V-containing antibodies. L or V H Fragments of structural domains, fragments generated from Fab expression libraries, and anti-idiotypic (anti-Id) antibodies. The antibody molecules of this invention can be any type (e.g., IgG, IgE, IgM, IgD, IgA, and IgY), class (e.g., IgG1, IgG2, IgG3, IgG4, IgA1, and IgA2), or subclass of immunoglobulin molecules. Furthermore, unless otherwise stated, the term "monoclonal antibody" (mAb) means comprising the complete molecule and an antibody fragment (e.g., Fab and F(ab')2 fragments) capable of specifically binding to a target protein. The Fab and F(ab')2 fragments lack the Fc fragment of the complete antibody.

[0152] As used herein, the term "antigen-binding fragment" refers to one or more fragments of an immunoglobulin that retain the ability to specifically bind to a target antigen. The antigen-binding function of an immunoglobulin can be achieved by fragments of a full-length antibody. Antibody fragments can be Fab, F(ab')2, scFv, SMIP, biantibodies, triantibodies, affinity antibodies, nanobodies, aptamers, or domain antibodies. Examples of binding fragments covered by the term "antigen-binding fragment" of an antibody include, but are not limited to: (i) Fab fragments, which are formed by V... L V H C L and C H(ii) A monovalent segment composed of a structural domain; (iii) A divalent segment consisting of two Fab segments connected by disulfide bonds in a hinge region; H and C H (iv) Fd fragments composed of 1 domain; VL and VH The Fv segment, composed of structural domains, (v) includes V H and V L dAb of structural domains (Ward et al.) , Nature 341:544-546, 1989); (vi) by V H The dAb segment composed of structural domains; (vii) composed of V H or V L The domains constitute dAb; (viii) separate complementarity-determining regions (CDRs); and (ix) combinations of two or more separate CDRs, which may optionally be connected by a synthetic linker. Furthermore, although the two domains V of the Fv segment... L and V H They are encoded by different genes, but they can be linked together by adapters through recombination, which make them into single protein chains, where V L and V H Regions pair to form monovalent molecules (called single-chain Fvs (scFvs)). These antibody fragments can be obtained using conventional techniques known to those skilled in the art, and their utility can be screened in the same manner as for intact antibodies. Antigen-binding fragments can be generated by recombinant DNA technology, enzymatic or chemical cleavage of intact immunoglobulins, or, in some cases, by chemical peptide synthesis procedures known in the art.

[0153] As used herein, the term "primer" refers to a natural or synthetic oligonucleotide capable of forming a double helix with a polynucleotide template and then serving as an initiation site for nucleic acid synthesis, extending from its 3' end along the template nucleic acid to form an extended double helix. The sequence of nucleotides added during extension is determined by the sequence of the template polynucleotide. Primers are typically extended by DNA polymerase. Primer lengths typically range from 3 to 36 nucleotides, 5 to 24 nucleotides, or 14 to 36 nucleotides. In some respects, primers are universal or non-universal. Primer pairs can be located flanking the sequence of interest or a set of sequences of interest. The sequences of primers and probes can be degenerate. In some respects, primers bind adjacent to the target sequence, whether it is a sequence to be captured for analysis or a tag to be replicated.

[0154] As used herein, the term "vector" includes nucleic acids, such as DNA (e.g., plasmids), or RNA containing polynucleotides encoding a product of the gene of interest, optionally combined with one or more additional elements (e.g., promoters, enhancers, untranslated regions, or splicing regulators) that promote the expression of the gene product. Vectors include viral vectors and nonviral vectors. Various vectors have been developed for delivering polynucleotides encoding foreign proteins into eukaryotic or prokaryotic cells. Examples of such expression vectors are disclosed, for example, in WO 1994 / 011026; this patent is incorporated herein by reference as it relates to vectors suitable for expressing the gene of interest. Some vectors that can be used to express the transgenes described herein include plasmids containing regulatory sequences (e.g., promoter and enhancer regions) that guide gene transcription. Other vectors that can be used to express transgenes contain polynucleotide sequences that enhance the translation rate of these genes or improve the stability or nuclear export of mRNA derived from gene transcription. These sequence elements include, for example, 5' and 3' untranslated regions, internal ribosome entry sites (IRES), and polyadenylation signaling sites that guide efficient transcription of the gene carried on the expression vector. Expression vectors suitable for use with the compositions and methods described herein may also contain polynucleotides encoding markers for selecting cells containing such vectors. Examples of suitable markers are genes encoding resistance to antibiotics such as ampicillin, chloramphenicol, kanamycin, norovirus, or bleomycin.

[0155] As used herein, the term "isolated" means a substance or entity altered or removed from its natural state (e.g., altered or removed from at least some of its components associated with its natural state). For example, nucleic acids or peptides naturally present in living organisms are not "isolated," but the same nucleic acids or peptides partially or completely isolated from coexisting substances in their natural state are "isolated." Isolated nucleic acids or proteins may exist in a substantially purified form or may exist in a non-natural environment, such as a host cell. Such polynucleotides may be part of a carrier and / or such polynucleotides or peptides may be part of a composition and remain isolated because such carriers or compositions are not part of the environment in which they exist in nature. In some embodiments, the isolated nucleic acids are recombinant (e.g., incorporated into a carrier). Methods for isolating polynucleotides and proteins or peptides are conventional in the art.

[0156] As used in this article, the terms “naturally occurring” or “wild-type” refer to substances that exist in nature without human intervention or assistance. “Naturally occurring” or “wild-type” can refer to the natural form of a biomolecule, sequence, or entity.

[0157] As used in this article, the phrase "operably linked" refers to a functional connection between two or more molecules, constructs, transcripts, entities, parts, etc. For example, if one DNA fragment is located relative to another DNA fragment on the same contiguous DNA molecule and has a structural or functional relationship, such as a promoter or enhancer being located relative to a coding region to facilitate transcription of that region, then these two DNA fragments can be operably linked. In other instances, the operably linked nucleic acids are not contiguous, but are located in such a way that they have a functional relationship as nucleic acids or as proteins expressed by them. For example, enhancers do not necessarily have to be contiguous. Linkage can be achieved by connecting at a convenient restriction site or by using synthetic oligonucleotide adaptors or linkers.

[0158] As used herein, the term "contact" (i.e., cell-to-agent contact) is intended to include incubating the agent and cells together in vitro (e.g., adding the agent to cultured cells) or administering the agent to a subject such that the agent and the subject's cells come into contact in vivo. The term "contact" does not include exposure of cells to the agent that may occur naturally in a subject's body (i.e., exposure that occurs due to natural physiological processes).

[0159] As used herein, the terms “associated with,” “bonded,” “connected,” “attached,” and “tethered” when applied to two or more parts refer to the parts being physically associated or connected to each other, either directly or through one or more additional parts acting as a linker, to form a structure stable enough that the parts remain physically associated under the conditions of using that structure (e.g., physiological conditions). “Association” does not necessarily have to be strictly through direct covalent chemical bonding. It may also indicate that ionic bonds or hydrogen bonds or hybridization-based connections are stable enough for the “associated” entities to remain physically associated.

[0160] As used herein, the term "stability" refers to the equilibrium or steady-state level of the production (e.g., transcription or translation) and decay or degradation of biological materials in a system, such as an entire organism, organ, tissue or tissue subpopulation, cell or cell subpopulation, or in a petri dish or container. In some embodiments, stability refers to the half-life of the biological material or molecule.

[0161] As used herein, the term "cell type" refers to a group of cells that share a statistically separable phenotype based on gene expression data. For example, cells of common cell types may share similar structural and / or functional characteristics, such as similar gene activation patterns and antigen presentation profiles. Cells of common cell types may include those isolated from common tissues (e.g., epithelial tissue, nervous tissue, connective tissue, or muscle tissue) and / or those isolated from common organs, tissue systems, blood vessels, or other structures and / or regions of an organism.

[0162] As used in this article, the term "in vitro" refers to events that occur in an artificial environment, such as in a test tube or reaction vessel, in a cell culture, or in a petri dish, rather than within an organism (such as an animal, plant, or microorganism).

[0163] As used in this article, the term "in vivo" refers to events that occur within an organism (such as an animal, plant, or microorganism, or its cells or tissues).

[0164] As used herein, the term "ex vivo" refers to the event in which a component of an organism (e.g., a tissue, cell, or subcellular part) is removed from its natural environment (e.g., from the body or a natural structure) and placed in an artificial environment (e.g., a test tube or petri dish, flask, or other container) for experimental or clinical application. In some cases, ex vivo experiments or applications may include the administration of a component (e.g., implantation, injection, deposition, infusion, and other suitable routes of administration) to the same subject or a separate recipient after one or more ex vivo applications.

[0165] As used herein, “modification” refers to an alteration in the state or structure of molecules of the present invention (e.g., polynucleotides; e.g., DNA or mRNA; e.g., polypeptides or proteins; e.g., amino acid residues). Molecules can be modified in a variety of ways, such as structural modifications (e.g., mutations in one or more base pairs or amino acid residues) or chemical modifications (e.g., methylation, acetylation, reduction or oxidation, glycosylation, lipidation, ubiquitination, or modification of one or more base pairs or amino acid residues). In some embodiments, molecules such as DNA or mRNA are modified to remove, reduce, or eliminate DRACH motifs, thereby reducing the amount of m6A methylation modifications in the gene or coding sequence of interest.

[0166] As used herein, the term "exogenous" describes molecules (e.g., polypeptides, nucleic acids, or cofactors) that are not naturally present in a particular organism (e.g., human) or at a specific location within an organism (e.g., an organ, tissue, or cell, such as a human cell). Exogenous substances include those provided to an organism or to cultured material extracted from said organism from an external source.

[0167] As used herein, the term "identity" or "homology" refers to the overall relevance between polymer molecules, such as nucleic acid molecules (e.g., DNA and / or RNA molecules) and / or polypeptide molecules. In some embodiments, polymer molecules are considered homologous if their sequences share at least 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% identity. In some embodiments, polymer molecules are considered homologous if their sequences share at least 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% similarity. The term "homology" necessarily refers to a comparison between at least two sequences (polynucleotide or polypeptide sequences).

[0168] The "sequence identity percentage (%)" relative to a reference polynucleotide or polypeptide sequence is defined as the percentage of nucleic acids or amino acids in a candidate sequence that are identical to those in the reference polynucleotide or polypeptide sequence after the sequences have been aligned and vacancies have been introduced (if necessary) to achieve the maximum sequence identity percentage. Alignments used to determine the nucleic acid or amino acid sequence identity percentage can be performed in various ways within the capabilities of those skilled in the art, for example, using publicly available computer software such as BLAST, BLAST-2, or Megalign software. Those skilled in the art can determine the parameters applicable to the aligned sequences, including any algorithms required to achieve the maximum alignment across the full length of the compared sequences. For example, the sequence identity percentage value can be generated using the sequence comparison computer program BLAST. For example, the sequence identity percentage for a given pair of nucleic acid or amino acid sequences A and / or for a given nucleic acid or amino acid sequence B (which can also be expressed alternatively as a certain sequence identity percentage possessed by a given pair of nucleic acid or amino acid sequences A and / or for a given nucleic acid or amino acid sequence B) is calculated as follows: 100 × (fraction X / Y) Where X is the number of nucleotides or amino acids that are scored as a consistent match in the A and B alignments by a sequence alignment program (e.g., BLAST), and Y is the total number of nucleic acids in B. It should be understood that when the length of nucleic acid or amino acid sequence A is not equal to the length of nucleic acid or amino acid sequence B, the percentage of sequence identity between A and B will not be equal to the percentage of sequence identity between B and A.

[0169] In some embodiments, the term "reference level" as used herein refers to a value derived from a "reference sample" used to determine the effect caused by the methods described herein. The reference level may be an indicator or measurement determined prior to the application or implementation of a method (e.g., one or more codon optimization methods or one or more therapeutic methods described herein). The reference level may be an indicator or measurement determined in a reference sample in which the methods described herein have not been applied (e.g., a negative control sample; e.g., a healthy subject control or a subject with a disease or condition). The reference level may be an indicator or measurement determined in a reference sample that exhibits a known or expected effect to evaluate the efficacy of the methods described herein (e.g., the effect produced by conventional protein production methods or by known therapeutic methods). In some embodiments, the reference level may be a predetermined value or a single value. As will be understood by those skilled in the art, the reference level is predetermined and set to meet requirements, such as specificity and / or sensitivity. For example, the assay sensitivity or specificity may have to be set to certain limits, such as 80%, 90%, or 95%. These requirements may also be defined based on positive or negative predictive values. In one embodiment, the reference level is determined in a healthy individual. In one implementation, the reference value has been pre-determined within the disease entity to which the subject belongs. In some implementations, the reference level can be set as any percentage of the overall distribution of values ​​in the studied disease entity, such as between 25% and 75%. In other implementations, the reference level can be set as, for example, the median, tertiary, quartile, or quintile, as determined based on the overall distribution of values ​​in the studied disease entity or a given population. In one implementation, the reference level is set as the median determined based on the overall distribution of values ​​in the studied disease entity. In some implementations, the reference level may depend on the patient's sex; for example, males may have different reference levels than females.

[0170] As used herein, the term “sample” refers to a subset of its tissues, cells, or components (e.g., bodily fluids, including but not limited to peripheral blood, serum, plasma, ascites, urine, cerebrospinal fluid (CSF), sputum, saliva, bone marrow, synovial fluid, aqueous humor, amniotic fluid, cerumen, breast milk, bronchoalveolar lavage fluid, semen, prostatic fluid, Copper fluid or preejaculate fluid, sweat, feces, hair, tears, sac fluid, pleural and peritoneal fluid, pericardial fluid, lymph, chyme, chyle, bile, interstitial fluid, menstrual blood, pus, sebum, vomitus, vaginal secretions, mucosal secretions, fecal water, pancreatic juice, sinus lavage fluid, bronchopulmonary aspirate, blastocyst fluid, and umbilical cord blood). Samples may also include homogenates, lysates, or extracts prepared from a whole organism or a subset or fraction thereof of its tissues, cells, or components, including but not limited to, plasma, serum, cerebrospinal fluid, lymph, external skin parts, respiratory tract, intestinal and genitourinary tract, tears, saliva, breast milk, blood cells, tumors, and organs. Samples also refer to culture media, such as nutrient broths or gels, which may contain cellular components such as protein or nucleic acid molecules.

[0171] As used herein, “treatment / treating” in relation to a disease or ailment means a method used to achieve a beneficial or desired outcome (e.g., clinical outcome). Beneficial or desired outcomes may include, but are not limited to, reducing or improving one or more symptoms or ailments; reducing the severity of a disease or ailment; stabilizing (i.e., not worsening) the state of a disease, condition, or ailment; preventing the spread of a disease or ailment; delaying or slowing the progression of a disease or ailment; improving or alleviating a disease or ailment; and detectable or undetectable remission (partial or complete). “Improvement” or “alteration” of a disease or ailment means a reduction or prolongation of the severity and / or undesirable clinical manifestations and / or the time course of progression of a disease, condition, or ailment compared to its severity or time course without treatment. “Treatment” may also mean prolonging survival compared to expected survival without treatment. Those requiring treatment include those who already have a disease or ailment, those who are susceptible to a disease or ailment, and those who will prevent a disease or ailment.

[0172] As used herein, the terms “effective amount,” “therapeutic effective amount,” and “sufficient amount” for the compositions described herein mean the amount that produces a beneficial or desired outcome, including clinical outcomes, when administered to a subject (e.g., a mammal; e.g., a human subject). Therefore, “effective amount” or its synonyms depend on the context of its application. The dosage of a given composition described herein corresponding to such a dosage will vary depending on a variety of factors, such as the given therapeutic agent (e.g., a polynucleotide, transgenic, or coding sequence), the pharmaceutical formulation, the route of administration, the type of disease or condition, the identity of the subject or host receiving treatment (e.g., age, sex, weight), etc., but can still be determined in a conventional manner by those skilled in the art. Furthermore, as used herein, a “therapeutic effective amount” for the compositions of this disclosure means the amount that produces a beneficial or desired outcome in a subject compared to a reference value (e.g., a pre-treatment subject, a healthy control, or an untreated subject). As defined herein, the therapeutically effective amount of the compositions of this disclosure can be readily determined by those skilled in the art using conventional methods known in the art. Dosing regimens can be adjusted to provide an optimal therapeutic response.

