Method for reducing listeria monocytogenes infection by interfering with host MIC19 gene expression
By transfecting HeLa cells with siRNA-MIC19 to inhibit the expression of Mic19 protein, the infection and proliferation capacity of Listeria monocytogenes was reduced, which solved the problem of unclear interaction between Mic19 and PlcB in Listeria monocytogenes infection and provided a new method for treatment and in vitro reduction of infection.
Patent Information
- Application Number
- CN202511366080.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-09-23
- Publication Date
- 2026-01-16
AI Technical Summary
In the prior art, Listeria monocytogenes enhances its adhesion, invasion and spread capabilities by regulating the structure and function of host cell mitochondria, and the interaction between Mic19 and phospholipase PlcB is unclear, and the role of Mic19 in Listeria monocytogenes infection has not been confirmed.
By transfecting siRNA-MIC19, the expression level of Mic19 protein in HeLa cells was reduced, and the gene expression of MIC19 was inhibited by siRNA targeting MIC19, thus interfering with the expression of Mic19 protein in host cells.
This study reduced the infectivity and intracellular proliferation of Listeria monocytogenes, providing new therapeutic strategies for combating Listeria monocytogenes infection and methods for reducing infection in vitro. An anti-infection cell model was also constructed.
Smart Images

Figure CN121337833A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biotechnology, and more specifically to a method for reducing Listeria monocytogenes infection by interfering with the expression of the host MIC19 gene. Background Technology
[0002] Listeria monocytogenes (L.) is a zoonotic intracellular parasite that can invade macrophages and proliferate intracellularly. When a host ingests contaminated food, L. monocytogenes can cross the intestinal epithelial barrier into the lamina propria, subsequently spreading via the lymphatic and hematogenous systems to the liver and spleen, where it multiplies. L. monocytogenes infection can induce meningoencephalitis and invade the placenta, leading to fetal infection, stillbirth, miscarriage, and neonatal infection. In humans, pregnant women, newborns, the elderly, and immunocompromised individuals are particularly vulnerable to severe infection.
[0003] Listeria monocytogenes phospholipase PlcB is a 289-amino acid protease that is activated by the metalloproteinase Mpl in an acidic environment. When Listeria monocytogenes infects host cells, PlcB is the first to act, reducing changes in calcium flux, reactive oxygen species (ROS), and membrane potential induced by hemolysin O (LLO) secreted by Listeria monocytogenes, thereby alleviating mitochondrial damage in the infected host cells. The expression level of PlcB is also directly related to bacterial virulence; strains unable to synthesize the PlcB precursor peptide show significantly reduced colonization ability in cells, indicating a close relationship between PlcB and Listeria monocytogenes infection.
[0004] MICOS is a multi-subunit protein complex and one of the major structural elements of eukaryotic mitochondria, promoting the formation, maintenance, and stability of mitochondrial cristae. Mic19, a peripheral protein of the mitochondrial inner membrane and a component of the MICOS complex, consists of 227 amino acids. It has five cysteine residues, four of which are arranged in a double Cys-X9-Cys motif within the typical coiled-coil CHCH domain of MIA substrates. Previous studies have reported that the oxidative state of Mic19 is essential for MICOS assembly and maintaining inner membrane morphology, and its CHCH domain is crucial for the cellular delivery of Mic19 to mitochondria.
[0005] Listeria monocytogenes is known to possess a unique infection strategy that allows it to evade immune clearance and survive within the host. Similar to many pathogens, it enhances its adhesion, invasion, and spread by modulating the structure and function of host cell mitochondria, thereby altering the intracellular microenvironment. Furthermore, phospholipase PlcB is indispensable for Listeria monocytogenes, and Mic19 is crucial for maintaining the dynamic homeostasis of the host cell mitochondrial network. However, the interaction between Mic19 and phospholipase PlcB remains unclear, and the role of Mic19 in Listeria monocytogenes infection is yet to be confirmed. Summary of the Invention
[0006] This invention is the first to discover the interaction between the Listeria monocytogenes virulence factor PlcB and the mitochondrial inner membrane protein Mic19; further, it was found that during Listeria monocytogenes infection, PlcB leads to a significant increase in the expression level of endogenous Mic19 protein in host cells, and the imbalance of Mic19 protein expression level in host cells is not conducive to the intracellular proliferation of Listeria monocytogenes.
[0007] Specifically, this invention successfully reduced the expression level of Mic19 protein in HeLa cells by transfecting siRNA-MIC19. Then, HeLa cells with knocked-down MIC19 were infected with the wild-type Listeria monocytogenes strain EGD-e, and intracellular bacterial dilution plate counts were collected to analyze bacterial intracellular proliferation. The results show that reducing intracellular MIC19 expression leads to a decrease in the infectivity and intracellular proliferation capacity of Listeria monocytogenes. This indicates that reduced endogenous MIC19 expression in host cells decreases Listeria monocytogenes infection and proliferation. The findings of this invention provide a new direction for the interaction between Listeria monocytogenes and the host, and offer a valuable paradigm for the complexity and co-evolution of host-pathogen interactions.
