Conjugates of saponins and antisense oligonucleotides for use in the treatment of neurodegenerative diseases

Pentacyclic triterpene saponins with a 12,13-dehydrooleanane-type aglycone core enhance nucleic acid delivery to neuronal organs, addressing inefficiencies and safety issues in current therapies, providing safer and more effective treatment options.

JP2026521778APending Publication Date: 2026-07-01SAPREME TECH BV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2025574586
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2023-06-21
Filing Date
2024-06-19
Publication Date
2026-07-01

Smart Images

  • Figure 2026521778000051
    Figure 2026521778000051
  • Figure 2026521778000052
    Figure 2026521778000052
  • Figure 2026521778000053
    Figure 2026521778000053
Patent Text Reader

Abstract

The present invention relates to the field of therapy and drug delivery. More specifically, therapeutic methods and pharmaceutical compositions for treating disorders of blood-tissue barrier-protected organs that harbor substantial populations of postmittal neurons, such as organs derived from the neural tube, including the central nervous system and the eye. The disclosed methods and compositions involve topical administration of an effector component that targets intracellular biological targets to such organs, in combination with a saponin component that enhances the effective uptake of the effector component into cells and / or enhances the effective delivery of the effector component within cells where the biological target is present. For example, the effector component may be an oligonucleotide therapeutic that targets gene products associated with CNS and / or ocular disorders. Due to the cellular uptake stimulating and / or endosomal escape enhancing effects of the saponin component, the neuropharmaceuticals and ophthalmic compositions presented herein for topical administration to the CNS and / or eye, respectively, can be formulated with lower concentrations of the effector component and / or lower volumes, which provides safety benefits to neurons and patient comfort.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] The present invention relates to the field of therapy and drug delivery. More specifically, therapeutic methods and pharmaceutical compositions for treating disorders of blood-tissue barrier-protected organs that harbor substantial populations of postmittal neurons, such as organs derived from the neural tube, including the central nervous system and the eye. The disclosed methods and compositions involve topical administration of an effector component that targets intracellular biological targets to such organs, in combination with a saponin component that enhances the effective uptake of the effector component into cells and / or enhances the effective delivery of the effector component within cells where the biological target is present. For example, the effector component may be an oligonucleotide therapeutic that targets gene products associated with CNS and / or ocular disorders. Due to the cellular uptake stimulating and / or endosomal escape enhancing effects of the saponin component, the neuropharmaceuticals and ophthalmic compositions presented herein for topical administration to the CNS and / or eye, respectively, can be formulated with lower concentrations of the effector component and / or lower volumes, which provides safety benefits to neurons and patient comfort. [Background technology]

[0002] Patients suffering severe nerve damage, such as neurodegeneration, paralysis, and blindness, often require lifelong support, placing a significant burden not only on the patients themselves but also on their families and society. Therefore, strategies are needed to advance the treatment of disorders that lead to nerve cell damage and affect organs made of nerve tissue.

[0003] Neurons are electrically excitable, specialized cells whose function is to send, receive, and transmit electrochemical signals across different areas of the body. They are extremely fragile cells with very limited regenerative capacity and extremely high sensitivity to various types of stress, harmful substances, and injury (Di Virgilio, 2006). Their survival is substantially dependent on other cell types called glial cells that surround neurons as part of the nervous tissue. Due to this vulnerability, and in addition to being hidden behind the axial skeleton structure of the human skull, which is only 7 mm thick, the organs of the body that enclose the nervous tissue are equipped with numerous adaptive mechanisms and anatomical protective structures that are thought to exist to protect postmittal nerve cells from stress and injury. This is especially true of the interrelated organs derived from the embryonic progenitor structure known as the neural tube, which are the brain, spinal cord, and eyes (Marchesi et al., 2021).

[0004] The substantial majority of neurons are concentrated within the central nervous system (CNS), and a large population is also present in the retina of the eye, which is formed from nerve tissue and connects directly to the brain via the optic nerve (Purves et al., 2001). The state of the eye as an extension of the brain's anatomical structure is reflected not only by the presence of neurons and glial cells in both of these organs, but also by several clear parallels between their vascular characteristics and immune responses, namely the presence of the blood-tissue barrier and so-called immune privilege (Nguyen et al., 2021).