[0173] As used herein, “administration” means dispensing, delivering, or applying the composition of this disclosure to a subject by any suitable route to deliver the composition (e.g., a polynucleotide; for example, a polynucleotide encoding a transgene) to a desired location within the subject. Exemplary routes of administration include intramuscular, subcutaneous, intradermal, intravenous, intraperitoneal, intraarterial, intravenous, intranasal, intraorbital, intracranial, or intraosseous administration.

[0174] As used herein, the terms "combined administration" or "concurrent administration" refer to the administration of two or more agents to a subject simultaneously or at time intervals, such that the effects of each agent may overlap on the subject in need. In some embodiments, the agents are administered about one week or more, one day or more, one hour or more, or one minute or more. In some embodiments, the administration intervals of the agents are close enough to achieve a combined (e.g., synergistic) effect.

[0175] As used herein, the term “pharmaceutically acceptable” means a compound, material, composition, and / or dosage form that, to the extent of reasonable medical judgment, is suitable for use in contact with the tissues of a subject, such as a mammal (e.g., a human), without excessive toxicity, irritation, allergic reaction, or other problems or complications, and is commensurate with a reasonable benefit / risk ratio.

[0176] As used herein, the term “pharmaceuticalally acceptable excipient” refers to any component, other than an active agent (e.g., as described herein), present in a pharmaceutical composition and having properties that are substantially non-toxic and non-inflammatory to the subject.

[0177] As used herein, the term "pharmaceutical composition" refers to a mixture containing a therapeutic agent, optionally in combination with one or more pharmaceutically acceptable excipients, diluents and / or carriers, to be administered to a subject (such as a mammal, e.g., a human) to prevent, treat or control a particular disease or ailment that affects or may affect the subject. Detailed Implementation

[0178] This article describes compositions and methods for codon optimization techniques. For example, the compositions and methods described herein aim to improve mRNA stability and half-life to enhance the production of exogenous proteins.

[0179] Advantageously, the methods described herein reduce m6A methylation of the transcribed mRNA sequence by modifying the polynucleotide sequence encoding the protein of interest, thereby enhancing mRNA stability and producing stronger protein expression than conventional protein production methods, thus enabling improved production of recombinant or exogenous proteins. For example, the methods described herein can be used for in vitro, in vivo, and / or ex vivo expression of proteins for therapeutic purposes, such as gene therapy, drug delivery, and / or vaccine development.

[0180] I. Methods of codon optimization The codon optimization methods described herein can be used alone or in combination to improve protein expression in applications targeting transgenic or heterologous gene expression. Generally, codon optimization can improve the efficiency of translating a target gene or transcript into a peptide or protein product, thereby increasing protein production. The codon optimization methods described herein can be applied to genes or polynucleotide sequences encoding any type of protein, including soluble proteins, transmembrane proteins, membrane-associated proteins, intracellular proteins, or secreted proteins. In some embodiments, the codon optimization methods described herein are applied to genes or polynucleotide sequences encoding whole proteins (e.g., complete amino acid sequences), peptides, or protein fragments (e.g., one or more protein domains, polypeptides of proteins, and / or one or more protein chains). In further embodiments, the codon optimization methods described herein are applied to genes or polynucleotide sequences encoding fusion proteins (e.g., Fc fusion proteins or albumin fusion proteins), which can further enhance protein stability and / or protein half-life.

[0181] A. Reduce or eliminate DRACH motifs In the method described herein, increased protein expression of the target protein can be achieved through codon optimization techniques that reduce or eliminate DRACH motifs in the target gene or coding sequence. A DRACH motif is a short, five-base-pair common sequence of nucleic acids, where "D" represents guanine, adenine, or uracil; "R" represents guanine or adenine; "A" represents adenine; "C" represents cytosine; and "H" represents adenine, uracil, or cytosine. DRACH motifs include the following unique sequences: AGACA, AGACT, GAACC, GAACT, GGACA, GGACT, TGACT, AAACA, AAACC, AAACT, AGACC, GACA, GGACC, TAACA, TAACC, TAACT, TGACA, and TGACC.

[0182] The DRACH motif is more likely to occur at the third adenosine base. N (6)-Methyladenosine (“m6A”) modification can shorten the half-life of target mRNA in cells or biological samples containing mRNA. By modifying genes or coding sequences to reduce or eliminate one or more DRACH motifs, the half-life of the resulting mRNA transcripts may increase compared to unmodified genes or coding sequences due to less m6A modification. In some embodiments, the increased half-life of modified mRNA transcripts may be due to increased stability or reduced decay. For example, proteins of the YTHDF protein family (e.g., YTHDF2 and YTHDC2) recognize m6A-modified mRNA transcripts in the cytosol and mediate the degradation of these modified transcripts by destabilizing the m6A-modified mRNA transcripts and / or recruiting exonucleases.

[0183] Methylation enrichment studies have shown that DRACH motifs have a higher predisposition or likelihood of m6A modification. The predisposition of DRACH motifs to undergo m6A modification may depend on the primary sequence of the motif, its position within the gene or coding sequence, the gene or sequence topology (e.g., secondary or tertiary structural elements surrounding the motif), or a combination thereof. For example, one or more of these factors can increase the accessibility of the DRACH sequence to methyltransferases (e.g., METTL3, METTL14, WTAP, KIAA1439, METTL16, RBM15, and / or ZC3H13) for m6A modification. DRACH motifs with nucleotide sequences selected from the AGACA, AGACT, GAACC, GAACT, GGACA, GGACT, and TGACT groups are more likely to undergo m6A modification. Sequence-dependent enrichment of m6A modification in DRACH motifs has been addressed elsewhere, such as by Schwartz et al. (…). Cell Rep.8(1): 284-296, 2014), which is incorporated herein by reference. Polynucleotide topology and sequence elements can also influence the enrichment of m6A-modified DRACH motifs in mRNA transcripts. For example, m6A modifications may be enriched in DRACH motifs in gene coding sequences, 3' untranslated regions, and / or near stop codons. Conversely, DRACH motifs are less prone to m6A modification if they are closer to the splice site or located in the 5' untranslated region. In some embodiments, DRACH motifs are less likely to accept m6A modification if they are located within about 50 nucleotides or less of the splice site (e.g., about 60, about 55, about 50, about 45, about 40, about 35, about 30, about 25, about 20, about 15, about 10, or about 5 nucleotides).

[0184] The presence of m6A modifications in the DRACH motif of RNA molecules can be detected using methods known in the art, such as RNA crosslinking and immunoprecipitation combined with next-generation sequencing and nanopore sequencing. Methods for detecting m6A modifications in mRNA transcripts are known in the art and have been used, for example, by Meyer et al. (…). Cell. 149(7): 1635-1646, 2012), Dominissini et al. ( Nature. 29(485): 201-206, 2012), Linder et al. ( Nat Methods. 12(8):767-772, 2015), Ke et al. ( Genes Dev . 31(10):990-1006, 2017) and Lorenz et al. ( RNA. The references described in detail in (26:19-28, 2020) are all incorporated herein by reference.

[0185] In some embodiments, the gene or coding sequence is modified such that 1 to 5 DRACH motifs (e.g., 1, 2, 3, 4, or 5 DRACH motifs) are removed from the gene or coding sequence. In some embodiments, the gene or coding sequence is modified such that 5 to 10 DRACH motifs (e.g., 5, 6, 7, 8, 9, or 10 DRACH motifs) are removed from the gene or coding sequence. In some embodiments, the gene or coding sequence is modified such that 10 to 20 DRACH motifs (e.g., 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 DRACH motifs) are removed from the gene or coding sequence. In some implementations, the gene or coding sequence is modified such that 20 to 40 DRACH motifs are removed from the gene or coding sequence (e.g., 20 to 25, 25 to 30, 30 to 35, 30 to 40; e.g., 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39 or 40 DRACH motifs). In some implementations, the gene or coding sequence is modified such that 40 to 80 DRACH motifs (e.g., 40 to 45, 45 to 50, 50 to 55, 55 to 60, 60 to 65, 65 to 70, 70 to 75, 75 to 80; e.g., 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, or 80 DRACH motifs) are removed from the gene or coding sequence. In some implementations, the gene or coding sequence is modified to remove 50 to 100 DRACH motifs (e.g., 50 to 60, 60 to 70, 70 to 80, 80 to 90, 90 to 100; e.g., 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100 DRACH motifs). In other embodiments, more than 100 DRACH motifs (e.g., more than 100, more than 110, more than 120, more than 130, more than 140, more than 150, more than 160, more than 170, more than 180, more than 190, or more than 200 DRACH motifs) are removed from the gene or coding sequence.

[0186] Genes or coding sequences can be modified to remove or eliminate all DRACH motifs from the gene or coding sequence. In some embodiments, the gene or coding sequence is modified such that the number of DRACH motifs in the sequence is reduced by at least 90%, at least 80%, at least 70%, at least 60%, at least 50%, at least 40%, at least 30%, at least 20%, or at least 10% compared to the natural gene or coding sequence.

[0187] The method of removing one or more DRACH motifs can be combined with additional codon usage practices to further reduce the likelihood of m6A modification of the sequence. In some implementations, the additional codon usage practices for reducing m6A modification adopt one or more of the following six guidelines: (1) never use GAC for aspartic acid (Asp or D); (2) never use GAA for glutamic acid (Glu or E); (3) never use GGA for glycine (Gly or G); (4) never use AAA for lysine (Lys or K); (5) never use AAC for asparagine (Asn or N); and / or (6) always use ACG for threonine (Thr or T).

[0188] In some embodiments, removing one or more DRACH motifs requires iterative modification of the polynucleotide of interest to avoid introducing new DRACH motifs and / or to preserve amino acid sequence identity. In some embodiments, removing one or more DRACH motifs involves replacing one or more codons in the polynucleotide sequence with synonymous codons (i.e., codons encoding the same amino acid sequence). In some embodiments, removing one or more DRACH motifs involves replacing nucleotides such that the primary sequence (i.e., amino acid sequence) of the polypeptide or protein has 100% sequence identity.

[0189] Other factors that may affect mRNA stability or total protein production include the GC content of mRNA, mRNA secondary structure, accessibility of ribosome binding sites, relative tRNA abundance, and other factors known in the art. In some embodiments, a higher GC content in the coding sequence can improve mRNA stability and half-life by inhibiting mRNA decay and repressive mechanisms in the cell (e.g., localization to P-body granules or reduced interaction with translation repressors). The optimal GC content for enhanced protein production can be 50% to 80% of the length of the coding sequence of interest (e.g., between 50-60%, 60-70%, or 70-80%; for example, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, or 80%). Structural considerations for mRNA transcripts include secondary structures, such as hairpins or stem-loops, that could potentially inhibit translation initiation or promote ribosome arrest. Hairpins or stem-loops can form when intramolecular hydrogen bonds are formed between complementary nucleotides (e.g., A and T, A and U, or G and C). Mechanisms affecting ribosome scanning and ribosome fidelity in protein production are known in the art and have been addressed elsewhere, for example by Zaher and Green (…). Cell. 136(4): 746-762, 2009), which is incorporated herein by reference. Codon optimization methods involving the removal of one or more DRACH motifs can be performed iteratively to achieve the optimal value for any one or a combination of the foregoing considerations. In some implementations, the codon optimization methods are performed one, two, three, or more times to achieve optimal mRNA GC content and structural considerations.

[0190] In some embodiments, codon optimization by removing or eliminating one, more, or all of the present DRACH motifs results in an enhanced mRNA half-life (e.g., enhanced stability) of the gene or coding sequence of interest. In some embodiments, eliminating one, more, or all of the present DRACH motifs of the gene or coding sequence of interest increases the mRNA half-life by approximately 1.25-fold, approximately 1.5-fold, approximately 1.75-fold, approximately 2-fold, approximately 2.25-fold, approximately 2.5-fold, approximately 2.75-fold, approximately 3-fold, or more times compared to a polynucleotide sequence (e.g., a native gene or coding sequence) without DRACH motif removal. In some implementations, removing one, more, or all of the present DRACH motifs in the gene or coding sequence of interest increases the mRNA half-life by about 5 to about 50 times (e.g., about 5, about 6, about 7, about 8, about 9, about 10, about 15, about 20, about 25, about 30, about 35, about 40, about 45, about 50, or more than 50 times) compared to a polynucleotide sequence (e.g., a natural gene or coding sequence) without the DRACH motif removed.

[0191] In some embodiments, eliminating one, more, or all of the present DRACH motifs in the gene or coding sequence of interest, compared to a polynucleotide sequence (e.g., a natural gene or coding sequence) without the DRACH motif removed, increases the mRNA half-life by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 100%, or more than 100%. In some embodiments, eliminating one, more, or all of the present DRACH motifs in the gene or coding sequence of interest, compared to a polynucleotide sequence (e.g., a natural gene or coding sequence) without the DRACH motif removed, increases the mRNA half-life, for example, by about 1 to 24 hours or more (e.g., about 1 hour, about 2 hours, about 3 hours, about 4 hours, about 5 hours, about 10 hours, about 15 hours, about 20 hours, about 24 hours, or more). Methods for measuring mRNA half-life or stability include those known in the art and described herein.

[0192] In some embodiments, eliminating one, more, or all of the present DRACH motifs in the gene or coding sequence of interest increases the production of the protein or fragment thereof (e.g., protein expression). In some embodiments, eliminating one, more, or all of the present DRACH motifs in the gene or coding sequence of interest increases protein expression by about 1.5-fold, about 2-fold, about 3-fold, about 4-fold, about 5-fold, or more than 5-fold compared to a polynucleotide sequence (e.g., a natural gene or coding sequence) without DRACH motif removal. In some embodiments, eliminating one, more, or all of the present DRACH motifs in the gene or coding sequence of interest increases protein expression by about 5-fold to about 50-fold (e.g., about 5-fold, about 6-fold, about 7-fold, about 8-fold, about 9-fold, about 10-fold, about 15-fold, about 20-fold, about 25-fold, about 30-fold, about 35-fold, about 40-fold, about 45-fold, about 50-fold, or more than 50-fold) compared to a polynucleotide sequence (e.g., a natural gene or coding sequence) without DRACH motif removal.

[0193] In some embodiments, eliminating one, more, or all of the present DRACH motifs in the gene or coding sequence of interest results in an increase in protein expression of at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 100%, or more than 100%, compared to a polynucleotide sequence (e.g., a natural gene or coding sequence) without DRACH motif removal. In some embodiments, the increase in expression of the protein of interest or a fragment thereof is defined by an increase in the total protein production from recombinant production or an increase in protein measured in a biological sample. Methods for measuring protein expression are known in the art and are described herein.

[0194] B. Codon optimization based on codon usage preferences In some implementations, methods for heterologous gene expression by reducing or eliminating DRACH motifs may also include codon optimization based on codon usage preference. Codon usage preference refers to the biological phenomenon of preferentially using specific codons over other synonymous codons, which can affect the rate and efficiency of protein translation. Codon usage preference may affect RNA processing, ribosome scanning, translation initiation or termination, and / or protein folding and protein stability. Because an organism's genome is influenced by evolution, including mutations, recombination rates, and genetic drift, codon usage preference varies from organism to organism with the coding sequence. Different codon usage preferences have been observed in different species, families, or populations of organisms, and even in different genes within the same species. Therefore, codon usage preference can be considered in applications of heterologous gene expression. For example, if there is no initial codon optimization based on DRACH motifs... E. coliIf the codon usage in the sequence is modified, then the natural polynucleotide sequence of human cells will be affected. E. coli The amount of protein that may be produced in cells is less than the amount of protein produced in human cells.