[0008] In this regard, the present invention includes, but is not limited to, the following technical solutions:
[0009] In one aspect, the present invention provides the use of MIC19 gene expression inhibitors in the preparation of medicaments that reduce Listeria monocytogenes infection.
[0010] In one aspect, the MIC19 gene expression inhibitor of the present invention is a siRNA targeting the MIC19 gene.
[0011] In another aspect, the present invention provides a method for reducing cell infection with Listeria monocytogenes in vitro by inactivating or reducing MIC19 gene expression.
[0012] In one aspect, the inactivation or reduction of MIC19 gene expression according to the present invention includes the following steps: introducing siRNA targeting the MIC19 gene into the cells.
[0013] In one aspect, the cells described in this invention are human cells, preferably human mononuclear cells or human cervical cancer cells, more preferably human mononuclear cells.
[0014] In one aspect, the siRNA of the present invention comprises a sense strand and an antisense strand forming a double-stranded region, the sequence of the sense strand being shown in SEQ ID NO:3 (5'-AAUUCUUCAUCAGAAACUGAG-3'), and the sequence of the antisense strand being shown in SEQ ID NO:4 (3'-CAGUUUCUGAUGAAGAAUUGA-5').
[0015] In one aspect, the amino acid sequence encoded by the MIC19 gene of the present invention is SEQ ID NO:1.
[0016] SEQ ID NO:1 (NCBI Registry Number: XP_047276505.1)
[0017] MIMNVQCRTFILPSSLTLMLSDEELKRRVAEELALEQAKKESEDQKRLKQAKELDRERAAANEQLTRAILRERICSEEERAKAKHLDIEDKARQLEEKDRVLKKQDAFYKEQLARLEERSSEFYRVTTEQYQKAAEEVEAKFKRYESHPVCADLQAKILQCYRENTHQTLKCSALATQYMHCVNHAKQSMLEKGG
[0018] In one aspect, the nucleotide sequence of the MIC19 gene described in this invention is SEQ ID NO:2.
[0019] SEQ ID NO:2 (NCBI Registry Number: XM_047420549.1)
[0020]
[0021] In another aspect, the present invention also provides a cell obtained by the method of the present invention.
[0022] The beneficial technical effects of the present invention include at least the following:
[0023] This invention is the first to discover that reducing intracellular MIC19 gene expression leads to a decrease in both the infectivity and intracellular proliferation of Listeria monocytogenes, thus providing a new therapeutic approach for treating Listeria monocytogenes infection, such as using drugs that inhibit MIC19 gene expression. Furthermore, this invention provides a method for reducing Listeria monocytogenes infection in vitro and cells constructed using this method. These cells can be used in the development of drugs against Listeria monocytogenes infection, for example, as a negative control group for Listeria monocytogenes infection. Attached Figure Description
[0024] Figure 1 The map of the ΔplcB recombinant plasmid (A) and the construction of the ΔplcB deletion strain (BD) are shown.
[0025] Figure 2 This shows the transcriptional level of the MIC19 gene in HeLa cells before and after Listeria monocytogenes infection, as detected by qRT-PCR.
[0026] Figure 3 The changes in Mic19 protein expression levels in HeLa cells after bacterial infection are shown in (A) and their grayscale analysis (B). The t-test was used to analyze the differences between the infection group and the Mock group; ** indicates p < 0.01, and ns indicates no significant difference.
[0027] Figure 4 The changes in the expression level of Mic19 protein in mitochondria before and after HeLa cell infection are shown in (A) and their grayscale analysis (B). The t-test was used to analyze the difference between the infection group and the Mock group; ** indicates p < 0.01, and ns indicates no significant difference.
[0028] Figure 5 The effect of PlcB eukaryotic plasmid transfection on Mic19 expression in HeLa cells is shown in Figure A (and its grayscale analysis is shown in Figure B). The difference between the infection group and the Mock group was analyzed using a t-test; *** indicates p < 0.001.
[0029] Figure 6 The effect of the proteasome inhibitor MG132 on the expression level of Mic19 protein in HeLa cells transfected with PlcB, as detected by Western blotting (A), is shown in the image (B). A t-test was used to analyze the difference between the infection group and the Mock group; ns indicates no significant difference.
[0030] Figure 7The expression level of Mic19 in HeLa cells transfected with siRNA-MIC19 is shown in (A) and its grayscale analysis is shown in (B). The difference between the infection group and the Mock group was analyzed by t-test, with *** indicating p<0.001.