[0005] The eyes and other CNS organs, namely the brain (including the brainstem) and spinal cord, are considered immune-privileged organs with highly controlled adaptive immunity and inflammation. This feature is thought to exist to protect susceptible nerve cells from potential immune-mediated damage and death (Hong and Kaer, 1999). The blood-tissue barrier then enables this protection by providing an anatomical interface between the capillaries and the cells of these organs and their other components (e.g., cerebrospinal fluid [CSF] in the CNS, vitreous humor in the eye, etc.). This interface not only keeps infectious agents away but also restricts the exchange of substances across the capillary walls, protecting neurons from dangerous bodily metabolites and toxins that may be present in the blood. The barriers of the CNS and eyes are collectively called the blood-ocular barrier, which includes the blood-brain barrier (BBB), the blood-spinal cord barrier, and the blood-retinal barrier, respectively. While their presence and integrity are essential for neuroprotection, if the pathological process has already begun in the CNS or eyes, most drug types are unable to cross the blood-tissue barrier or require complex modifications to do so, thus severely limiting the options for pharmacological intervention (Mitusova et al., 2022).

[0006] Perhaps the most promising type of drug currently available for treating CNS disorders and many ocular conditions is nucleic acid therapies. They are based on chain-like polymers of DNA or RNA with frequent synthetic modifications (an overview can be found in Roberts et al., 2020). While their chains may contain entire transcripts or mutation repair sequences for gene therapy (Ghoraba et al., 2022), more frequently, shorter polymers (oligomers, called oligonucleotides for brevity) are used to modulate gene expression when delivered to diseased cells. Typical examples include antisense oligonucleotides (ASOs, AONs) as well as RNA interference oligotherapies such as siRNAS and microRNAs (Roberts et al., 2020). Due to their immense potential, many are currently in development or clinical trials (Moumne et al., 2022), and some have been approved by the FDA for CNS and ophthalmic diseases. Some examples include nusinersen (Spinraza®), a splicing-adjustable 2'-O-MOE ASO for the treatment of spinal muscular atrophy; homivirsen (Vitravene®), a PS-DNA ASO for intraocular cytomegalovirus retinitis infection; and pegatinib (Macugen®), a synthetic DNA aptamer for neovascular age-related macular degeneration (AMD).

[0007] However, even the smallest oligonucleotide therapeutics cannot cross the blood-tissue barrier and require local administration directly to the CNS or eye to bypass it. For example, Spinraza® is administered intrathecally to the CSF, while both Vitravene® and Macugen® require repeated intravitreal injections into the eye. Such interventions are naturally unpleasant for the patient, partly due to the increased pressure within and around the organs resulting from the puncture and introduction of the therapeutic volume. This can cause side effects such as nausea and tissue detachment. More importantly, these interventions carry a potentially serious risk of neurotoxicity from the drug components and also lead to highly toxic infections that are amplified by repeated administration, given the limited immune protection provided by the immune privileges of these organs.

[0008] It is not better in relation to intraocular injections. Firstly, they have the major drawbacks of being usually painful and only being able to deliver small amounts of medication because the volume that the eye or surrounding tissues can accept is limited. Furthermore, the larger the volume injected, the greater the increase in pressure around or inside the eye, which causes further discomfort and imposes further constraints on the volume that can be injected and the amount of medication that can be administered. This is complicated by the fact that these injections are not only painful but must also be administered by trained personnel, sometimes in an operating room, and are associated with an increased risk of eye infection and damage.

[0009] For example, repeated intravitreal injections are known to cause retinal detachment, subconjunctival hemorrhage, retinal toxicity, corneal abrasion, endophthalmitis, and potentially catastrophic intraocular infections (Falavarjani et al., 2013). As a result, maximizing the dose per treatment is a common practice to avoid frequent reinjections, which not only increases intraocular pressure (IOP)-related discomfort but also increases the potential for dose-related toxic effects (deVries et al., 2020). The occurrence of such or similar adverse events has caused several nucleic acid-based therapies, including the VEGF-A targeted siRNA bevacilanib, to fail in clinical trials.