[0195] In some implementations, codon optimization for heterologous gene expression involves using a codon usage frequency table for a given organism. Table 1 below shows an example of a human codon usage frequency table.

[0196] Table 1: Exemplary Codon Usage Frequency Table Codons: A=adenine, C=cytosine, G=guanine, T=thymine; Amino acids: =Terminal codon, A=alanine, C=cysteine, D=aspartic acid, E=glutamate; F=phenylalanine; G=glycine, H=histidine, I=isoleucine, K=lysine, L=leucine, M=methionine, N=asparagine, P=proline, Q=glutamine, R=arginine, S=serine, T=threonine, V=valine, W=tryptophan, Y=tyrosine; The reported frequency corresponds to the human codon. Codon optimization techniques for increasing protein expression of a target of interest can be implemented by modifying genes or coding sequences to replace one or more codons with synonyms that have the highest frequency of use. For example, genes or coding sequences for human protein expression can be modified such that each instance of a particular amino acid in the modified sequence represents only the most frequent codon shown in Table 1 (e.g., all codons encoding leucine are modified to CTG).

[0197] In some embodiments, the gene or coding sequence used for protein expression may be modified such that all listed codons are replaced by synonyms that are most frequently used in the organism. In some embodiments, the gene or coding sequence used for protein expression may be modified such that 5% to 50% of the cited codons (e.g., 5% to 10%, 10% to 25%, 20% to 40%, or 25% to 50%; e.g., about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, or about 50%) are replaced by synonyms that have the highest frequency of use. In some embodiments, the gene or coding sequence used for protein expression may be modified such that 25% to 75% (e.g., 25% to 40%, 30% to 50%, 40% to 60%, or 50% to 75%; e.g., about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, or about 75%) of the codons are replaced with synonymous codons with the highest frequency of use. In some embodiments, the gene or coding sequence used for protein expression may be modified such that 75% to 100% (e.g., between 75% and 85%, 80% and 90%, 85% and 95%, or 90% to 100%; e.g., about 75%, about 80%, about 85%, about 90%, about 95%, or about 100%) of the codons are replaced with synonymous codons with the highest frequency of use.

[0198] Codon optimization can be achieved by modifying gene or codon sequences to increase the expression of proteins targeting a specific interest, such that the representation of one or more codons is proportional to their reported frequency of use in the organism. For example, gene or codon sequences used for protein expression in humans can be modified so that codons encoding specific amino acids are represented according to their frequency of use, as shown in Table 1 (e.g., modifying codons encoding leucine so that CTG is represented as CTG in approximately 41% of cases, CTC in approximately 20% of cases, TTG in approximately 13% of cases, etc.).

[0199] In some embodiments, the gene or coding sequence used for protein expression may be modified such that all listed codons are replaced with synonymous codons in proportion to their frequency of use. In some embodiments, the gene or coding sequence used for protein expression may be modified such that 5% to 50% of the referenced codons (e.g., 5% to 10%, 10% to 25%, 20% to 40%, or 25% to 50%; e.g., about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, or about 50%) are replaced with synonymous codons based on their proportional frequency of use. In some embodiments, the gene or coding sequence used for protein expression may be modified such that 25% to 75% (e.g., 25% to 40%, 30% to 50%, 40% to 60%, or 50% to 75%; e.g., about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, or about 75%) of the codons are replaced with synonymous codons based on their proportional frequency of use. In some embodiments, the gene or coding sequence used for protein expression may be modified such that 75% to 100% (e.g., between 75% and 85%, between 80% and 90%, between 85% and 95%, or between 90% and 100%; e.g., about 75%, about 80%, about 85%, about 90%, about 95%, or about 100%) of the codons are replaced with synonymous codons based on their proportional frequency of use.

[0200] In some embodiments, the codon optimization method is performed using available software or network tools known in the art, wherein the codon optimization is automated or algorithm-based. In some embodiments, the codon optimization method involves heuristic scoring methods. In some embodiments, the codon optimization method involves using neural networks. In some embodiments, the codon optimization method is performed using quantum computing (see, for example, Fox et al.). PLoS ONE 16(10):e0259101, 2021, incorporated herein by reference). In some implementations, codon optimization methods are iteratively performed to achieve optimal mRNA guanine-cytosine (GC) content, mRNA secondary structure, mRNA motif, ribosome binding site, and other considerations.

[0201] C. Evaluation methods for codon optimization Codon optimization methods can be assessed by measuring the stability or half-life of mRNA compared to the native gene or coding sequence. In some embodiments, one or more codon optimization methods or combinations thereof described herein produce mRNA transcripts with increased stability or increased half-life. In some embodiments, mRNA half-life is assessed by one or more measurements of the concentration, relative abundance, or relative stability of the mRNA transcript detected in a biological sample. The concentration, relative abundance, or relative stability of the mRNA transcript can be assessed by reverse transcription polymerase chain reaction (RT-PCR), fluorescence methods, colorimetry, spectrophotometry, flow cytometry, in situ hybridization, RNA blotting, or using an array of one or more hybrid oligonucleotides or antibodies against one or more mRNA transcripts of interest. In further embodiments, the half-life or stability of the mRNA transcript of interest is assessed by structural or biochemical methods. In some embodiments, the half-life or stability of the mRNA transcript is assessed by selective 2'-hydroxyacylation (SHAPE) of primer extension analysis or methods modified thereto (see, for example, Wilkinson et al.). Nat. Prot. 1: 1610-1616, 2006, incorporated herein by reference. In a further embodiment, the half-life or stability of the mRNA transcript of interest can be assessed by mass spectrometry to evaluate the presence of chemical modifications. One or more of the methods described herein for assessing mRNA half-life or stability can be used in any combination, optionally in addition to other methods known in the art.

[0202] In some embodiments, the half-life or stability of the mRNA transcript of interest is assessed using a pulse-tracking method to analyze mRNA decay. In some embodiments, the mRNA half-life of the mRNA transcript of interest is assessed by measuring the rate of mRNA decay following transcriptional repression (e.g., by applying actinomycin D to a biological sample derived from a subject or a cultured cell population in vitro). In any of the foregoing embodiments, the stability or half-life of the mRNA transcript derived from the modified gene or coding sequence can be compared to a reference sample. In some embodiments, the reference sample is derived from a natural gene or coding sequence. In other embodiments, the reference sample is a housekeeping gene (e.g., a cell viability-related gene stably expressed in cells; e.g., β-actin, GAPDH, rRNA).

[0203] Alternatively or concurrently, codon optimization methods can be assessed by measuring protein production of the modified gene or coding sequence compared to the native gene or coding sequence. In some embodiments, protein production is assessed by measuring the concentration of the protein of interest in the sample. In some embodiments, the concentration of the protein of interest is measured by mass spectrometry, Western blotting, ELISA, immunoprecipitation, flow cytometry, fluorescence, colorimetry, spectrophotometry, or using an array of bound oligonucleotides (e.g., aptamers or antibodies against one or more proteins of interest).

[0204] Codon optimization methods can be assessed based on the protein quality or stability of the produced protein or peptide of interest. Protein quality or stability can be measured by functional or binding assays of the protein of interest (e.g., enzyme activity assays or binding assays using one or more known binding partners as ligands or analytes). Protein quality or stability can also be assessed using biochemical or biophysical methods known in the art, such as differential scanning fluorometry, thermal shift analysis, circular dichroism spectroscopy, dynamic light scattering, analytical ultracentrifugation, size exclusion chromatography, isothermal titration calorimetry, microscale thermophoresis, mass spectrometry, hydrogen-deuterium exchange, and other methods known in the art (see, for example, Basle et al.). J. Pharm. Sci . 109(1): 169-190, 2020), which is incorporated herein by reference.

[0205] II. Application of Codon Optimization Methods A. Protein production methods Any codon optimization methods described herein can be used alone or in combination to express heterologous or transgenic genes in host cells, such as eukaryotic or prokaryotic cells. In some embodiments, the host cells are bacterial, yeast, insect, plant, or mammalian cells. In further embodiments, the host cells are cultured in vitro for heterologous gene expression or recombinant protein production. In some embodiments, the host cells are cultured as adherent or suspension cells. In some embodiments, the host cells are established model cell lines, such as those available for culture from the American Type Culture Collection (ATCC).

[0206] In some embodiments, the host cells are located in an organism for in vivo protein production (e.g., transgenic expression). In some embodiments, the host cells are derived from an organism used for in vitro culture methods (e.g., a human subject), wherein after in vitro culture, the host cells may be implanted, injected, deposited, or otherwise administered to the same or different organisms (e.g., for autologous or allogeneic therapies or treatments).

[0207] B. Methods for delivering codon-optimized gene products Codon-optimized gene products (e.g., transgenes, mRNA transcripts, or purified or partially purified proteins) can be delivered to host cells or subjects using a variety of delivery techniques. The following sections describe exemplary, non-limiting methods for delivering polynucleotides of interest (e.g., polynucleotides from which one or more DRACH motifs have been eliminated according to the methods described herein) to host cells or subjects.

[0208] i. Viral genomes used to deliver codon-optimized gene products Viral genomes provide a rich source of vectors for efficiently delivering genes of interest into target cells within host cells (e.g., mammalian cells, such as human cells). Viral genomes are particularly useful for gene delivery because the polynucleotides contained within such genomes are typically incorporated into the target cell's genome via generalized or specialized transduction. These processes occur as part of the natural viral replication cycle and do not require the addition of proteins or reagents to induce gene integration. Examples of viral vectors that can be used in conjunction with the compositions and methods described herein are adeno-associated virus (AAV), retroviruses, adenoviruses (e.g., Ad5, Ad26, Ad34, Ad35, and Ad48), parvoviruses (e.g., adeno-associated virus), coronaviruses, negative-strand RNA viruses such as orthomyxoviruses (e.g., influenza viruses), rod-shaped viruses (e.g., rabies virus and vesicular stomatitis virus), paramyxoviruses (e.g., measles virus and Sendai virus), positive-strand RNA viruses (e.g., parvoviruses and alpha viruses), and double-stranded DNA viruses, including adenoviruses, herpesviruses (e.g., herpes simplex virus type 1 and 2, Epstein-Barr virus, cytomegalovirus), and poxviruses (e.g., cowpox, modified vaccinia Ankara (MVA), fowlpox, and canarypox). Other viruses that can be used in conjunction with the compositions and methods described herein include, for example, norovirus, tunica albuginea, flavivirus, reovirus, papillomavirus, hepatotropic DNA virus, and hepatitis virus. Examples of retroviruses include: avian leukosis sarcoma, mammalian type C, type B, type D viruses, HTLV-BLV groups, lentiviruses, and foam viruses (Coffin, JM, Retroviridae: The viruses and their replication, Fundamental Virology, 3rd edition, edited by BN Fields et al., Lippincott-Raven Publishers, Philadelphia, 1996). Other examples include murine leukosis virus, murine sarcoma virus, mouse mammary tumor virus, bovine leukosis virus, feline leukosis virus, feline sarcoma virus, avian leukosis virus, human T-cell leukosis virus, baboon endogenous virus, gibbon leukosis virus, MasonPfizer monkey virus, simian immunodeficiency virus, simian sarcoma virus, Rous sarcoma virus, and lentiviruses. Other examples of vectors are described, for example, in U.S. Patent No. 5,801,030, the disclosure of which relates to viral vectors for gene therapy is incorporated herein by reference.

[0209] ii. AAV vectors for delivering codon-optimized gene products In some embodiments, codon-optimized polynucleotides (e.g., modified gene or coding sequences) as described herein are incorporated into recombinant AAV (rAAV) vectors for introduction into cells. rAAV vectors used in conjunction with the compositions and methods described herein comprise recombinant nucleic acid constructs containing (1) a transgene encoding a codon-optimized sequence to enhance protein production and (2) one or more nucleic acids that promote the expression of modified gene or coding sequences. Viral nucleic acids may include those cis-acting elements of rAAV for replicating and packaging DNA (e.g., functional inverted terminal repeat sequences, or “ITRs”) into virions. Such rAAV vectors may also contain marker genes or reporter genes. Available rAAV vectors include one or more of naturally occurring AAV genes having a complete or partial deletion but retaining a functional flanking ITR sequence. The AAV ITR may have any serotype suitable for a particular application (e.g., derived from serotype 2). Methods using rAAV vectors are described, for example, by Tal et al. (…). J. Biomed.Sci . 7:279-291, 2000) and Monahan and Samulski ( Gene Delivery. In references 7:24-30 (2000), the disclosures of each of the aforementioned documents relating to AAV vectors for gene delivery are incorporated herein by reference.

[0210] The nucleic acids and vectors described herein can be incorporated into rAAV virions to facilitate the introduction of either nucleic acid or vector into cells. The capsid proteins of AAV constitute the outer non-nucleic acid portion of the viral particle and are encoded by the AAV cap gene. The cap gene encodes three viral capsid proteins, VP1, VP2, and VP3, required for virion assembly. The construction of rAAV viral particles has been described, for example, in U.S. Patent Nos. 5,173,414; 5,139,941; 5,863,541; 5,869,305; 6,057,152; and 6,376,237; and by Rabinowitz et al. (…). J. Virol. 76:791-801, 2002) and Bowles et al. ( J. Virol. In 77:423-432 (2003), the disclosures of each of the aforementioned documents relating to AAV vectors for gene delivery are incorporated herein by reference.

[0211] The rAAV virions used in conjunction with the compositions and methods described herein include virions derived from various AAV serotypes, including AAV 1, 2, 3, 4, 5, 6, 7, 8, and 9. The construction and use of AAV vectors and AAV proteins of different serotypes are described, for example, by Chao et al. Mol. Ther.2:619-623, 2000), Davidson et al. ( Proc. Natl. Acad. Sci. USA 97:3428-3432, 2000), Xiao et al. J. Virol. 72: 2224-2232, 1998), Halbert et al. ( J. Virol. 74: 1524-1532, 2000); Halbert et al. ( J. Virol. 75: 6615-6624, 2001), and Auricchio et al. ( Hum. Molec. Genet. In 10: 3075-3081, 2001, the disclosures of each of the aforementioned documents relating to AAV vectors for gene delivery are incorporated herein by reference.

[0212] Also used in conjunction with the compositions and methods described herein are pseudotyped rAAV vectors. Pseudotyped vectors comprise an AAV vector of a given serotype (e.g., AAV2) pseudotyped with a capsid protein derived from a serotype other than the given serotype (e.g., AAV1, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, or AAV9). A representative pseudotyped vector is the AAV2 vector encoding a therapeutic protein pseudotyped with a capsid protein derived from AAV serotype 8 or AAV serotype 9. In some embodiments, the pseudotyped AAV has an ITR of an AAV serotype (e.g., AAV2) and VP1, VP2, and / or VP3 capsid proteins from different AAV serotypes (e.g., AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAVrh10, or AAVrh74). Techniques involving the construction and use of pseudotyped rAAV viral particles are known in the art and described, for example, by Dua et al., J. Virol. 75:7662-7671 (2001); Halbert et al. ( J. Virol. 74: 1524-1532, 2000); Zolotukhin et al. ( Methods . 28: 158-167, 2002); and Auricchio et al. ( Hum. Molec. Genet. 10: 3075-3081, 2001)

[0213] In some embodiments, AAV comprises, for example, the capsid disclosed in WO 2017 / 218842, the disclosure of which is incorporated herein by reference. In some embodiments, AAV comprises the capsid protein disclosed in Lin et al., Mol Brain 13:138 (2020), the disclosure of which is incorporated herein by reference. In some embodiments, AAV comprises AAV2-reverse-transcribed capsid protein or AAV9-reverse-transcribed capsid protein. In some embodiments, AAV comprises a capsid protein conjugated to a ligand or aptamer.