[0031] Figure 8 The proliferation of EGD-e in MIC19-knockdown HeLa cells was shown. The difference between the infection group and the mock group was analyzed using a t-test; *** indicates p < 0.001. Detailed Implementation Plan
[0032] The present invention will be further described below with reference to specific embodiments, and the advantages and features of the present invention will become clearer with the description. However, unless otherwise specified, the specific experimental methods involved in the following embodiments are conventional methods or implemented according to the conditions recommended in the manufacturer's instructions.
[0033] Unless otherwise specified, the technical means used in the embodiments are conventional means well known to those skilled in the art. Unless otherwise specified, the experimental methods in the following embodiments are all conventional methods. Unless otherwise specified, the reagents and materials used can be purchased commercially.
[0034] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as are familiar to those skilled in the art. Furthermore, any methods and materials similar to or equivalent to those described herein may be used in this invention. The preferred embodiments and materials described herein are for illustrative purposes only.
[0035] Example 1: Effect of Listeria monocytogenes phospholipase PlcB on the expression level of host mitochondrial protein Mic19.
[0036] Previous experiments using yeast two-hybrid assays verified the interaction between Listeria monocytogenes phospholipase PlcB and the host mitochondrial protein Mic19. This example further investigates whether Listeria monocytogenes infection affects the protein expression level of the host mitochondrial protein Mic19.
[0037] 1.1 Construction of the mutant strain EGD-eΔplcB
[0038] 1.1.1 Preparation of Listeria monocytogenes competent cells
[0039] (1) Taking EGD-e as an example, the EGD-e strain was revived, streaked in three zones on BHI antibiotic-free solid medium, and then incubated at 37°C overnight.
[0040] (2) Pick a single colony and inoculate it into 5 mL of BHI liquid medium. Incubate at 37°C and 200 rpm for 12 h.
[0041] (3) Transfer the overnight culture solution at a ratio of 1:100 to 100 mL of culture medium (containing 50 mL of 2×BHI medium plus 50 mL of 1M filtered sterile sucrose solution), and incubate at 37°C with shaking at 200 rpm for 3 to 5 hours until the logarithmic growth phase (OD200). 600nm =0.18-0.25).
[0042] (4) Add penicillin G to the bacterial culture to a final concentration of 20 μg / mL, and culture at 37℃ and 200 rpm for 2 h.
[0043] (5) Place the bacterial culture into a benchtop high-speed refrigerated centrifuge that has been pre-cooled to 4°C, centrifuge at 4000 rpm for 10 min, and discard the supernatant in a clean bench after centrifugation.
[0044] (6) Add 15 mL of pre-cooled washing buffer containing 1 mM HEPES and 0.5 M sucrose, gently resuspend the bacterial cells, combine them into one tube and centrifuge at 4000 rpm for 8 min. After centrifugation, discard the supernatant in a clean bench.
[0045] (7) Repeat step (6) three times.
[0046] (8) Finally, add 1 mL of washing buffer, dispense 150 μL into each sterile centrifuge tube, and store at -80°C for later use.
[0047] 1.1.2 Construction of Listeria monocytogenes deletion strains
[0048] The principle of Listeria deletion strain construction: A single-gene Listeria deletion strain was constructed using the operable principle of homologous recombination. In this experiment, the exogenous recombinant homologous DNA fragment was introduced into bacteria using the pKSV7 temperature-sensitive shuttle plasmid. During bacterial replication, the fragment was integrated into the bacteria. This vector could complete the homologous recombination process through single and double crossovers under chloramphenicol-resistant conditions at 42℃. Finally, the gene knockout was completed by transferring the plasmid into bacteria in vitro at 30℃ without antibiotic resistance.
[0049] (1) Taking the construction of the plcB deletion plasmid as an example, the gene and its upstream and downstream gene sequences were first downloaded from the NCBI database (https: / / www.ncbi.nlm.nih.gov).
[0050] (2) To investigate whether plcB affects the transcription of its upstream and downstream genes, the BioCyc metabolic pathway database (www.biocyc.org) was used to predict whether the plcB gene exists alone in a transcript. The prediction results showed that plcB and its upstream genes actA and mpl belong to the same operon region.
[0051] (3) Primers were designed at approximately 500 bp upstream and downstream of the gene using Snapgene software to amplify the homologous arm sequences (primers are: pSL1838-a-KpnI:CGGGGTACCACTACAACGAAAACAGTGACTAAAAAACCAAC; pSL1838-b:TAAATATTGTTATTCATTTGTTTTTTTCACCTTTTTGAATTTCATATCATTCACC TCACT; pSL1838-c:GTGAATGATATGAAATTCAAAAAGGTGAAAAAAACAAATGAATAACAATATT TAGGAATACATTCTTATCCACT; pSL1838-d-PstI:AAACTGCAGAACCGCACTATTGCAATAGATATTTTTGTGAAC).