[0010] Given the limited treatment options for the most common eye diseases, patients are expected to receive eye injections throughout their lives. Consequently, the frequency of injections needs to be reduced as much as possible, sometimes by improving bioavailability. At the same time, injections need to be more tolerable and safer for patients. Therefore, in addition to the need to increase bioavailability, which can be achieved by increasing the dose, there is also the conflicting need to keep the volume of the injectable formulation as low as possible.

[0011] Therefore, it is necessary to reduce the frequency and discomfort associated with invasive local treatments, while decreasing the injectable volume, by increasing the efficacy, bioavailability, and long-term effects of nucleic acid therapies in some cases. This is not simple, as oligonucleotide therapies are known to undergo highly inefficient cellular uptake, especially when administered locally and delivered or targeted to cells or sites of the desired therapeutic effect. This prevents oligonucleotides from effectively reaching the cytoplasmic and / or nuclear intracellular compartments where they are supposed to act on their common targets. This is best reflected by quantitative estimates that perhaps less than 2% of therapeutic doses of oligonucleotide drugs become accurately internalized, which is likely due to the estimated 98% being retained in endosomal compartments and ultimately degraded in lysosomes (Gilleron et al., 2013).

[0012] This inefficient cellular uptake leads to high-dose administration and high-frequency, high-dose administration, both of which increase the risk of off-target effects, which are potentially cytotoxic in nature. Furthermore, higher doses of nucleic acids increase the risk of stimulating the immune system, regardless of the organ's immune privileged status, as observed, for example, in response to ASO injection into the mouse brain (Toonen et al., 2018).

[0013] In conclusion, improved compositions of nucleic acid therapeutics are needed for the safe and sustainable treatment of neuron-rich tissues. Therefore, strategies are needed that allow for more efficient delivery of nucleic acid therapeutics, dose reduction, and increased intervals between invasive administrations. Importantly, these strategies must result in increased cellular uptake of the therapeutic agent without causing neurotoxicity or inducing neurotoxic stress or immunostimulatory effects. [Overview of the project] [Problems that the invention aims to solve]

[0014] The object of this disclosure is to provide such compositions and strategies as described below. [Means for solving the problem]

[0015] This disclosure relates to the finding that pentacyclic triterpene saponins containing a 12,13-dehydrooleanane-type aglycone core are stable for direct topical administration and enhancement of nucleic acid therapeutics in organs rich in susceptible neurons protected by the blood-tissue barrier and apparent immune privilege, particularly in CNS organs and organs derived from the neural tube, such as the eye.

[0016] Interestingly, at test concentrations, pentacyclic triterpene saponins containing a 12,13-dehydrooleanane-type aglycone core were observed to enhance the therapeutic effect of oligonucleotide therapeutics administered concurrently at substantially lower doses than their usual reference dose, while simultaneously showing no apparent neurotoxic effects in mouse brains, as further demonstrated by in vivo mouse data.

[0017] Based on this discovery, methods and compositions are provided herein that enhance the effective uptake of an effector component into cells containing a biological target, by combining an effector component that targets an intracellular biological target with a saponin component made of this particular saponin type, and administering it topically to neuron-rich organs. For example, the effector component may be an oligonucleotide therapeutic that targets gene products associated with CNS and / or ocular disorders. Due to the cellular uptake-stimulating effect of the saponin component, the neuropharmaceutical compositions and ophthalmic compositions presented herein for topical administration into the CNS and / or eyes, respectively, may be formulated with lower concentrations of the effector component and / or lower volumes, which provides safety benefits to neurons and patient comfort.