[0214] AAV viral particles with mutations within their viral capsids can be used to infect specific cell types more effectively than non-mutated capsid viral particles. For example, suitable AAV mutants may have ligand insertion mutations that facilitate AAV targeting of specific cell types. The construction and characterization of AAV capsid mutants (including insertion mutants, alanine-selective mutants, and epitope-tagged mutants) are described in Wu et al. J. Virol. 74: 8635-45, 2000). Other rAAV viral particles that can be used in the methods of this invention include those capsid hybrids generated by molecular breeding of viruses and by exon shuffling. See, for example, Soong et al. ( Nat. Genet. 25: 436-439, 2000) and Kolman and Stemmer( Nat. Biotechnol. 19: 423-428, 2001).

[0215] iii. Other methods for delivering codon-optimized gene products to host cells In addition to the virus-based delivery methods described above, various non-viral techniques can be used to introduce codon-optimized gene or coding sequences into subject or host cells (e.g., host cells derived from human subjects). For example, mammalian cells (e.g., human cells) can be permeated by electroporation by applying an electrostatic potential to the cells of interest. Mammalian cells (such as human cells) subjected to an external electric field in this manner then readily take up exogenous nucleic acids. Electroporation of mammalian cells is described in detail, for example, by Chu et al. (…). Nucleic Acids Res. The disclosure of Nucleofection™ (15: 1311, 1987) is incorporated herein by reference. A similar technique, Nucleofection™, utilizes an applied electric field to stimulate the uptake of exogenous polynucleotides into the nucleus of eukaryotic cells. Nucleofection™ and protocols for performing this technique are described, for example, by Distler et al. ( Exp. Dermatol. Detailed descriptions can be found in US 2010 / 0317114 (14:315, 2005) and US 2010 / 0317114, the contents of which are hereby incorporated by reference.

[0216] Other techniques that can be used to transfect target cells include squeeze perforation. This technique induces rapid mechanical deformation of cells to stimulate the uptake of exogenous DNA through membrane pores formed in response to applied stress. An advantage of this technique is that a vector is not necessary for delivering nucleic acids into cells (such as human target cells). Squeeze perforation is used, for example, by Sharei et al. (… J. Vis. Exp. A detailed description is provided in 81:e50980 (2013), the contents of which are incorporated herein by reference.

[0217] Lipid transfection represents another technique that can be used to transfect target cells. This method involves loading nucleic acids into liposomes, which typically have cationic functional groups (e.g., quaternary or protonated amines) facing outwards. This promotes electrostatic interactions between the liposomes and the cell due to the anionic nature of the cell membrane, ultimately leading to the uptake of exogenous nucleic acids, for example, through direct fusion of the liposomes with the cell membrane or through endocytosis of the complex. Lipid transfection is described in detail, for example, U.S. Patent No. 7,442,386, the disclosure of which is incorporated herein by reference. Similar techniques utilizing ionic interactions with the cell membrane to induce the uptake of exogenous nucleic acids include contacting cells with cationic polymer-nucleic acid complexes. An exemplary cationic molecule associated with polynucleotides to impart a positive charge favorable for cell membrane interaction is an activated dendritic polymer (described, for example, Dennig… Topics in Current Chemistry (228:227, 2003), the disclosure of which is incorporated herein by reference, and diethylaminoethyl (DEAE)-glucan, the use of which as a transfection agent, is described in detail in, for example, Gulick et al. ( Curr. Protoc. in Mol. Biol. The disclosure of document 40:I:9.2:9.2.1, 1997, is incorporated herein by reference. Magnetic beads are another tool that can be used to transfect target cells in a gentle and efficient manner because this method utilizes an applied magnetic field to guide the uptake of nucleic acids. This technology is described in detail, for example, in US 2010 / 0227406, the disclosure of which is incorporated herein by reference.

[0218] Another tool that can be used to induce the uptake of exogenous nucleic acids by target cells is laser transfection, a technique that involves exposing cells to electromagnetic radiation of a specific wavelength to gently permeate the cells and allow polynucleotides to pass through the cell membrane. This technique is described in detail, for example, by Rhodes et al. Methods in Cell Biology The contents of the aforementioned document (82:309, 2007) are incorporated herein by reference.

[0219] Microvesicles represent another potential medium for modifying the genome of target cells according to the methods described herein. For example, proteins can be efficiently delivered into cells using microvesicles induced by co-overexpression of the glycoprotein VSV-G with, for example, genome-modifying proteins (e.g., nucleases), followed by site-specific cleavage of endogenous polynucleotide sequences to prepare a cellular genome for covalently incorporating relevant polynucleotides (e.g., genes or regulatory sequences). The use of such vesicles (also known as nanovesicles (Gesicles)) in the genetic modification of eukaryotic cells is described in detail, for example, by Quinn et al. Mol. Ther .23:Supplement 1, Abstract No. 122, 2015).

[0220] C. Treatment methods i. Therapeutic efficacy of codon-optimized gene sequences The codon optimization and protein production methods described herein can be applied to the treatment of diseases or conditions in subjects in need. In some embodiments, the treatment may be a preventative treatment for subjects at risk of disease or condition. In other embodiments, the treatment may alleviate, reverse, improve, stabilize, or improve a subject's disease state or condition. In other embodiments, the method may be used to alleviate, improve, reduce, or reverse the clinical manifestations of a disease or condition.

[0221] In some embodiments, the treatment method aims to treat a disease or condition caused by a defect or deficiency of a single gene or a single gene product (e.g., a single polynucleotide or protein). In some embodiments, the treatment method aims to treat a disease or condition that results in defects or deficiencies of multiple gene products. In some embodiments, the defect or deficiency is defined by reduced expression, reduced activity, and / or abnormal localization of one or more gene products. In some embodiments, the gene product is delivered for transient expression. In other embodiments, the gene product is integrated into the host genome.

[0222] In some embodiments, the treatment aims to replace, supplement, or complement gene products that are missing, deficient (e.g., low expression levels), or defective (e.g., mutated, loss-of-function, or low biological or catalytic activity) in a subject suffering from a disease or condition. In some embodiments, the condition or disease is characterized by a loss-of-function mutation or gene deletion. In other embodiments, the condition or disease is acquired (e.g., a deficiency or defect in the gene product due to random or environmental factors). In some embodiments, a codon-optimized gene product encodes a polypeptide or protein with the same amino acid sequence as the wild type (i.e., retaining 100% sequence identity) to replace, supplement, or complement low levels of one or more deficient or defective gene products. In other embodiments, the codon-optimized gene product encodes a polypeptide or protein having at least 85% (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) sequence identity with the wild-type amino acid sequence to encode a polypeptide or protein having improved biological function (e.g., increased catalytic function or reduced immunogenicity). Some examples of polypeptides or proteins that can be modified to improve their biological function include mutating or adding post-translational modification sites (e.g., glycosylation, phosphorylation, ubiquitination, nitrosation, methylation, acetylation, esterification, etc., or combinations thereof), mutating or adding cysteine ​​residues to alter or add disulfide bonds, modifying binding sites to enhance the binding activity between the protein of interest and one or more known binding partners, modifying protease binding or targeted cleavage sites, modifying signal sequences to enhance secretion or alter localization, and other protein modifications known in the art.

[0223] In some implementations, the treatment aims to increase or supplement the expression of a normally expressed gene product (e.g., present at concentrations within an acceptable healthy range) in a subject suffering from a disease or condition that would benefit from increased expression of the gene product. Increasing the expression of a normally expressed gene product may be necessary to increase the rate of an enzymatic reaction, enhance the potency or rate of a signal transduction response (e.g., intracellular or extracellular), regulate the transport or adhesion of cells or cellular components, or increase the likelihood or predisposition of binding or transient interactions (e.g., based on the affinity or K+ of two or more molecules). D This approach can modulate one or more biological processes, either directly or otherwise. Such methods may be used clinically to increase the expression of proteins with redundant functions to replace insufficient or defective proteins. Clinically, this approach can also be used to modulate pathogenic gene products that are logically more difficult to use as codon-optimized gene products for therapeutic purposes due to various non-limiting factors, including large gene size, low accessibility to target cells or tissues, and / or high immunogenicity of the gene product.

[0224] In some implementations, the treatment increases the expression of a protein or peptide (e.g., upregulates or induces the expression of an exogenous protein or peptide) to modulate or control a single pathogenic factor behind a disease. Such implementations can be used clinically to block, inhibit, proteolytically hydrolyze, mediate clearance, or otherwise attenuate the effects of pathogenic factors such as pathogens (e.g., viruses, bacteria, fungi, or parasites) or pro-inflammatory proteins (e.g., cytokines or cytokine receptors).

[0225] In some embodiments, treatment with an effective amount of codon-optimized gene product (e.g., a polynucleotide encoding a protein of interest; e.g., a transgene packaged into an AAV to encode a protein of interest) or a pharmaceutical composition containing the same gene product may increase the expression of the gene product by about 5% to 50% (e.g., about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, or about 50%), about 50% to 100% (about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, or about 100%) or more than 100% (about 100%, about 125%, about 150%, about 175%, about 200%, about 225%, about 250%, about 275%, about 300%, or more) compared to a reference sample (e.g., a biological sample from a healthy control subject or a biological sample from the same subject prior to treatment administration). In some implementations, treatment with an effective amount of codon-optimized gene product (e.g., a polynucleotide encoding the protein of interest; e.g., a transgene packaged into an AAV to encode the protein of interest) increases the expression of the gene product by about 1-fold, about 2-fold, about 3-fold, about 4-fold, about 5-fold, about 6-fold, about 7-fold, about 8-fold, about 9-fold, about 10-fold, about 11-fold, about 12-fold, about 13-fold, about 14-fold, about 15-fold, about 16-fold, about 17-fold, about 18-fold, about 19-fold, about 20-fold, about 25-fold, about 30-fold, about 35-fold, about 40-fold, about 45-fold, about 50-fold, or more compared to a reference sample (e.g., a biological sample from a healthy control subject or a biological sample from the same subject prior to treatment). In any of the foregoing embodiments, treatment with gene product optimized with an effective amount of codons can result in increased expression either globally (e.g., in all organ systems or all tissues of the subject; e.g., throughout the body) or locally (e.g., in a subset of tissues, in one or more organs, or in one or more organ systems of interest).

[0226] In some implementations, the treatments target metabolic disorders, hematologic disorders, cardiovascular disorders, neurological disorders, eye or ophthalmological disorders, reproductive disorders, infectious diseases, autoimmune or immune disorders, or certain types of cancer. Table 2 below summarizes example diseases and target genes that may benefit from the methods and applications described herein.

[0227] Table 2: Exemplary Diseases and Target Genes ii. Gene products with optimized codons Treatment methods include delivering a codon-optimized gene product or a pharmaceutical composition containing such gene product to a subject (e.g., a human) via any suitable route of administration (e.g., intramuscular, subcutaneous, intradermal, intravenous, intraperitoneal, intraarterial, intravenous, intranasal, intraorbital, intracranial, or intraosseous). In some embodiments, the treatment method includes administering a codon-optimized gene product or a pharmaceutical composition containing such gene product to a subject to produce a therapeutic effect. In some embodiments, the codon-optimized gene product or a pharmaceutical composition containing such gene product is administered to a subject as a single therapy. In some embodiments, the codon-optimized gene product or a pharmaceutical composition containing such gene product is administered to a subject as a combination therapy in conjunction with one or more additional therapies (e.g., 1, 2, 3, 4, or 5 additional therapeutic agents). In some embodiments, the combination therapy includes delivering two or more (e.g., 2, 3, 4, 5, or for 5) codon-optimized gene products or pharmaceutical compositions containing the same gene product to a subject. In some embodiments, combination therapy includes delivering to a subject one or more codon-optimized gene products or pharmaceutical compositions containing the same gene products, along with one or more additional therapeutic agents or other standard care interventions targeting a specific disease or condition. In some embodiments, combination therapy is administered to the subject to produce additional or synergistic therapeutic effects.

[0228] Codon-optimized gene products or pharmaceutical compositions containing such gene products can be administered at any suitable dose. The actual dose of the disclosed composition administered to a patient can be determined by physical and physiological factors such as weight, severity of symptoms, prior or concurrent treatment interventions, patient idiopathic conditions, and route of administration. Depending on the dose and route of administration, the preferred dose and / or the number of times an effective amount is administered may vary based on the subject's response. In some embodiments, the treatment is used to reduce, slow, and / or inhibit the onset or progression of a disease or condition. In other embodiments, the method can be used to alleviate, improve, reduce, or reverse the clinical presentation of a disease or condition. In some embodiments, the treatment method includes administering one or more codon-optimized gene products to a subject in a single dose. In some embodiments, the treatment method includes administering one or more codon-optimized gene products to a subject in multiple doses. Administration can be performed daily, weekly, monthly, or annually at any suitable frequency and can be performed as needed. The subject can be an adult or a child with or without comorbidities.

[0229] iii. Assess the efficacy Determining the efficacy of the treatments described herein may require assessing the subject's response to treatment. Subject responses can be assessed in an inpatient or outpatient setting. Subject responses can be assessed once or multiple times after administration of one or more codon-optimized gene products or pharmaceutical compositions containing such gene products. Assessment of subject responses can be performed continuously, occasionally, or at specified time points following administration of one or more codon-optimized gene products. Subject responses can be assessed, for example, 1–10 days after administration of one or more codon-optimized gene products (e.g., 7–10 days, 6–8 days, 5–7 days, 3–5 days, 2–4 days, 1–3 days, or within 1 day after administration of one or more codon-optimized gene products; e.g., 10 days, 9 days, 8 days, 7 days, 6 days, 5 days, 4 days, 3 days, 2 days, 1 day, or less than one day after administration of one or more codon-optimized gene products). The assessment of the subject's response can occur 1–12 weeks or longer after administration of one or more codon-optimized gene products (e.g., 10–12 weeks, 8–12 weeks, 6–12 weeks, 8–10 weeks, 6–10 weeks, 4–10 weeks, 6–8 weeks, 4–8 weeks, 2–8 weeks, 4–6 weeks, 2–6 weeks, 3–6 weeks, 2–4 weeks, 1–3 weeks, or 1–2 weeks after administration of one or more codon-optimized gene products; e.g., 12 weeks, 12 weeks, 11 weeks, 10 weeks, 9 weeks, 8 weeks, 7 weeks, 6 weeks, 5 weeks, 4 weeks, 3 weeks, 2 weeks, or 1 week after administration of one or more codon-optimized gene products). The assessment of a subject's response can be performed 1–12 months after administration of one or more codon-optimized gene products (e.g., 10–12 months, 8–10 months, 6–8 months, 4–6 months, 3–5 months, 2–4 months, or 1–3 months after administration of one or more codon-optimized gene products; e.g., 12 months, 11 months, 10 months, 9 months, 8 months, 7 months, 6 months, 5 months, 4 months, 3 months, 2 months, or 1 month after administration of one or more codon-optimized gene products). The assessment of a subject's response can also occur 1–5 years or longer after administration of one or more codon-optimized gene products (e.g., 4–5 years, 3–5 years, 2–3 years, or 1–3 years after administration of one or more codon-optimized gene products; e.g., 5 years, 5 years, 4 years, 3 years, 2 years, or 1 year after administration of one or more codon-optimized gene products).

[0230] The efficacy of a treatment method can be assessed by comparing one or more indicators of a treated subject with a relevant control or reference. In some embodiments, the efficacy of the treatment method is assessed by comparing one or more indicators of a treated subject with one or more indicators of the same subject prior to treatment. In some embodiments, the efficacy of the treatment method is assessed by comparing one or more indicators of a treated subject with one or more indicators of different subjects with the same disease or condition but who did not receive treatment. In a further embodiment, the efficacy of the treatment method is assessed by comparing one or more indicators of a treated subject with one or more indicators of healthy subjects (e.g., subjects without disease or condition).