[0052] (4) The upstream and downstream homologous arms were amplified and ligated using overlapping PCR to obtain the recombinant fragment for homologous recombination. The fragment was cloned into the pKSV7 vector to obtain the recombinant plasmid pSL2501. After confirming that the sequence was correct, the plasmid was transformed into DH5α. (Construction of recombinant plasmid for deletion strain)
[0053] (5) Remove the EGD-e competent cells from -80℃ and thaw them in ice for 5 minutes.
[0054] (6) Add 1 μg of recombinant plasmid to competent cells, gently blow it a few times, and then add the mixture vertically to the 2 mm electrode cup.
[0055] (7) After wiping the electrode plates at both ends, place them in the electroconversion instrument and perform electrode conversion according to the conditions of voltage 2500V, resistance 200-400Ω and capacitance 25μF. The appearance of a curve indicates that the electroconversion is successful.
[0056] (8) Immediately add 1 mL of 2×BHI liquid culture medium containing 0.5 M sucrose preheated at 37°C to the electrode cup, aspirate it into a centrifuge tube, and incubate at 30°C for 3 h.
[0057] (9) Centrifuge the mixture at 6000 rpm for 3 min. After centrifugation, discard 900 μL of supernatant and gently resuspend the bacterial cells.
[0058] (10) The bacterial solution was evenly spread on BHI solid plate medium with Cm10 (chloramphenicol concentration 10 μg / mL) resistance using a sterile spreading stick and incubated at 30°C for 2 days.
[0059] (11) Select a single colony for colony PCR verification (“M13 primers” are: pKSV7-M13F:GCGATTAAGTTGGGTAACGCC; pKSV7-M13R:GCGGATAACAATTTCACACAGGA). After verifying that it is a positive clone, it can be stored for a short period of time.
[0060] (Electroconversion steps)
[0061] (12) Add the bacterial culture to BHI liquid medium with Cm10 resistance, culture at 42°C with shaking, and perform continuous subculturing. Every 5 generations, streak the bacteria and select a single colony for PCR verification ("deletion strain detection primers" are: pSL1838-a-front:CCGGTTCCTTCGTTAAGTCCAAAGGTATCG; pSL1838-d-PstI:AAACTGCAGAACCGCACTATTGCAATAGATATTTTGTGAAC) until a positive strain with the target gene missing in its genome is obtained, and preserve the bacterial culture.
[0062] The bacterial culture was added to antibiotic-free BHI liquid medium and cultured with shaking at 30°C. Streaking was performed every 5 generations, and single colonies were selected for MixPCR verification on antibiotic-free BHI solid medium. Single colonies were first selected on Cm10 resistant plates and then spotted onto antibiotic-free BHI solid plates. Single colonies that did not grow on Cm10 resistant plates but grew on antibiotic-free plates were subjected to PCR verification. If the "deletion detection primers" and "M13 primers" failed to amplify bands, and sequencing confirmed the deletion of this gene in the genome, then the deletion strain could be preliminarily confirmed.
[0063] PCR validation was performed during plasmid electroporation into EGD-e, single / double exchange, and plasmid loss. Finally, ΔplcB was obtained through genome sequencing. The ΔplcB recombinant plasmid was constructed using the homologous recombination method. Figure 1 A), the upstream and downstream homologous arm bands of ΔplcB are 536bp ( Figure 1 B). Overlap PCR yielded a 1018bp target fragment ( Figure 1 B). Using primers (pSL1838-a / pSL1838-d), pSL1838 colonies electroporated into EGD-e competent cells were amplified to obtain a 1018 bp positive clone. Figure 1 C). After homologous recombination at 42℃, the colonies were amplified using primers (pSL1838-a-front / pSL1838-d) to obtain a 1128bp positive clone. Figure 1 D). After passage at 30℃ and loss of pKSV7 plasmid, the absence of a band in the colonies was verified using primers (pKSV7-M13-Fwd / pKSV7-M13-Rev). Figure 1D) indicates that the plasmid has been lost. After sequencing verification that the gene sequence matches the expected design, the ΔplcB deletion strain was obtained.
[0064] 1.2 Effects of Listeria monocytogenes infection on the expression level of Mic19 protein in host cells
[0065] 1.2.1 Preparation of Listeria monocytogenes bacterial suspension
[0066] (1) Take out the wild strain EGD-e and mutant strain EGD-eΔplcB that are frozen in the -80℃ freezer in advance. In order to avoid repeated freeze-thaw cycles affecting bacterial activity, when unscrewing the cryovial, quickly dip the pipette tip into a small amount of bacterial solution and streak it in four zones onto BHI solid medium. Let it stand at 37℃ overnight. After the bacteria grow and single colonies fall, wrap the plate with sealing film and invert it in the 4℃ freezer for later use. (2) Select single colonies with normal color and morphology from the streak plate and inoculate them into 5 mL of BHI liquid medium. Shake and culture overnight at 37℃ and 200 rpm.