[0018] This particular type of saponin has been characterized as having endosomal escape enhancement (EEE) activity against various antibody-drug conjugates (ADCs) in several cancer cells, as reported, for example, in International Publication No. 2020126620, and they have shown promising effects in enhancing known cancer therapies. However, cancer cells are robust cells that are targets of cytotoxic therapeutic strategies. In contrast to known cancer-targeted therapies, local delivery to organs rich in susceptible neurons requires that a given therapeutic composition be safe or at least not cytotoxic to vulnerable nerve cells present in these organs, even though the therapeutic composition is intended to directly target neurons or other cell types within the same nerve tissue compartment.

[0019] As disclosed herein, these particular saponins, after direct topical administration by injection to any one of these organs, appear safe for the neuronal structures of the brain and eye while simultaneously retaining the ability to enhance nucleic acid delivery. In particular, this enhancement is demonstrated herein in mature and differentiated cells of the brain. Such differentiated cells, in particular, are very different from the cultured immortalized cells disclosed in International Publication No. 2020126620 and are more difficult to "transfect" with nucleic acids. Therefore, the enhancement of the therapeutic effect of nucleic acids administered in vivo to neuron-rich organs at doses lower than nominal doses in the presence of the saponins presented herein demonstrates the potential of the methods disclosed herein for developing improved therapeutic compositions for nucleic acid-mediated therapy of neuron-rich organs such as the brain and eye.

[0020] In accordance with the foregoing, a saponin component for use in a therapeutic method for treating a subject suffering from a disorder of an immune-privileged neuron-rich organ, which includes a vascular structure having blood-tissue barrier properties and is preferably derived from the neural tube, is disclosed herein for the first time, and the method is: Saponin components including a pentacyclic triterpene saponin containing a 12,13-dehydrooleanane type aglycone core, Effector components including nucleic acid therapeutics intended to be delivered to one or more cells of an organ, This includes administering the drug to the target organ, and the administration is carried out either directly to the organ or into a body cavity or fluid space that is in communication with the cells of the organ (i.e., the blood-tissue barrier is not blocked).

[0021] Advantageously, organs rich in immune-privileged neurons, including vascular structures with blood-tissue barrier properties, are selected from organs of the CNS, including the eyes, brain, and spinal cord.

[0022] In related embodiments, the above-mentioned pharmaceutical compositions for treating disorders of neuronal organs are further disclosed herein, particularly neuropharmaceutical compositions for treating disorders in the CNS, for example, the brain, or alternatively, ophthalmic compositions for treating disorders of the eyes.

[0023] Therefore, in detail, pharmaceutical compositions for use in the treatment of disorders of neuronal organs, including blood vessels having blood-tissue barrier properties (immunely privileged), are further disclosed herein, and the pharmaceutical compositions are Saponin components including a pentacyclic triterpene saponin containing a 12,13-dehydrooleanane type aglycone core, Effector components including nucleic acid therapeutics intended to be delivered to one or more cells of an organ, The pharmaceutical composition, which includes [the specified substance], is administered either directly to an organ or into a body cavity or fluid space that communicates with the cells of the organ (i.e., the blood-tissue barrier is not blocked).

[0024] In further and related embodiments, a method for treating a subject suffering from a disorder of neuronal organs (immunely privileged) including blood vessels having blood-tissue barrier properties, Saponin components including a pentacyclic triterpene saponin containing a 12,13-dehydrooleanane type aglycone core, Effector components including nucleic acid therapeutics intended to be delivered to one or more cells of an organ, The present invention provides a method comprising administering to the subject, wherein the administration is carried out directly to an organ or into a body cavity or fluid space that is in communication with the cells of the organ (i.e., the blood-tissue barrier is not blocked).

[0025] Furthermore, the use of saponin components in the manufacture of pharmaceuticals for use in methods of treating subjects suffering from disorders of neuronal organs, including blood vessels with blood-tissue barrier properties (immunely privileged), is provided herein, and the therapeutic method is Saponin components including a pentacyclic triterpene saponin containing a 12,13-dehydrooleanane type aglycone core, Effector components including nucleic acid therapeutics intended to be delivered to one or more cells of an organ, This includes administering the substance to the subject, and the administration is carried out either directly to an organ or into a body cavity or fluid space that is in communication with the cells of the organ (i.e., the blood-tissue barrier is not blocked).