[0231] In some embodiments, the indicator is the expression level of a protein or peptide encoded by a codon-optimized gene product or its mRNA transcript. In some embodiments, the indicator is the activity or biological function of a protein or peptide, wherein the protein is the same as or different from the protein encoded by the codon-optimized gene product (e.g., a downstream protein, effector protein, or binding protein). In some embodiments, the expression or activity of one or more proteins of interest is assessed by collecting one or more biological samples from a subject and comparing the results of earlier measurements from the subject with / or measurements from the subject prior to administration of one or more codon-optimized gene products. In some embodiments, the expression or activity of one or more proteins of interest is detected by biological or analytical methods known in the art or described herein.

[0232] The treatment regimen may be changed during treatment depending on the effectiveness of the treatment administered to the subject. The treatment regimen and its efficacy can be determined by those skilled in the art (e.g., physicians, clinicians, or medical experts). In some embodiments, the dosage of one or more codon-optimized gene products or pharmaceutical compositions containing them may be adjusted (e.g., reduced or increased) during treatment. In some embodiments, the dosage of one or more codon-optimized gene products or pharmaceutical compositions containing them may be increased by about 10%, 25%, 50%, 75%, 100%, 125%, 150%, 175%, 200%, or more during treatment. In some embodiments, the dosage of one or more codon-optimized gene products or pharmaceutical compositions may be reduced by about 10%, 25%, 50%, 75%, or more than 75% during treatment. In some embodiments, the frequency of administration of one or more codon-optimized gene products or pharmaceutical compositions may be increased or decreased during treatment. In further embodiments, one or more additional therapies may be added to the treatment regimen based on the disease or condition and its standards of care.

[0233] III. Reagent Kit The compositions or methods described herein may be provided as kits for the production of proteins or gene products. In some embodiments, the compositions and methods described herein may be provided as kits for the treatment of diseases or conditions. In some embodiments, the kit may include a package insert instructing the user of the kit on any of the codon optimization methods described herein. In further embodiments, the kit may include a package insert instructing the user of the kit on any of the therapeutic methods described herein. The kit may optionally include a syringe or a device for administering the compositions of this disclosure. In some embodiments, the kit may include one or more additional therapeutic agents. In some embodiments, the kit includes one or more antibodies or binding molecules for detecting the expression or activity of the protein of interest.

[0234] Example Example 1. Determination of ZsGreen fluorescent protein production using four different codon optimization methods. This embodiment describes the process of codon optimization of the sequence encoding the ZsGreen fluorescent protein reporter gene using two common codon usage schemes, and compares and analyzes the resulting sequences and their protein production with and without the application of a series of codon usage rules to reduce or eliminate DRACH motifs. The two common codon usage schemes are the "AllBest" scheme (also referred to as "AllBest" in this embodiment), which replaces one or more codons with the most frequently used synonymous codons, and the "AllProb" scheme (also referred to as "AllProb" in this embodiment), which modifies the gene or codon sequence so that the occurrence of one or more codons is proportional to their reported usage frequency. Table 1 shows exemplary codons and their usage frequencies. Codon usage rules (also referred to as "pRules" in this embodiment) are a strategy to reduce m6A modifications by removing DRACH motifs, and are applied in this embodiment and the following embodiments after modifying the coding sequence using one of the described codon usage schemes. The codon usage rules or pRules are as follows: 1. GAC is never used for aspartic acid (D). 2. GAA is never used for glutamate (E). 3. Glycine (G) is never used. 4. For lysine (K), AAA is never used. 5. AAC is never used for asparagine (N). 6. For threonine (T), always use ACG. In this embodiment, when using the six codon usage rules, they apply to every occurrence of the D, E, G, K, N, and T codons in the encoded sequence. This method eliminates all DRACH motifs and alters many codons unrelated to the m6A modification.

[0235] The open reading frames (ORFs) of the ZsGreen DNA sequence after removing the DRACH motif using one or more codon optimization strategies are shown below: 1. ZsG ORF (SEQ ID NO: 1) optimized using the best codon usage scheme. >ZsG_AllBest ATGGCCCAGAGCAAGCACGGCCTGACCAAGGAGATGACCATGAAGTACCGGATGGAGGGCTGCGTGGACGGCCACAAGTTCGTGATCACCGGCGAGGGCATCGGCTACCCCTTCAAGGGCAAGCAGGCCATCAACCTGGTGCGTGGTGGAGGGCGGCCCCCTGCCCTTCGCCGAG GACATCCTGAGCGCCGCCTTCATGTACGGCAACCGGGTGTTCACCGAGTACCCCCAGGACATCGTGGACTACTTCAAGAACAGCTGCCCCGCCGGCTACACCTGGGACCGGAGCTTCCTGTTCGAGGACGGCGCCGTGTGCATCTGCAACGCCGACATCACCGTGAGCGTGGAG GAGAACTGCATGTACCACGAGAGCAAGTTCTACGGCGTGAACTTCCCCGCCGACGGCCCCGTGATGAAGAAGATGACCGACAACTGGGAGCCCAGCTGCGAGAAGATCATCCCCGTGCCCAAGCAGGGCATCCTGAAGGGCGACGTGAGCATGTACCTGCTGCTGAAGGACGGC GGCCGGCTGCGGTGCCAGTTCGACACCGTGTACAAGGCCAAGAGCGTGCCCCGGAAGATGCCCGACTGGCACTTCATCCAGCACAAGCTGACCCGGGAGGACCGGAGCGACGCCAAGAACCAGAAGTGGCACCTGACCGAGCACGCCATCGCCAGCGGCAGCGCCCTGCCCTGA 2. The ZsG ORF (SEQ ID NO: 2) is obtained by employing the best codon usage scheme and then optimizing the codons using six codon usage rules. >ZsG_ABpRules ATGGCCCAGAGCAAGCACGGCCTGACGAAGGAGATGACGATGAAGTACCGGATGGAGGGCTGCGTGGATGGCCACAAGTTCGTGATCACGGGCGAGGGCATCGGCTACCCCTTCAAGGGCAAGCAGGCCATCAATCGTGCGTGGTGGAGGGCGGCCCCCTGCCCTTCGCCGAG GATATCCTGAGCGCCGCCTTCATGTACGGCAATCGGGTGTTCACGGAGTACCCCCAGGATATCGTGGATTACTTCAAGAATAGCTGCCCCGCCGGCTACACGTGGGATCGGAGCTTCCTGTTCGAGGATGGCGCCGTGTGCATCTGCAATGCCGATATCACGGTGAGCGTGGAG GAGAATTGCATGTACCACGAGAGCAAGTTCTACGGCGTGAATTTCCCCGCCGATGGCCCCGTGATGAAGAAGATGACGGATAATTGGGAGCCCAGCTGCGAGAAGATCATCCCCGTGCCCAAGCAGGGCATCCTGAAGGGCGATGTGAGCATGTACCTGCTGCTGAAGGATGGC GGCCGGCTGCGGTGCCAGTTCGATACGGTGTACAAGGCCAAGAGCGTGCCCCGGAAGATGCCCGATTGGCACTTCATCCAGCACAAGCTGACGCGGGAGGATCGGAGCGATGCCAAGAATCAGAAGTGGCACCTGACGGAGCACGCCATCGCCAGCGGCAGCGCCCTGCCCTGA 3. ZsG ORF (SEQ ID NO: 3) after codon optimization using the codon usage scheme according to the specified proportions. >ZsG_AllProb ATGGCCCAGTCAAAACATGGACTCACTAAAGAGATGACCATGAAATACAGAATGGAGGGGTGCGTCGATGGTCACAAATTCGTCATCACCGGCGAGGGGATTGGATATCCATTCAAGGGAAAGCAGGCCATTAACCTGTGCGTCGTGGAAGGAGGACCACTGCCTTTCGCAGAAGATATCCTCAGTGCCGCATTCATGTATGGAAACAGGGTCTTCACTGAGTACCCACAGGATATTGTTGACTATTTTAAAAATTCTTGCCCAGCCGGCTATACATGGGACCGCTCCTTCCTCTTTGAAGACGGAGCGGTGTGTATCTGCAACGCAGATATCACAGTGTCCGTTGAGGAAAACTGCATGTATCACGAAAGCAAGTTCTATGGCGTGAATTTCCCTGCGGACGGGCCCGTTATGAAGAAGATGACAGACAATTGGGAGCCCAGTTGCGAGAAAATCATTCCAGTGCCCAAGCAGGGGATTCTCAAGGGCGACGTAAGCATGTACCTGCTGCTAAAGGATGGAGGTCGCTTACGCTGCCAGTTTGACACCGTCTATAAAGCCAAGAGCGTCCCCCGGAAGATGCCGGACTGGCATTTTATCCAGCACAAGCTGACCCGTGAGGACAGGTCTGATGCCAAAAATCAGAAGTGGCACTTAACTGAGCATGCTATCGCAAGCGGATCAGCACTCCCGTGA 4. The ZsG ORF (SEQ ID NO: 4) after codon optimization using a proportional codon usage scheme and then applying six codon usage rules >ZsG_APpRules ATGGCCCAGTCAAAGCATGGCCTCACGAAGGAGATGACGATGAAGTACAGAATGGAGGGGTGCGTCGATGGTCACAAGTTCGTCATCACGGGCGAGGGGATTGGGTATCCATTCAAGGGCAAGCAGGCCATTAATCTGTGCGTCGTGGAGGGCGGCCCACTGCCTTTCGCAGAG GATATCCTCATGCCGCATTCATGTATGGCAATAGGGTCTTCACGGAGTACCCACAGGATTTGTTGATTATTTTAAGAATTCTTGCCCAGCCGGCTATACGTGGGATCGCTCCTTCCTCTTTGAGGATGGGGCGGTGTGTATCTGCAATGCAGATATCACGGTGTCCGTTGAG GAGAATTGCATGTATCACGAGAGCAAGTTCTATGGCGTGAATTTCCCTGCGGATGGGCCCGTTATGAAGAAGATGACGGATAATTGGGAGCCCAGTTGCGAGAAGATCATTCCAGTGCCCAAGCAGGGGATTCTCAAGGGCGATGTAAGCATGTACCTGCTGCTAAAGGATGGC GGTCGCTTACGCTGCCAGTTTGATACGGTCTATAAGGCCAAGAGCGTCCCCCGGAAGATGCCGGATTGGCATTTTATCCAGCACAAGCTGACGCGTGAGGATAGGTCTGATGCCAAGAATCAGAAGTGGCACTTAACGGAGCATGCTATCGCAAGCGGTTCAGCACTCCCGTGA Based on the codon optimization strategy, the number of DRACH motifs in the ZsGreen open reading frame was quantified, and the results are shown in Table 3 below.

[0236] Table 3: Number of DRACH motifs after ZsGreen ORF codon optimization After quantifying the number of DRACH motifs, the resulting ORFs were aligned and compared to evaluate differences in codon optimization strategies. The comparison results are shown below, where identical nucleotides are marked with an asterisk (...). Differences in polynucleotide sequences are indicated by bold and underline.

[0237] 1. The ZsGreen ORF was compared according to the optimal codon usage scheme, and six codon usage rules were not applied (SEQ ID NO: 1) and were applied (SEQ ID NO: 2): 2. The ZsGreen ORF was compared according to the proportional codon usage scheme, and the six codon usage rules (SEQ ID NO: 3 and SEQ ID NO: 4) were not applied. Then, each of the four ZsGreen fluorescent protein ORFs was commercially ordered as a synthetic double-stranded DNA (dsDNA) fragment and cloned into the BamHI and EcoRI restriction sites of ZsGreen1 in plasmid pAAV. Figure 1 After verifying the sequence of the cloned plasmid using Sanger sequencing, the ZsGreen1 plasmid variant, along with the control pUC19 plasmid (to balance the total DNA amount), was transiently transfected into HEK293T cells in 24-well plates using liposome 3000, according to the manufacturer's instructions. The DNA transfection conditions are shown in Table 4 below.

[0238] Table 4: Transfection Conditions Two or three days post-transfection, transfected HEK293 cells were collected by trypsin digestion, and the relative protein production of each ORF variant under both transfection conditions was analyzed by flow cytometry, with relative ZsGreen fluorescence measured in the green channel. Post-transfection, ORFs generated by the full optimal codon usage protocol with and without the six additional codon usage rule were compared (Figure 2). ORFs generated by the proportional usage protocol with and without the six additional codon usage rule were also compared (Figure 3).

[0239] Example 2. Determination of GLP-1-Fc protein production with or without reduction of DRACH motifs using commercially available codon optimization network tools. This embodiment describes the process of codon optimization of the sequence encoding the GLP-1-Fc protein using commercially available online tools, and compares and analyzes the resulting sequences and their protein production with and without the application of a series of codon usage rules to reduce or eliminate DRACH motifs. The codon usage rules or pRules are as follows: 1. GAC is never used for aspartic acid (D). 2. GAA is never used for glutamate (E). 3. Glycine (G) is never used. 4. For lysine (K), AAA is never used. 5. AAC is never used for asparagine (N). 6. For threonine (T), always use ACT. In this embodiment, the six-codon usage rule applies only to the observed DRACH motif, not to the D, E, G, K, N, and T codons that appear every time in the sequence. To generate a codon-optimized GLP1-Fc ORF for protein production, the amino acid sequence was input into the IDT codon optimization network tool on the Integrated DNA Technologies website. After inputting the amino acid sequence, the GLP-1-Fc ORF was generated, and the DRACH motif was quantified. The GLP-1-Fc ORF (SEQ ID NO: 5) generated by the IDT codon optimization network tool is shown below: IDT ATGATCCCCGCAAAGGACATGGCGAAGGTAATGATTGTGATGCTGGCAATCTGCTTTCTGACTAAGTCAGACGGGAAGTCAGTTAAGAAGCGCCACGGCGAAGGCACCTTTACCAGTGATGTTAGCTCGTATCTGGAGGAACAGGCCGCCAAAGAGTTCATCGCCTGGCTCGTGAAGGGGGGAGGCGGAGGAGGTGGATCTGGGGGCGGTGGGTCCGGTGGTGGCGGCTCCGCGGAATCGAAATACGGCCCTCCTTGTCCACCATGCCCCGCTCCTGAAGCCGCAGGAGGACCCTCTGTCTTTCTCTTCCCACCTAAGCCTAAAGATACTCTTATGATAAGTCGAACCCCTGAGGTGACATGCGTGGTGGTCGATGTTTCACAGGAAGACCCTGAGGTCCAGTTCAACTGGTATGTTGATGGGGTAGAGGTACACAATGCCAAAACAAAGCCTAGAGAGGAACAGTTCAATAGCACATATCGCGTGGTTTCCGTGCTGACAGTGCTGCACCAGGACTGGCTCAACGGAAAGGAGTACAAGTGTAAGGTTAGCAACAAAGGCCTTCCAAGTTCGATAGAGAAGACAATCTCTAAAGCTAAGGGACAGCCTAGAGAGCCACAGGTTTACACTCTGCCCCCCAGTCAGGAGGAAATGACCAAAAACCAGGTCAGCCTGACTTGTCTGGTGAAGGGATTCTATCCATCAGATATTGCCGTCGAGTGGGAAAGCAATGGGCAGCCTGAGAATAATTACAAAACCACACCCCCCGTGCTGGATAGCGACGGCAGCTTTTTCCTATATTCCCGACTTACCGTTGACAAGTCCCGCTGGCAGGAAGGCAATGTGTTTTCTTGCAGTGTGATGCACGAGGCATTGCATAATCACTATACCCAGAAAAGCCTGAGCCTGTCCCTGGGGTGA A total of 19 DRACH motifs appeared in the GLP-1-Fc ORF. Next, the ORF was further modified according to six codon usage rules to modify the DRACH motifs. Following these rules, 18 DRACH motifs were removed through synonymous codon substitution. Due to cloning limitations, one DRACH motif in the sequence could not be changed and therefore remained in the ORF without substitution. The resulting modified sequence is shown below, where all but one DRACH motif were removed from the IDT sequence (IDT-m6A) (SEQ ID NO: 6): IDT-m6A ATGATCCCCGCAAAGGATATGGCGAAGGTAATGATTGTGATGCTGGCAATCTGCTTTCTGACGAAGTCAGACGGGAAGTCAGTTAAGAAGCGCCACGGCGAAGGCACCTTTACCAGTGATGTTAGCTCGTATCTGGAGGAGCAGGCCGCCAAAGAGTTCATCGCCTGGCTCGTGAAGGGGGGAGGCGGAGGAGGTGGATCTGGGGGCGGTGGGTCCGGTGGTGGCGGCTCCGCGGAATCGAAATACGGCCCTCCTTGTCCACCATGCCCCGCTCCTGAAGCCGCAGGAGGCCCCTCTGTCTTTCTCTTCCCACCTAAGCCTAAAGATACTCTTATGATAAGTCGAACGCCTGAGGTGACGTGCGTGGTGGTCGATGTTTCACAGGAGGATCCTGAGGTCCAGTTCAACTGGTATGTTGATGGGGTAGAGGTACACAATGCCAAGACGAAGCCTAGAGAGGAGCAGTTCAATAGCACATATCGCGTGGTTTCCGTGCTGACGGTGCTGCACCAGGATTGGCTCAACGGAAAGGAGTACAAGTGTAAGGTTAGCAACAAAGGCCTTCCAAGTTCGATAGAGAAGACGATCTCTAAAGCTAAGGGCCAGCCTAGAGAGCCACAGGTTTACACTCTGCCCCCCAGTCAGGAGGAAATGACGAAGAATCAGGTCAGCCTGACGTGTCTGGTGAAGGGATTCTATCCATCAGATATTGCCGTCGAGTGGGAAAGCAATGGGCAGCCTGAGAATAATTACAAGACGACACCCCCCGTGCTGGATAGCGACGGCAGCTTTTTCCTATATTCCCGACTTACCGTTGATAAGTCCCGCTGGCAGGAAGGCAATGTGTTTTCTTGCAGTGTGATGCACGAGGCATTGCATAATCACTATACCCAGAAAAGCCTGAGCCTGTCCCTGGGGTGA The generated GLP1-Fc ORFs were compared, with the DRACH motif either preserved (IDT) (SEQ ID NO: 5) or removed according to the six-codon usage rule (IDT-m6A) (SEQ ID NO: 6), as shown below, where identical nucleotides are marked with an asterisk ( Differences in polynucleotide sequences are indicated by bold and underline.