[0067] 1.2.2 Listeria monocytogenes infection of HeLa cells
[0068] (1) Digest and centrifuge HeLa cells, then resuspend them in cell culture medium at a concentration of 1.5 × 10⁻⁶. 5 The solution is evenly spread in the 24-well plate at a density of / mL, with 200μL per well;
[0069] (2) Prepare Listeria monocytogenes bacterial suspension one night in advance, and centrifuge the prepared bacterial suspension at 3000 rpm for 5 min.
[0070] (3) Resuspend the centrifuged bacteria in sterile 10mM PBS and centrifuge at 3000rpm for 5min;
[0071] (4) The bacterial cells were resuspended in sterile 10mM PBS, and the OD600 nm value was measured by an enzyme-linked immunosorbent assay (ELISA) reader. The value was then adjusted to 0.6 with PBS.
[0072] (5) Discard the culture medium in the 24-well plate and gently rinse the cells three times with PBS preheated to 37°C.
[0073] (6) Dilute the bacterial culture with an OD600 nm of 0.6 with FBS-free DMEM cell culture medium (purchased from Gibco) and add it to a 24-well plate at an MOI ratio of 100:1;
[0074] (7) Place the 24-well plate in a cell culture incubator at 37°C and 5% CO2 and let it stand for 1 hour;
[0075] (8) Remove the 24-well plate, discard the culture medium, and gently rinse the cells three times with preheated sterile 10mM PBS;
[0076] (9) Dilute 50 μg / μL of gentamicin with DMEM cell culture medium, add it to a 24-well plate, and incubate it in a cell culture incubator at 37°C and 5% CO2 for 1 h.
[0077] (10) Discard the culture medium containing antibiotics and add DMEM cell culture medium to continue culturing for later use.
[0078] 1.2.3 qRT-PCR assay to detect MIC19 transcription levels in HeLa cells
[0079] (1) Primers for MIC19 qRT-PCR were designed using Primer Premier 5 software (MIC19-RT-F: ggcggacgagaatgagaac; MIC19-RT-R: ggcaccataagcaccagaa), and were synthesized by Zhejiang Youkang Biotechnology Co., Ltd. The Homo-Tubulin gene was used as the internal control.
[0080] (2) Reverse transcribe RNA from HeLa cells into cDNA;
[0081] (3) Prepare the reaction system in 200 μL EP tubes, and set up three parallel reactions for each group;
[0082] (4) Place the 200 μL EP tube into the machine and start the reaction program;
[0083] (5) Use the Livak method to process the experimental results and use Graphpad 9 to analyze the data.
[0084] qRT-PCR reaction system:
[0085]
[0086] qRT-PCR reaction procedure:
[0087]
[0088] 1.2.4 Western blot analysis to detect endogenous Mic19 protein expression levels
[0089] Infected HeLa cells were lysed using WB IP lysis buffer (purchased from Beyotime Biotechnology Co., Ltd.), cellular proteins were collected and samples were prepared, and changes in the expression level of endogenous Mic19 protein in the cells were detected by Western blotting.
[0090] The results showed that, compared with the Mock group (uninfected cells), there was no significant change in the transcription level of the MIC19 gene in HeLa cells infected with EGD-e and ΔplcB. Figure 2 Proteins were extracted from infected cells, and the expression level of Mic19 protein in the cells was detected by Western blotting. Figure 3 A) Gray-scale analysis of the exposed bands was performed, and the differences were compared using a t-test. The results showed that the intracellular Mic19 protein expression level was significantly increased in EGD-e-infected HeLa cells compared with uninfected cells (p < 0.01). Figure 3 B). This indicates that after Listeria monocytogenes infection of HeLa cells, the transcriptional level of the endogenous MIC19 gene did not change significantly, but the protein expression level increased significantly.
[0091] 1.3 Effect of Listeria monocytogenes infection on the expression level of Mic19 protein in mitochondria
[0092] 1.3.1 Collection of mitochondria from HeLa cells infected with Listeria monocytogenes
[0093] (1) According to the instructions, at least 2×10 7 Mitochondria can only be prepared once per cell, so three flasks of T75 HeLa cells need to be cultured in advance, digested with trypsin, and collected by centrifugation.
[0094] (2) Resuspend the digested cells in 10mM PBS pre-cooled in an ice bath, centrifuge at 600g and 4℃ for 5min to precipitate the cells, and discard the supernatant;
[0095] (3) Gently resuspend the cells in mitochondrial separation reagent pre-added with protease inhibitor (PMSF, purchased from Beyotime Biotechnology Co., Ltd.). 1 mL of reagent is needed for every 20 million cells. Incubate on ice for 15 min.
[0096] (4) Transfer the cell suspension to a glass homogenizer and homogenize 10 times;
[0097] (5) Centrifuge 600g of cell homogenate at 4℃ for 10min;
[0098] (6) Transfer the supernatant to another EP tube and centrifuge at 11000g and 4℃ for 10min;
[0099] (7) Carefully remove the supernatant. The precipitate is the mitochondria. If mitochondrial protein analysis is required, add 150 μL of mitochondrial lysis buffer pre-added with PMSF.
[0100] 1.3.2 Detection of Mic19 protein expression level in mitochondria by Western blotting
[0101] Mitochondrial proteins were extracted from infected HeLa cells and quantitatively prepared. Western blotting was used, with COX IV antibody as an internal control for mitochondrial protein detection, and Mic19 antibody was used to detect changes in Mic19 protein expression levels. The specific steps are as follows:
[0102] 1.3.2.1 Protein Concentration Determination
[0103] (1) Take a protein sample and centrifuge at 4℃ and 10000rpm for 5min;
[0104] (2) Add 2 μL of supernatant to a 96-well plate, and then add 18 μL of 10 mM PBS;
[0105] (3) Add 250 μL of Braford solution;
[0106] (4) Place the 96-well plate on the microplate reader and record the OD. 595 nm The readings are used to calculate the protein concentration.
[0107] 1.3.2.2 Identification of protein expression by Western blotting
[0108] (1) Dilute the protein samples to the same concentration using PBS;
[0109] (2) Add 10 μL of 4× loading buffer to every 30 μL of sample;
[0110] (3) Let the protein sample stand in a metal bath at 100°C for 10 min;
[0111] (4) Prepare 15-well protein gels according to Tables 1 and 2;
[0112] (5) Fill the protein gel plate with freshly prepared 1×SDS buffer (purchased from Sangon Biotech Co., Ltd.), and add recycled 1×SDS buffer outside the protein gel plate, just above the metal wire.
[0113] (6) Add 10 μL of protein sample to each well and add 5 μL of protein marker (purchased from Novizan Biotech Co., Ltd.) to the wells on both sides of the sample.
[0114] (7) 120V constant voltage electrophoresis until loading electrophoresis forms a straight line;
[0115] (8) Electrophoresis at 150V constant voltage until the protein markers are completely separated;
[0116] (9) Cut the gel according to the size of the protein and put the cut protein gel into a pre-cooled 1×Transbuffer (purchased from Polyplus);
[0117] (10) According to the principle of black glue and white film, place the filter-free sponge on the black board frame and neatly lay the protein glue;
[0118] (11) Cut a piece of PVDF membrane (purchased from Millipore) with the corresponding pore size and activate it with methanol for 30 seconds;
[0119] (12) Place the activated PVDF membrane on the protein gel, and then cover it with a layer of filter paper-free sponge;
[0120] (13) Place the transfer template into a 1×Transbuffer and transfer the film at a constant voltage of 103V for 45 minutes.
[0121] (14) Dissolve 2.5g of skim milk powder in 50mL of TBST to prepare 5% skim milk;
[0122] (15) Place the PVDF membrane after transfer in skim milk and seal it on a shaker at 80 rpm for 1 hour;
[0123] (16) Clean the membrane with TBST three times, 5 minutes each time;
[0124] (17) Discard TBST, add diluted primary antibody, and incubate overnight at 4°C;
[0125] (18) Recover the primary antibody and wash three times with TBST for 10 min each time;
[0126] (19) Discard TBST, add diluted secondary antibody, and incubate at room temperature for 45 min on a shaker at 80 rpm.
[0127] (20) Clean with TBST three times, 5 minutes each time;
[0128] (21) Exposure.
[0129] Table 1 12% Separating Gel
[0130]
[0131] Table 2 Concentrated Gel
[0132]
[0133] Mic19 is an important component of the MICOS family and is essential for maintaining the morphology of the mitochondrial inner membrane. This study collected mitochondrial proteins from EGD-e-infected and uninfected HeLa cells 2 hours after infection. Changes in Mic19 protein expression levels in cellular mitochondria were detected by Western blotting. Gray-scale analysis of the exposure results was performed, and t-tests were used to compare differences between data. The results showed that the Mic19 protein expression level in the EGD-e-infected group was significantly higher than that in the Mock group (P<0.01), while the change in Mic19 protein expression level in the EGD-eΔplcB-infected group was not significant. Figure 4 B). In general, Listeria monocytogenes infection of HeLa cells significantly increased the expression level of Mic19 protein in the mitochondria, and this change was associated with plcB.