[0240] The two ORFs shown above were ordered as synthetic dsDNA fragments and cloned between the BamHI and EcoRI restriction sites of the pAAV ZsGreen1 plasmid. Figure 1 After verifying the sequence of the cloned plasmid using Sanger sequencing, the plasmid containing the ORF variant and the control pUC19 plasmid (total DNA 0.5 μg) were transiently transfected into HEK293T cells in 24-well plates using Lipofectamine 3000 according to the manufacturer's instructions. The DNA transfection conditions are shown in Table 5 below.

[0241] Table 5: Transfection Conditions Two days after transfection, cell culture supernatant was collected, and the amount of secreted GLP-1-Fc protein was quantified by ELISA. Compared to samples where codon optimization was performed using only the IDT network tool, the concentration of GLP-1-Fc protein detected in samples with reduced DRACH motifs was increased by more than 5-fold. Figure 4 ).

[0242] Example 3. Determination of GLP-1-Fc protein production via AAV transduction after removal of the DRACH motif. This embodiment describes the process of codon optimization of the sequence encoding the GLP-1-Fc protein, where all amino acids in the ORF are encoded by the most preferred codons (i.e., the most frequently used codons) in each case. Then, codon usage rules are applied to the codon-optimized ORF to eliminate the DRACH motif. The codon usage rules, or pRules, are as follows: 1. GAC is never used for aspartic acid (D). 2. GAA is never used for glutamate (E). 3. Glycine (G) is never used. 4. For lysine (K), AAA is never used. 5. AAC is never used for asparagine (N). 6. For threonine (T), always use ACT. The codon-optimized ORF encoding GLP-1-Fc (labeled CH) (SEQ ID NO: 7) contains 19 DRACH motifs, as shown below: >CH atgatccccgccaaggacatggccaaggtgatgatcgtgatgctggccatctgcttcctgaccaagtccgacggcaagtccgtgaagaagcgccacggcgagggcaccttcaccagcgacgtgtctagctacctggaggagcaggccgccaaggagttcatcgcctggctggtgaagggcggcggcggcggcggcggcagcggcggcggcggcagcggcggcggcggcagcgccgagagcaagtacggccccccctgccccccctgccccgcccccgaggccgccggcggccccagcgtgttcctgttcccccccaagcccaaggacaccctgatgatcagcaggacccccgaggtgacctgcgtggtggtggacgtgagccaggaggaccccgaggtgcagttcaactggtacgtggacggcgtggaggtgcacaacgccaagaccaagcccagggaggagcagttcaacagcacctacagggtggtgagcgtgctgaccgtgctgcaccaggactggctgaacggcaaggagtacaagtgcaaggtttctaacaagggcctgcccagcagcatcgagaagaccatcagcaaggccaagggccagcccagggagccccaggtgtacaccctgccccccagccaggaggagatgaccaagaaccaagttagcctgacctgcctggtgaagggcttctaccccagcgacatcgccgtggagtgggagagcaacggccagcccgagaacaactacaagaccaccccccccgtgctggacagcgacggcagcttcttcctgtacagccgactgaccgtggacaagagcaggtggcaggagggcaacgtgttcagctgcagcgtgatgcacgaggccctgcacaaccactacacccagaagagcctgagcctgagcctgggctga Further modifications to the CH ORF according to the six codon usage rules to eliminate the DRACH motif resulted in the replacement of 20 base pairs and the removal of all 19 DRACH motifs present in the codon-optimized CH ORF. The following shows the further modified ORF encoding GLP-1-Fc, where all DRACH motifs were removed (labeled CH-m6A) (SEQ ID NO: 8), with all modified base pairs shown in bold and underlined: The alignment of codon-optimized GLP-1-FcORF (CH) (SEQ ID NO: 7) with codon-optimized GLP-1-FcORF (with the DRACH motif (CH-m6A) removed (SEQ ID NO: 8)) is shown below, where identical nucleotides are marked with an asterisk ( The CH-m6A sequence is indicated by nucleotide fragments containing the DRACH motif (uppercase letters) and modified nucleotides (bold and underlined): After verifying the polynucleotide sequence of the ORF, the amino acid sequence encoded by each ORF was aligned to ensure that the GLP-1-Fc protein retains 100% sequence identity after the DRACH motif in the ORF is removed. The amino acid sequence alignments of CH ORF (SEQ ID NO: 9) and CH-m6a ORF (SEQ ID NO: 10) are shown below, where identical amino acids are marked with an asterisk (…). Mark: After confirming the polynucleotide and amino acid sequences, CH and CH-m6A GLP-1-Fc ORFS (SEQ ID NO: 7 and 8) were ordered as the synthesized dsDNA fragments and then cloned into the pAAV ZsGreen1 plasmid between the BamHI and EcoRI restriction sites. The sequence of the cloned plasmid was verified by Sanger sequencing.

[0243] Then, using the CH and CH-m6A plasmids and the IDT and IDT-m6A plasmids described in Example 2, the AAV9 vector was transfected into HEK293 cells via triple transfection using standard methods known in the art. The recovered AAV9.GLP-1Fc vector was titered by qPCR to determine the vector genome concentration, and then at a rate of 1 x 10⁻⁶ cells per cell. 6The multiple of infection (MOI) of a vector genome was applied to HEK293 cells for GLP-1-Fc protein transduction. Three days after protein transduction, HEK293 cell culture supernatant was collected, and the level of secreted GLP-1-Fc protein was measured by ELISA.

[0244] The GLP-1-Fc protein level in each sample was compared relative to the CH codon-optimized ORF sample. Figure 5 Compared to the CH sample using the CH ORF (SEQ ID NO: 7), the CH-m6A sample with all DRACH motifs removed from the codon-optimized CH ORF (SEQ ID NO: 8) resulted in a 3-fold increase in detectable GLP-1-Fc protein secretion. The ORF optimized using the IDT codon optimization network tool (SEQ ID NO: 5) resulted in a 1.3-fold increase in detectable GLP-1-Fc protein secretion compared to the CH sample. Furthermore, the IDT codon-optimized ORF (SEQ ID NO: 6) (in which all motifs except one DRACH motif were removed) resulted in a 6.8-fold increase in detectable GLP-1-Fc protein secretion compared to the CH sample.

[0245] Example 4. Evaluation of circulating GLP-1-Fc protein in vivo after AAV delivery This example illustrates the impact of different codon optimization methods described in Examples 2 and 3 on in vivo protein production.

[0246] In addition to the four AAV vectors prepared according to Example 3, a natural ORF encoding GLP-1-Fc (i.e., an ORF without any codon optimization methods) was generated based on the human GLP-1 gene sequence. The natural GLP-1-Fc ORF (SEQ ID NO: 11) is shown below: Natural ATGATACCTGCAAAAGACATGGCTAAAGTTATGATTGTCATGTTGGCAATTTGTTTTCTTACAAAATCGGATGGGAAATCTGTAAAGAAGCGGCATGGAGAAGGGACCTTTACCAGTGATGTAAGTTCTTATTTGGAAGAACAAGCTGCCAAGGAATTCATTGCTTGGCTGGTGAAAGGCGGAGGAGGGGGGGGGGGGTCAGGCGGAGGGGGCTCCGGAGGAGGAGGATCTGCAGAGTCCAAATATGGTCCCCCATGCCCACCATGCCCAGCACCTGAGGCTGCAGGGGGACCATCAGTCTTCCTGTTCCCCCCAAAACCCAAGGACACTCTCATGATCTCCCGGACCCCTGAGGTCACGTGCGTGGTGGTGGACGTGAGCCAGGAAGACCCCGAGGTCCAGTTCAACTGGTACGTGGATGGCGTGGAGGTGCATAATGCCAAGACAAAGCCGCGGGAGGAGCAGTTCAACAGCACGTACCGTGTGGTCAGCGTCCTCACCGTCCTGCACCAGGACTGGCTGAACGGCAAGGAGTACAAGTGCAAGGTCTCCAACAAAGGCCTCCCGTCCTCCATCGAGAAAACCATCTCCAAAGCCAAAGGGCAGCCCCGAGAGCCACAGGTGTACACCCTGCCCCCATCCCAGGAGGAGATGACCAAGAACCAGGTCAGCCTGACCTGCCTGGTCAAAGGCTTCTACCCCAGCGACATCGCCGTGGAGTGGGAGAGCAATGGGCAGCCGGAGAACAACTACAAGACCACGCCTCCCGTGCTGGACTCCGACGGCTCCTTCTTCCTCTACAGCAGGCTCACCGTGGACAAGAGCAGGTGGCAGGAGGGGAATGTCTTCTCATGCTCCGTGATGCATGAGGCTCTGCACAACCACTACACACAGAAGAGCCTCTCCCTGTCTCTGGGTTGA Plasmids and AAV vectors encoding the native GLP-1-Fc sequence were generated and validated using the same method described in Example 3.

[0247] To test the in vivo protein production of the four codon optimization methods, each GLP-1-Fc AAV vector was administered at a low dose (1 x 10⁻⁶ per mouse). 9 One genome copy (GC) or a high dose (1 x 10^12 copies per mouse) or high dose (1 x 10^12 copies per mouse) 10 Each GC was injected into mice. Each vector and administration group consisted of eight 8-week-old female rag mice.

[0248] Each mouse received a single intramuscular injection of 10 μL of GLP-1-Fc AAV vector into its leg. Serum samples were collected from the mice every 2 weeks for 60 days post-injection. Muscle tissue and liver samples were collected at the injection site during necropsy, as these tissues are the primary organs for protein transduction following intramuscular AAV administration. Serum GLP-1-Fc protein levels were assessed by ELISA, and GLP-1-Fc mRNA transcript levels in muscle and liver tissue homogenates were measured by qPCR.

[0249] In both dosing groups, the CH-m6A and CH codon-optimized AAV vectors produced the highest detectable concentrations of GLP-1-Fc protein in serum at every time point over 42 days. Figures 6A-6B On day 14, serum samples containing the vector encoding the native sequence showed the lowest levels of GLP-1-Fc protein, while those containing the vector encoding the CH codon-optimized sequence (CH-m6A) (SEQ ID NO: 8) with the DRACH motif removed showed the highest levels of GLP-1-Fc protein. The vector encoding the CH-m6A sequence (SEQ ID NO: 8) resulted in a 4.5-fold increase in serum GLP-1-Fc protein concentration compared to the vector encoding the native sequence. Figure 7 ).

[0250] To further evaluate the impact of m6A modification (i.e., the presence of the DRACH motif) on protein production efficiency, the levels of detectable GLP-1-Fc protein in serum were compared 28 days after AAV vector administration, based on codon optimization strategies and dosage composition. Figure 8A -D). When the DRACH motif was removed, three of the four comparative experimental groups showed elevated serum GLP-1-Fc protein levels. Compared to the IDT codon optimization protocol alone (SEQ ID NO: 5), the IDT codon optimization protocol after removing the DRACH motif (SEQ ID NO: 6) resulted in a 3.6-fold increase in serum GLP-1-Fc protein levels following low-dose injection of each AAV vector. Figure 8ACompared to using the CH codon optimization scheme alone (SEQ ID NO: 7), the CH codon optimization scheme, which removed the DRACH motif (SEQ ID NO: 8), resulted in a 1.75-fold increase in serum GLP-1-Fc protein levels after low-dose injection of each AAV vector. Figure 8B Similarly, at high doses, the IDT codon optimization scheme (SEQ ID NO: 6) after removing the DRACH motif resulted in a 2.0-fold increase in GLP-1-Fc protein levels compared to the ID codon optimization scheme alone (SEQ ID NO: 5). Figure 8D However, no significant differences in serum GLP-1-Fc protein levels were observed with high-dose injections of either variant of the CH codon-optimized vector.

[0251] Similar trends in GLP-1-Fc mRNA transcript levels were observed in muscle and liver tissues. In every group except for the low-dose CH codon-optimized vector, the vector with the DRACH motif removed after codon optimization produced higher detectable GLP-1-Fc mRNA transcripts (Figures 9-10). The greatest difference in tissue GLP-1-Fc mRNA transcript expression was observed in muscle tissue following high-dose injection of the IDT codon-optimized vector, where removal of the DRACH motif from the codon-optimized ORF resulted in a 15.2-fold increase in detectable GLP-1-Fc mRNA levels after 60 days. Figure 9C In summary, these results indicate that removal of the DRACH motif can lead to increased expression of mRNA transcripts and proteins after transduction.

[0252] Other implementation plans All publications, patents and patent applications mentioned in this specification are incorporated herein by reference to the extent that each individual publication or patent application is specifically and individually identified and incorporated by reference.

[0253] Although the invention has been described in conjunction with its specific embodiments, it should be understood that further modifications can be made to it and this application is intended to cover any variations, uses or adaptations made based on the principles, including known or conventional practices that, while not part of the invention, fall within the field to which the invention pertains, and changes that fall within the essential features described above and are within the scope of the claims.

[0254] Other embodiments are defined in the claims.

Claims

1. A method for codon optimization of a polynucleotide sequence encoding a polypeptide of interest, the method comprising replacing one or more nucleotides in a DRACH motif within the polynucleotide sequence with an equal amount of alternative nucleotides that eliminate the DRACH motif, wherein the replacement does not alter the amino acid sequence of the encoded polypeptide.