[0134] 1.4 Effect of PlcB eukaryotic expression plasmid staining on Mic19 protein expression levels in HeLa cells
[0135] (1) Digest and centrifuge HeLa cells, then resuspend them in cell culture medium at a concentration of 1.5 × 10⁻⁶. 5 The solution is evenly spread in the 6-well plate at a density of / mL, with 2mL in each well;
[0136] (2) Transfect HeLa cells with N-Myc-pCMV-PlcB plasmid using transfection reagent. The specific steps are as follows: (a) cell seeding; (b) take a 1.5 mL EP tube and add 200 μL of jetPRIME buffer (purchased from Polyplus); (c) add 2000 ng of plasmid, mix well and let stand for 10 s; (d) add 4 μL of jetPRIME transfection reagent (purchased from Polyplus) and let stand for 10 min; (e) remove the 6-well plate and discard 200 μL of cell culture medium from each well; (f) add the plasmid and transfection reagent mixture to the 6-well plate, 200 μL per well.
[0137] (3) After transfection for 12, 24, 36 and 48 hours, the transfected cells were discarded from the culture medium and washed three times with 10mM PBS.
[0138] (4) Add WB IP lysis buffer pre-added with protease inhibitors and collect cell protein samples for later use;
[0139] (5) The changes in the content of Mic19 in HeLa cells were detected by Western blotting.
[0140] To investigate whether the increased protein expression level induced by Listeria monocytogenes is related to PlcB, this experiment transfected HeLa cells with the PlcB eukaryotic expression plasmid and simultaneously transfected them with the N-Myc-pCMV empty vector plasmid (purchased from Takara Bio) as a control group. HeLa cell proteins were collected at 12h, 24h, 36h, and 48h after transfection using Western blotting. Changes in intracellular Mic19 protein expression levels were detected by Western blotting. Gray-scale analysis of the exposure results was performed, and t-tests were used to compare the differences between data. The results showed that compared with HeLa cells not transfected with the PlcB eukaryotic expression plasmid, the expression level of Mic19 protein after transfection was significantly increased (P<0.001). Figure 5 B). This indicates that PlcB can lead to a significant increase in the expression level of Mic19 protein in cells.
[0141] 1.5 Effect of adding a proteasome inhibitor on the intracellular expression level of Mic19 protein after PlcB transfection
[0142] (1) Add proteasome inhibitor MG132 to HeLa cells transfected with N-Myc-pCMV-PlcB plasmid in a six-well plate 6 h before receiving the sample. Add 1 μL of proteasome inhibitor MG132 to each 1 mL of culture medium.
[0143] (2) Shake gently until well mixed, and place the 6-well plate in a 5% CO2, 37℃ cell culture incubator for static culture;
[0144] (3) HeLa cell proteins were collected at 12, 24, 36 and 48 h after transfection, and the steps were as follows: (a) WB IP lysis buffer and protease inhibitor were prepared into protein lysis buffer at a ratio of 100:1; (b) 6-well plates were taken 12 h after transfection, the cell culture medium was discarded and the plates were washed once with 10 mM PBS; (c) 6-well plates were placed on ice, 300 μL of protein lysis buffer was added to each well and lysed for 5 min; (d) Cells in the 6-well plates were collected by pipetting and inverting at 4 °C for 15 min; (e) The collected cell proteins were centrifuged at 4 °C and 10,000 rpm for 5 min; (f) The supernatant was used to determine the protein concentration and to prepare samples.
[0145] (4) The changes in the content of Mic19 in HeLa cells were detected by Western blotting.
[0146] Since the transcriptional level of MIC19 did not change significantly before and after infection, while transfection with PlcB led to an increase in Mic19 protein expression, this study investigated the mechanism by which PlcB caused this increase. After transfecting HeLa cells with PlcB, the ubiquitin-proteasome inhibitor MG132 was added 6 hours before sample collection at 12, 24, 36, and 48 hours after transfection. Cell proteins were then collected, and changes in Mic19 levels were detected by Western blotting. The results were analyzed using grayscale. The results showed that compared to cells not transfected with the PlcB eukaryotic expression plasmid, the expression level of Mic19 in PlcB-transfected HeLa cells treated with the proteasome inhibitor MG132 did not change significantly. Figure 6 B).
[0147] Example 2: siRNA interference with Mic19 protein expression in HeLa cells
[0148] 2.1 Transfection with siRNA
[0149] (1) Take 200 μL of DMEM culture medium into an EP tube;
[0150] (2) Add the dissolved siRNA to make the final concentration of the solution 50 nM, and add si-Ctrl to the control group at the same time. Mix well for 10 seconds.