2. The method of claim 1, wherein the polynucleotide sequence comprises a plurality of DRACH motifs, and wherein the substitution is performed only in a subset of the DRACH motifs.

3. The method of claim 2, wherein the substitution is performed only on the DRACH motif, the DRACH motif being at least 10 nucleotides away from the splice junction site within the polynucleotide sequence.

4. The method of claim 3, wherein the substitution is performed only on the DRACH motif, the DRACH motif being at least 20 nucleotides, at least 30 nucleotides, at least 40 nucleotides, at least 50 nucleotides, at least 60 nucleotides, at least 70 nucleotides, at least 80 nucleotides, at least 90 nucleotides, at least 100 nucleotides, at least 110 nucleotides, at least 120 nucleotides, at least 130 nucleotides, at least 140 nucleotides, at least 150 nucleotides, at least 160 nucleotides, at least 170 nucleotides, at least 180 nucleotides, at least 190 nucleotides, at least 200 nucleotides, or more away from the splice junction site within the polynucleotide sequence.

5. The method of claim 2, wherein the substitution is performed only on the DRACH motif, the DRACH motif being located at a splice junction site within the polynucleotide sequence at a distance of about 10 nucleotides to about 200 nucleotides, about 20 nucleotides to about 190 nucleotides, about 30 nucleotides to about 180 nucleotides, about 40 nucleotides to about 170 nucleotides, about 50 nucleotides to about 160 nucleotides, about 60 nucleotides to about 150 nucleotides, about 70 nucleotides to about 140 nucleotides, about 80 nucleotides to about 130 nucleotides, about 90 nucleotides to about 120 nucleotides, or about 100 nucleotides.

6. The method of any one of claims 1-5, wherein the substitution is performed on a DRACH motif selected from AGACA, AGACT, GAACC, GAACT, GGACA, GGACT, TGACT, AAACA, AAACC, AAACT, AGACC, GACA, GGACC, TAACA, TAACC, TAACT, TGACA, and TGACC.

7. The method of claim 6, wherein the substitution is performed on a DRACH motif selected from AGACA, AGACT, GAACC, GAACT, GGACA, GGACT, and TGACT.

8. The method of any one of claims 1-7, wherein the substitution of one or more nucleotides in the DRACH motif is performed using one or more codon usage guidelines selected from: (a) The codon GAC is never used to encode aspartic acid when the DRACH motif is eliminated; (b) The codon GAA encoding glutamate is never used when the DRACH motif is eliminated; (c) Glycine is never encoded by the codon GGA when the DRACH motif is eliminated; (d) When eliminating the DRACH motif, the codon AAA encoding lysine is never used; (e) never using the AAC codon to encode asparagine when eliminating the DRACH motif; and / or (f) The codon ACG is always used to encode threonine when eliminating the DRACH motif.

9. The method of any one of claims 1-8, wherein the codon optimization further comprises implementing one or more codon usage guidelines selected from the following throughout the polynucleotide sequence: (a) The codon GAC is never used to encode aspartic acid throughout the entire polynucleotide sequence; (b) The codon GAA is never used to encode glutamic acid throughout the entire polynucleotide sequence; (c) The codon GGA is never used to encode glycine throughout the entire polynucleotide sequence; (d) The codon AAA is never used to encode lysine throughout the entire polynucleotide sequence; (e) The codon AAC is never used to encode asparagine throughout the entire polynucleotide sequence; and / or (f) Threonine is always encoded using the codon ACG throughout the entire polynucleotide sequence.

10. The method of any one of claims 1-9, wherein prior to replacing the one or more nucleotides in the DRACH motif, the polynucleotide sequence has been codon optimized by replacing one or more nucleotides in the codon with an equal amount of alternative nucleotides, the alternative nucleotides collectively constituting a synonymous codon, the synonymous codon occurring more frequently in the target organism than the unmodified codon occurs in the target organism.

11. The method of any one of claims 1-10, wherein prior to replacing the one or more nucleotides in the DRACH motif, the polynucleotide sequence has been codon-optimized by replacing one or more codons in the polynucleotide sequence with an equal number of synonymous codons, the synonymous codons being more frequently naturally occurring in the target organism than the one or more unmodified codons being more frequently occurring in the target organism.

12. The method of claim 10 or 11, wherein the target organism is a mammal, optionally wherein the mammal is a human.

13. The method of any one of claims 1-12, wherein the polynucleotide sequence has been codon-optimized using a codon optimization network tool, codon optimization software, quantum computing, heuristic scoring method, neural network, or a combination thereof before replacing the one or more nucleotides in the DRACH motif.

14. The method of any one of claims 1-13, wherein the polynucleotide sequence has been codon-optimized by adjusting the polynucleotide guanine-cytosine (GC) content, polynucleotide secondary structure, mRNA motif, ribosome binding site, and / or translation rate before replacing the one or more nucleotides in the DRACH motif.

15. The method of claim 14, wherein the polynucleotide GC content is adjusted to between 50% and 80%.

16. The method of claim 15, wherein the polynucleotide GC content is adjusted to between 65% and 75%.

17. The method of any one of claims 1-16, wherein after replacing the one or more nucleotides in the DRACH motif, the codon optimization method further comprises replacing the one or more nucleotides in the codon with an equal amount of alternative nucleotides, the alternative nucleotides collectively constituting a synonymous codon, the synonymous codon occurring more frequently in the target organism than the unmodified codon occurs in the target organism.

18. The method of any one of claims 1-16, wherein after replacing the one or more nucleotides in the DRACH motif, the codon optimization method further comprises replacing one or more codons in the polynucleotide sequence with an equal amount of synonymous codons, the synonymous codons being more frequently naturally occurring in the target organism than the one or more unmodified codons being more frequently occurring in the target organism.

19. The method of claim 17 or 18, wherein the target organism is a mammal, and optionally the mammal is a human.

20. The method of any one of claims 1-19, wherein after replacing one or more nucleotides in the DRACH motif, the codon optimization method further comprises performing codon optimization by means of a codon optimization network tool, codon optimization software, quantum computing, heuristic scoring methods, neural networks, or a combination thereof.

21. The method of any one of claims 1-20, wherein after replacing one or more nucleotides in the DRACH motif, the codon optimization method further comprises regulating the polynucleotide GC content, polynucleotide secondary structure, mRNA motif, ribosome binding site, and / or translation rate.

22. The method of claim 21, wherein the polynucleotide GC content is adjusted to between 50% and 80%.

23. The method of claim 22, wherein the polynucleotide GC content is adjusted to between 65% and 75%.

24. The method of any one of claims 1-23, wherein the amino acid sequence of the protein or polypeptide, after codon optimization, has at least 85% sequence identity with the wild-type amino acid sequence of the protein or polypeptide.

25. The method of any one of claims 1-24, wherein the amino acid sequence of the protein or polypeptide, after codon optimization, has 100% sequence identity with the wild-type amino acid sequence of the protein or polypeptide.

26. The method of any one of claims 1-25, wherein the number of DRACH motifs in the polynucleotide sequence is reduced by at least 90%, at least 80%, at least 70%, at least 60%, at least 50%, at least 40%, at least 30%, at least 20%, or at least 10% compared to the corresponding polynucleotide sequence not subjected to the method.

27. The method of claim 26, wherein the number of DRACH motifs in the polynucleotide sequence is reduced by 100% compared to the corresponding polynucleotide sequence not subjected to the method.

28. The method of any one of claims 1-27, wherein the codon optimization method results in increased mRNA transcript stability or half-life.

29. The method of claim 28, wherein the increase in mRNA transcript stability or half-life is assessed by an increase in concentration or relative abundance compared to the corresponding polynucleotide sequence not subjected to the method.

30. The method of claim 29, wherein the increase in mRNA transcript concentration or relative abundance compared to mRNA transcripts of natural polynucleotide sequences is measured by RT-PCR, fluorescence assay, colorimetric assay, spectrophotometric analysis, flow cytometry, in situ hybridization, RNA blot analysis, or using an array of one or more hybrid oligonucleotides or antibodies targeting the mRNA transcript of interest.

31. The method of claim 28, wherein the increase in mRNA transcript stability or half-life is assessed by a reduced decay rate, the decay rate being detected by one or more pulse tracking methods.

32. The method of claims 1-31, wherein reducing the number of DRACH motifs in the polynucleotide sequence compared to the corresponding polynucleotide sequence not subjected to the method reduces the amount of DRACH motifs in the mRNA transcript. N The amount of (6)-methyladenosine (m6A) modification.

33. The method of any one of claims 1-32, wherein the codon optimization method results in increased protein expression or stability compared to proteins encoded by the corresponding polynucleotide sequences that have not undergone the method.

34. The method of any one of claims 26-33, wherein the corresponding polynucleotide sequence is a wild-type polynucleotide sequence.

35. The method of claim 33 or 34, wherein the protein expression or stability is increased by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 100%, or greater than 100% compared to the corresponding polynucleotide sequence not subjected to the method.

36. The method of any one of claims 33-35, wherein the protein expression or stability is increased by about 5-fold, about 6-fold, about 7-fold, about 8-fold, about 9-fold, about 10-fold, about 15-fold, about 20-fold, about 25-fold, about 30-fold, about 35-fold, about 40-fold, about 45-fold, about 50-fold, or greater than 50-fold compared to the corresponding polynucleotide sequence not subjected to the method.

37. The method of any one of claims 33-36, wherein the increase in protein expression is measured by mass spectrometry, Western blot analysis, enzyme-linked immunosorbent assay (ELISA), immunoprecipitation, flow cytometry, fluorescence assay, colorimetry, spectrophotometry, or using an array of aptamers or antibodies against the protein of interest.

38. A polynucleotide produced by the method of any one of claims 1-37.

39. A method for delivering a polynucleotide sequence encoding a polypeptide to a host cell, the method comprising (i) replacing one or more nucleotides in a DRACH motif within the polynucleotide sequence with an equal amount of a substitute nucleotide that eliminates the DRACH motif, wherein the replacement does not alter the amino acid sequence of the encoded polypeptide, and (ii) providing the resulting polynucleotide sequence to the host cell.

40. A method for expressing an mRNA transcript from a polynucleotide sequence encoding a polypeptide in a host cell, the method comprising (i) replacing one or more nucleotides in a DRACH motif within the polynucleotide sequence with an equal amount of a substitute nucleotide that eliminates the DRACH motif, wherein the substitution does not alter the amino acid sequence of the encoded polypeptide, and (ii) providing the polynucleotide sequence to the host cell.

41. A method for expressing a protein from a polynucleotide sequence encoding a protein in a host cell, the method comprising (i) replacing one or more nucleotides in a DRACH motif within the polynucleotide sequence with an equal amount of a substitute nucleotide that eliminates the DRACH motif, wherein the substitution does not alter the amino acid sequence of the encoded protein, and (ii) providing the polynucleotide sequence to the host cell.

42. A method of delivering a polynucleotide sequence encoding a polypeptide to a subject, the method comprising (i) replacing one or more nucleotides in a DRACH motif within the polynucleotide sequence with an equal amount of a substitute nucleotide that eliminates the DRACH motif, wherein the replacement does not alter the amino acid sequence of the encoded polypeptide, and (ii) providing the subject with the resulting polynucleotide sequence.

43. A method for expressing an mRNA transcript from a polynucleotide sequence encoding a polypeptide in a subject, the method comprising (i) replacing one or more nucleotides in a DRACH motif within the polynucleotide sequence with an equal amount of a substitute nucleotide that eliminates the DRACH motif, wherein the replacement does not alter the amino acid sequence of the encoded polypeptide, and (ii) providing the subject with the polynucleotide sequence.

44. A method for expressing a protein from a polynucleotide sequence encoding a protein in a subject, the method comprising (i) replacing one or more nucleotides in a DRACH motif within the polynucleotide sequence with an equal amount of a substitute nucleotide that eliminates the DRACH motif, wherein the replacement does not alter the amino acid sequence of the encoded protein, and (ii) providing the subject with the polynucleotide sequence.

45. The method of any one of claims 39-44, wherein the substitution is performed in a DRACH motif selected from AGACA, AGACT, GAACC, GAACT, GGACA, GGACT, TGACT, AAACA, AAACC, AAACT, AGACC, GACA, GGACC, TAACA, TAACC, TAACT, TGACA, and TGACC.

46. ​​The method of claim 45, wherein the substitution is performed on a DRACH motif selected from AGACA, AGACT, GAACC, GAACT, GGACA, GGACT, and TGACT.

47. The method of any one of claims 39-46, wherein the substitution of one or more nucleotides in the DRACH motif is performed using one or more codon usage guidelines selected from: (a) The codon GAC is never used to encode aspartic acid when the DRACH motif is eliminated; (b) The codon GAA encoding glutamate is never used when the DRACH motif is eliminated; (c) Glycine is never encoded by the codon GGA when the DRACH motif is eliminated; (d) When eliminating the DRACH motif, the codon AAA encoding lysine is never used; (e) never using the AAC codon to encode asparagine when eliminating the DRACH motif; and / or (f) The codon ACG is always used to encode threonine when eliminating the DRACH motif.

48. The method of any one of claims 39-47, wherein the codon optimization further comprises implementing one or more codon usage guidelines selected from the following throughout the polynucleotide sequence: (a) The codon GAC is never used for aspartic acid throughout the entire polynucleotide sequence; (b) The codon GAA is never used for glutamate throughout the entire polynucleotide sequence; (c) The codon GGA is never used for glycine throughout the entire polynucleotide sequence; (d) The codon AAA is never used for lysine throughout the entire polynucleotide sequence; (e) The codon AAC is never used for asparagine throughout the entire polynucleotide sequence; and / or (f) The codon ACG is always used for threonine throughout the polynucleotide sequence.

49. The method of any one of claims 39-48, wherein prior to replacing the one or more nucleotides in the DRACH motif, the polynucleotide sequence has been codon optimized by replacing one or more nucleotides in the codon with an equal amount of alternative nucleotides, the alternative nucleotides collectively constituting a synonymous codon, the synonymous codon occurring more frequently in the target organism than the unmodified codon occurs in the target organism.

50. The method of any one of claims 39-49, wherein prior to replacing the one or more nucleotides in the DRACH motif, the polynucleotide sequence has been codon-optimized by replacing one or more codons in the polynucleotide sequence with an equal number of synonymous codons, the synonymous codons being more frequently naturally occurring in the target organism than the one or more unmodified codons being more frequently occurring in the target organism.

51. The method of claim 49 or 50, wherein the target organism is a mammal, optionally wherein the mammal is a human.

52. The method of any one of claims 39-51, wherein the polynucleotide sequence has been codon-optimized using a codon optimization network tool, codon optimization software, quantum computing, heuristic scoring method, neural network, or a combination thereof before replacing the one or more nucleotides in the DRACH motif.

53. The method of any one of claims 39-52, wherein the polynucleotide sequence has been codon-optimized by adjusting the polynucleotide GC content, polynucleotide secondary structure, mRNA motif, ribosome binding site, and / or translation rate before replacing the one or more nucleotides in the DRACH motif.

54. The method of claim 53, wherein the polynucleotide GC content is adjusted to between 50% and 80%.

55. The method of claim 54, wherein the polynucleotide GC content is adjusted to between 65% and 75%.

56. The method of any one of claims 39-55, wherein after replacing one or more nucleotides in the DRACH motif, the method further comprises replacing one or more nucleotides in the codon with an equal amount of alternative nucleotides, the alternative nucleotides collectively constituting a synonymous codon, the synonymous codon occurring more frequently in the target organism than the unmodified codon occurs in the target organism.

57. The method of any one of claims 39-56, wherein after replacing the one or more nucleotides in the DRACH motif, the method further comprises replacing one or more codons in the polynucleotide sequence with an equal amount of synonymous codons, the synonymous codons being more frequently naturally occurring in the target organism than the one or more unmodified codons being more frequently occurring in the target organism.