[0151] (3) Add INTERFERIN reagent (purchased from Polyplus Transfection) according to the instructions and mix for 10 seconds;
[0152] (4) Let stand at room temperature for 10 minutes;
[0153] (5) Remove the 24-well plate with a cell density of 70%-90% and discard the culture medium;
[0154] (6) Wash twice with 10 nM PBS and add DMEM medium without FBS;
[0155] (7) Add the solution from step 3 and gently shake until well mixed;
[0156] (8) Used for subsequent experiments 24 hours after transfection.
[0157] 2.2 Validation of siRNA interference effect
[0158] HeLa cells transfected with si-Ctrl (targeting non-MIC19 gene sites) and si-MIC19 (sense strand: 5'-AAUUCUUCAUCAGAAACUGAG-3'(SEQ ID NO:3); antisense strand: 3'-CAGUUUCUGAUGAAGAAUUGA-5'(SEQ ID NO:4)) were collected, and intracellular Mic19 expression levels were detected by Western blotting.
[0159] HeLa cells were transfected with siRNA-MIC19 for 26 h and 30 h (corresponding to infection time). Cellular proteins were collected and quantified. Changes in Mic19 protein expression levels in HeLa cells were detected by Western blotting, and the exposure results were analyzed for grayscale. Results showed that when Mic19 was used as the primary antibody, the protein bands in cells transfected with siRNA-MIC19 were significantly less bright than those in untransfected cells. Figure 7 A) Compared to cells transfected with si-Ctrl, cells transfected with si-MIC19 showed a significantly lower intracellular Mic19 protein expression level (p<0.001). Figure 7 B) indicates that siRNA effectively interferes with the protein expression of Mic19 in cells.
[0160] Example 3: Detection of intracellular proliferation of HeLa cells after Listeria monocytogenes infection.
[0161] (1) Take HeLa cells with siRNA-MIC19 and si-Ctrl respectively and plate them in 24-well plates, with three replicates for each group;
[0162] (2) Add EGD-e at a ratio of MOI = 150:1;
[0163] (3) One hour after infection, discard the culture medium containing bacterial solution and wash three times with warm 10mM PBS;
[0164] (4) Add warm FBSDMEM medium containing gentamicin, and let stand at 37°C for 1 hour with 5% CO2.
[0165] (5) Discard the culture medium and wash three times with 10mM PBS;
[0166] (6) Add sterile ddH2O containing 10% EDTA, lyse on ice for 10 min, and replace the remaining cells with DMEM medium containing 10% FBS for further culture.
[0167] (7) Collect all the cells in the 24-well plate, shake to mix, and then serially dilute with 10mM PBS;
[0168] (8) Take 10 μL of the diluted cell lysate and spot it on BHI antibiotic-free solid medium. Perform three replicates for each gradient.
[0169] (9) Dry the inoculated BHI solid culture medium in a clean bench and invert it in a 37°C incubator overnight.
[0170] (10) Count the number of bacteria and analyze the results.
[0171] HeLa cells transfected with siRNA-MIC19 for 12 hours were infected with the wild-type Listeria monocytogenes strain EGD-e. Cells were lysed at 2 hours and 6 hours after infection, diluted, and spotted onto BHI solid medium. The number of Listeria monocytogenes bacteria was counted. The infection results of HeLa cells transfected with si-Ctrl were used as a control group for data analysis. The results showed that at 2 hours and 6 hours after infection, the number of bacteria in the si-MIC19-interfered cells was significantly lower than that in the si-Ctrl control group (p < 0.001). Figure 8 Therefore, a decrease in the expression level of Mic19 protein in HeLa cells leads to a significant reduction in the intracellular proliferation capacity of Listeria monocytogenes.
Claims
1. Use of a MIC19 gene expression inhibitor in the preparation of a medicament for reducing Listeria monocytogenes infection.
2. Use according to claim 1, characterized in that, The MIC19 gene expression inhibitor is an siRNA against MIC19 gene.
3. A method for reducing cell infection with Listeria monocytogenes in vitro, characterized in that, inactivating or reducing the expression of MIC19 gene.
4. The method of claim 3, wherein, The inactivating or reducing the expression of MIC19 gene comprises the step of introducing into the cell an siRNA against MIC19 gene.
5. The method according to claim 3 or 4, characterized in that, The cell is a human cell, preferably a human monocyte or a human cervical cancer cell, more preferably a human monocyte.
6. Use according to claim 2 or method according to claim 4, characterized in that, The siRNA comprises a sense strand and an antisense strand forming a double-stranded region, the sense strand sequence is as shown in SEQ ID NO: 3, and the antisense strand sequence is as shown in SEQ ID NO:
4.
7. Use according to claim 1 or method according to claim 4, characterized in that, The MIC19 gene encodes an amino acid sequence of SEQ ID NO:
1.
8. Use according to claim 1 or method according to claim 4, characterized in that, The MIC19 gene has a nucleotide sequence of SEQ ID NO:
2.
9. A cell obtained by the method according to claims 3-8.