58. The method of claim 56 or 57, wherein the target organism is a mammal, and optionally the mammal is a human.

59. The method of any one of claims 39-58, wherein after replacing the one or more nucleotides in the DRACH motif, the method further comprises codon optimization using a codon optimization network tool, codon optimization software, quantum computing, heuristic scoring methods, neural networks, or a combination thereof.

60. The method of any one of claims 39-59, wherein after replacing one or more nucleotides in the DRACH motif, the codon optimization method further comprises regulating the polynucleotide GC content, polynucleotide secondary structure, mRNA motif, ribosome binding site, and / or translation rate.

61. The method of claim 60, wherein the polynucleotide GC content is adjusted to between 50% and 80%.

62. The method of claim 61, wherein the polynucleotide GC content is adjusted to between 65% and 75%.

63. The method of any one of claims 39-62, wherein the amino acid sequence of the protein or polypeptide, after codon optimization, has at least 85% sequence identity with the wild-type amino acid sequence of the protein or polypeptide.

64. The method of any one of claims 39-63, wherein the amino acid sequence of the protein or polypeptide, after codon optimization, has 100% sequence identity with the wild-type amino acid sequence of the protein or polypeptide.

65. The method of any one of claims 39-64, wherein the number of DRACH motifs in the polynucleotide sequence is reduced by at least 90%, at least 80%, at least 70%, at least 60%, at least 50%, at least 40%, at least 30%, at least 20%, or at least 10% compared to the corresponding polynucleotide sequence not subjected to the method.

66. The method of claim 65, wherein the number of DRACH motifs in the polynucleotide sequence is reduced by 100% compared to the corresponding polynucleotide sequence not subjected to the method.

67. The method of any one of claims 39-66, wherein the method results in an increase in mRNA transcript stability or half-life.

68. The method of claim 67, wherein the increase in mRNA transcript stability or half-life is assessed by an increase in concentration or relative abundance compared to the corresponding polynucleotide sequence not subjected to the method.

69. The method of claim 68, wherein the increase in mRNA transcript concentration or relative abundance compared to mRNA transcripts of natural polynucleotide sequences is measured by RT-PCR, fluorescence assay, colorimetric assay, spectrophotometric analysis, flow cytometry, in situ hybridization, RNA blot analysis, or using an array of one or more hybrid oligonucleotides or antibodies targeting the mRNA transcript of interest.

70. The method of claim 67, wherein the increase in mRNA transcript stability or half-life is assessed by a reduced decay rate, the decay rate being detected by one or more pulse tracking methods.

71. The method of any one of claims 39-70, wherein reducing the number of DRACH motifs in the polynucleotide sequence compared to the corresponding polynucleotide sequence not subjected to the method reduces the amount of DRACH motifs in the mRNA transcript. N The amount of (6)-methyladenosine (m6A) modification.

72. The method of any one of claims 39-71, wherein the method results in increased protein expression or stability compared to proteins encoded by the corresponding polynucleotide sequences that have not undergone the method.

73. The method of any one of claims 65-72, wherein the corresponding polynucleotide sequence is a wild-type polynucleotide sequence.

74. The method of claim 72 or 73, wherein the protein expression or stability is increased by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 100%, or greater than 100% compared to the corresponding polynucleotide sequence not subjected to the method.

75. The method of any one of claims 72-74, wherein the protein expression or stability is increased by about 5-fold, about 6-fold, about 7-fold, about 8-fold, about 9-fold, about 10-fold, about 15-fold, about 20-fold, about 25-fold, about 30-fold, about 35-fold, about 40-fold, about 45-fold, about 50-fold, or greater than 50-fold compared to the corresponding polynucleotide sequence not subjected to the method.

76. The method of any one of claims 72-75, wherein the increase in protein expression is measured by mass spectrometry, Western blot analysis, enzyme-linked immunosorbent assay (ELISA), immunoprecipitation, flow cytometry, fluorescence assay, colorimetry, spectrophotometry, or using an array of aptamers or antibodies against the protein of interest.

77. The method of any one of claims 39-41 and 45-76, wherein the polynucleotide is delivered to the host cell by contacting the host cell with a medium containing the polynucleotide.

78. The method of any one of claims 42-76, wherein the polynucleotide is delivered to the subject by administering a medium containing the polynucleotide to the subject.

79. The method of claim 77 or 78, wherein the medium is selected from lipid nanoparticles, liposomes, viral genomes, and viral vectors.

80. The method of claim 79, wherein the viral vector is adeno-associated virus (AAV), adenovirus, retrovirus, or lentivirus.

81. The method of any one of claims 77-80, wherein the viral vector is AAV.

82. The method of claim 81, wherein the AAV is pseudomorphic.

83. The method of claim 81 or 82, wherein the AAV comprises an inverted terminal repeat (ITR) sequence and a capsid protein derived from different serotypes.

84. The method of any one of claims 39-41 and 45-83, wherein delivery to the host cells occurs in vivo, in vitro, or ex vivo.

85. The method of any one of claims 42-83, wherein delivery to the subject is performed by: (i) administering the polynucleotide in vivo to the subject, or (ii) expressing the polynucleotide in vitro in the host cells and then administering the host cells to the subject.

86. The method of any one of claims 1-85, wherein the method is used to treat a subject suffering from a disease characterized by low expression or activity of a protein or at risk of suffering from said disease.

87. A method of treating a subject who has a disease or is at risk of developing a disease, the method comprising (i) replacing one or more nucleotides in a DRACH motif of a polynucleotide sequence encoding a polypeptide associated with the disease with an equal amount of an alternative nucleotide that eliminates the DRACH motif, wherein the replacement does not alter the amino acid sequence of the encoded polypeptide, and (ii) administering the polynucleotide sequence to the subject.

88. A method of treating a subject who has a disease or is at risk of developing a disease, the method comprising administering to the subject a polynucleotide sequence encoding a polypeptide associated with the disease, wherein prior to administration, one or more nucleotides in a DRACH motif within the polynucleotide sequence have been replaced by an equal amount of alternative nucleotides that eliminate the DRACH motif, wherein the replacement does not alter the amino acid sequence of the encoded polypeptide.

89. The method of claim 87 or 88, wherein the substitution is performed in a DRACH motif selected from AGACA, AGACT, GAACC, GAACT, GGACA, GGACT, TGACT, AAACA, AAACC, AAACT, AGACC, GACA, GGACC, TAACA, TAACC, TAACT, TGACA, and TGACC.

90. The method of claim 89, wherein the substitution is performed on a DRACH motif selected from AGACA, AGACT, GAACC, GAACT, GGACA, GGACT, and TGACT.

91. The method of any one of claims 87-90, wherein the substitution of one or more nucleotides in the DRACH motif is performed using one or more codon usage guidelines selected from: (a) The codon GAC is never used to encode aspartic acid when the DRACH motif is eliminated; (b) The codon GAA encoding glutamate is never used when the DRACH motif is eliminated; (c) Glycine is never encoded by the codon GGA when the DRACH motif is eliminated; (d) When eliminating the DRACH motif, the codon AAA encoding lysine is never used; (e) never using the AAC codon to encode asparagine when eliminating the DRACH motif; and / or (f) The codon ACG is always used to encode threonine when eliminating the DRACH motif.

92. The method of any one of claims 87-91, wherein prior to application, the polynucleotide sequence has been codon-optimized by a method comprising implementing one or more codon usage guidelines selected from the following across the entire polynucleotide sequence: (a) The codon GAC is never used to encode aspartic acid throughout the entire polynucleotide sequence; (b) The codon GAA is never used to encode glutamic acid throughout the entire polynucleotide sequence; (c) The codon GGA is never used to encode glycine throughout the entire polynucleotide sequence; (d) The codon AAA is never used to encode lysine throughout the entire polynucleotide sequence; (e) The codon AAC is never used to encode asparagine throughout the entire polynucleotide sequence; and / or (f) Threonine is always encoded using the codon ACG throughout the entire polynucleotide sequence.

93. The method of any one of claims 87-92, wherein prior to replacing the one or more nucleotides in the DRACH motif, the polynucleotide sequence has been codon optimized by replacing one or more nucleotides in the codon with an equal amount of alternative nucleotides, the alternative nucleotides collectively constituting a synonymous codon, the synonymous codon occurring more frequently in the target organism than the unmodified codon occurs in the target organism.

94. The method of any one of claims 87-93, wherein prior to replacing the one or more nucleotides in the DRACH motif, the polynucleotide sequence has been codon-optimized by replacing one or more codons in the polynucleotide sequence with an equal number of synonymous codons, the synonymous codons being more frequently naturally occurring in the target organism than the one or more unmodified codons being more frequently occurring in the target organism.

95. The method of claim 93 or 94, wherein the target organism is a mammal, optionally wherein the mammal is a human.

96. The method of any one of claims 87-95, wherein the polynucleotide sequence has been codon-optimized using codon optimization network tools, codon optimization software, quantum computing, heuristic scoring methods, neural networks, or combinations thereof before replacing the one or more nucleotides in the DRACH motif.

97. The method of any one of claims 87-98, wherein the polynucleotide sequence has been codon-optimized by adjusting the polynucleotide guanine-cytosine (GC) content, polynucleotide secondary structure, mRNA motif, ribosome binding site, and / or translation rate before replacing the one or more nucleotides in the DRACH motif.

98. The method of claim 97, wherein the polynucleotide GC content is adjusted to between 50% and 80%.

99. The method of claim 98, wherein the polynucleotide GC content is adjusted to between 65% and 75%.

100. The method of any one of claims 87-99, wherein after replacing the one or more nucleotides in the DRACH motif, the method further comprises replacing the one or more nucleotides in the codon with an equal amount of alternative nucleotides, the alternative nucleotides collectively constituting a synonymous codon, the synonymous codon occurring more frequently in the target organism than the unmodified codon occurs in the target organism.

101. The method of any one of claims 87-100, wherein after replacing the one or more nucleotides in the DRACH motif, the method further comprises replacing one or more codons in the polynucleotide sequence with an equal amount of synonymous codons, the synonymous codons being more frequently occurring naturally in the target organism than the one or more unmodified codons being more frequently occurring in the target organism.

102. The method of claim 100 or 101, wherein the target organism is a mammal, and optionally wherein the mammal is a human.

103. The method of any one of claims 87-102, wherein after replacing the one or more nucleotides in the DRACH motif, the method further comprises codon optimization using a codon optimization network tool, codon optimization software, quantum computing, heuristic scoring methods, neural networks, or a combination thereof.

104. The method of any one of claims 87-103, wherein after replacing one or more nucleotides in the DRACH motif, the method further comprises regulating the polynucleotide GC content, polynucleotide secondary structure, mRNA motif, ribosome binding site, and / or translation rate.

105. The method of claim 104, wherein the polynucleotide GC content is adjusted to between 50% and 80%.

106. The method of claim 105, wherein the polynucleotide GC content is adjusted to between 65% and 75%.

107. The method of any one of claims 87-106, wherein the amino acid sequence of the protein or polypeptide, after codon optimization, has at least 85% sequence identity with the wild-type amino acid sequence of the protein or polypeptide.

108. The method of any one of claims 87-107, wherein the amino acid sequence of the protein or polypeptide, after codon optimization, has 100% sequence identity with the wild-type amino acid sequence of the protein or polypeptide.

109. The method of any one of claims 87-108, wherein the number of DRACH motifs in the polynucleotide sequence is reduced by at least 90%, at least 80%, at least 70%, at least 60%, at least 50%, at least 40%, at least 30%, at least 20%, or at least 10% compared to the corresponding polynucleotide sequence not subjected to the method.

110. The method of claim 109, wherein the number of DRACH motifs in the polynucleotide sequence is reduced by 100% compared to the corresponding polynucleotide sequence not subjected to the method.

111. The method of any one of claims 87-110, wherein the method results in an increase in mRNA transcript stability or half-life.

112. The method of claim 111, wherein the increase in mRNA transcript stability or half-life is assessed by an increase in concentration or relative abundance compared to a reference.

113. The method of claim 112, wherein the increase in mRNA transcript concentration or relative abundance compared to the mRNA transcript of the natural polynucleotide sequence is measured by RT-PCR, fluorescence assay, colorimetric assay, spectrophotometric analysis, flow cytometry, in situ hybridization, RNA blot analysis, or using an array of one or more hybrid oligonucleotides or antibodies targeting the mRNA transcript of interest.

114. The method of claims 87-113, wherein reducing the number of DRACH motifs in the polynucleotide sequence compared to the corresponding polynucleotide sequence not subjected to said method reduces the amount of DRACH motifs in the mRNA transcript. N The amount of (6)-methyladenosine (m6A) modification.

115. The method of any one of claims 87-114, wherein the method results in increased protein expression or stability compared to a reference.

116. The method of any one of claims 109-115, wherein the corresponding polynucleotide sequence is a wild-type polynucleotide sequence.

117. The method of any one of claims 112-116, wherein the reference is a sample obtained from a subject who has never received treatment or a sample obtained from a subject prior to treatment.

118. The method of any one of claims 115-117, wherein the protein expression or stability is increased by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 100%, or greater than 100% compared to a reference.

119. The method of any one of claims 115-118, wherein the protein expression or stability is increased by about 5-fold, about 6-fold, about 7-fold, about 8-fold, about 9-fold, about 10-fold, about 15-fold, about 20-fold, about 25-fold, about 30-fold, about 35-fold, about 40-fold, about 45-fold, about 50-fold, or greater than 50-fold compared to the reference.

120. The method of any one of claims 115-119, wherein the increase in protein expression is measured by mass spectrometry, Western blot analysis, enzyme-linked immunosorbent assay (ELISA), immunoprecipitation, flow cytometry, fluorescence assay, colorimetry, spectrophotometry, or using an array of aptamers or antibodies against the protein of interest.

121. The method of any one of claims 87-120, wherein the polynucleotide is administered to the subject by contacting the subject with a medium containing the polynucleotide.

122. The method of claim 121, wherein the medium is selected from lipid nanoparticles, liposomes, viral genomes, and viral vectors.

123. The method of claim 122, wherein the viral vector is adeno-associated virus (AAV), adenovirus, retrovirus, lentivirus, or double-stranded DNA virus.

124. The method of claim 122 or 123, wherein the viral vector is AAV.

125. The method of claim 124, wherein the AAV is pseudomorphic.

126. The method of claim 124 or 125, wherein the AAV comprises an inverted terminal repeat (ITR) sequence and a capsid protein derived from a different serotype.

127. The method of any one of claims 87-126, wherein the administration is performed by: providing the polynucleotide directly to the subject in vivo, or by expressing the polynucleotide in host cells in vitro, followed by administration of the host cells to the subject.

128. The method of any one of claims 87-127, wherein the delivery is performed via intramuscular, subcutaneous, intradermal, intravenous, intraperitoneal, intraarterial, intraventricular, intranasal, intraorbital, intracranial, or intraosseous administration.

129. The method of any one of claims 87-128, wherein the treatment is a single therapy.

130. The method of any one of claims 87-128, wherein the method is combined with the administration of one or more other therapeutic agents.

131. A kit comprising a packaging insert instructing a user to perform a codon optimization method, the method comprising eliminating the one or more DRACH motifs by modifying a polynucleotide sequence encoding a polypeptide by replacing one or more nucleotides in a DRACH motif in a polynucleotide sequence without altering the amino acid sequence of the encoded polypeptide.

132. A kit comprising a packaging insert instructing a user to perform the method of any one of claims 1-37 and 39-130.

133. The kit of claim 131 or 132, wherein the kit comprises means for administering the polynucleotide sequence to a subject.

134. The kit according to any one of claims 131-133, wherein the kit comprises one or more binding molecules to detect the expression of an mRNA transcript encoding the polypeptide or the expression or activity of the polypeptide.

Images