[0026] In summary, to address the shortcomings of the prior art, the present disclosure provides saponin components and pharmaceutical compositions for use in the treatment of neuronal organ disorders, comprising a saponin component comprising a pentacyclic triterpene saponin containing a 12,13-dehydrooleanane-type aglycone core, and an effector component comprising a nucleic acid therapeutic agent intended to be delivered to one or more cells of the organ, wherein the treatment is carried out by administering the saponin directly to the organ or into a body cavity or fluid space communicating with the cells of the organ (where the blood-tissue barrier is not occluded).

[0027] Furthermore, it should be noted that one of the objectives of the further embodiments disclosed herein is to provide a solution to the problem that the efficacy of current nucleic acid therapeutics is lower than desired and that they are unable to adequately reach and / or enter diseased cells in neuron-rich organs after local administration.

[0028] Another object of the disclosed embodiments is to provide a solution to the problem of inefficient nucleic acid delivery and target engagement, which is likely to be due to the low effective nucleic acid concentration at target sites in neuron-rich organs after local administration.

[0029] A further object of the disclosed embodiments is to provide a solution to one or more of the following problems: insufficient delivery of the required amount of nucleic acid therapeutic agent to the site of action by local delivery to neuron-rich organs; suppressed or suboptimal therapeutic effects of the delivery pathway; and off-target activity and / or undesirable adverse effects of the delivery pathway in or around the administration site.

[0030] One yet another objective disclosed herein is to provide a solution to the problem of inadequate safety characteristics of currently existing nucleic acid therapeutics, particularly those related to adverse effects associated with toxicity, discomfort, and / or post-administration complications, when administered topically to neuronal rich organs in human patients who require them, especially when administered in excessive doses that induce side effects.

[0031] definition As used herein, the term “neuron-rich organs containing vascular structures with blood-tissue barrier properties” should be interpreted as one of the organs containing a substantial population of nerve tissue and blood vessels with blood-tissue barrier properties. As used herein, this term should be interpreted in particular as referring to the organs of the central nervous system (CNS, the brain and spinal cord) and the eye, which are organs whose substantial and / or functional parts arise from an embryonic structure called the neural tube and which share many anatomical and physiological similarities. For example, these organs all contain nerve cells made up of neurons and glial cells, are considered to have immune privileges, are supplied with blood through blood vessels (capillaries), and are protected by the axial skeletal structures of the skull and spine, with the passage of many compounds severely restricted by the properties of the blood-tissue barrier (as the name suggests, implying the blood-eye barrier, including the blood-brain barrier, spinal cord barrier, and blood-retinal barrier).

[0032] As used herein, the term “eye” shall be understood to mean the eye of a vertebrate, preferably the human eye, which is a bilateral spherical organ that houses the photosensitive structures necessary for vision. For brevity, as used herein, the term “eye” shall be understood to be synonymous with what is understood as the anatomical “eyeball,” that is, a complex spherical organ made of the sclera and cornea and covered by a fibrous layer located within a bony cavity (orbit) known as the “eye socket” of the vertebrate skull.

[0033] The term "saponin" has its usual scientific meaning and refers to a chemical compound from the group of amphiphilic glycosides that contains one or more hydrophilic glycosides (usually located in a chain containing at least one sugar group, but more frequently involving branched glycan chains of several sugar groups), where one or more glycosides are covalently bonded to a lipophilic aglycone core of a steroid or terpenoid structure called a sapogenin.

[0034] In relation to saponins, the terms “aglycone core,” “sapogenin,” and “aglycone core structure” and “aglycone glycoside core (structure)” are used interchangeably and in accordance with their scientifically accepted meanings in the art. That is, these terms refer to the lipophilic portion of a saponin, which has a steroid or terpenoid structure and to which one or more glycosides are attached (these glycosides are sometimes called “glycone antennas” or “sugar antennas”).

[0035] The terms “glycan” or “carbohydrate chain” have their usual scientific meanings and, as used herein, refer to any glycan, carbohydrate antenna, single sugar moiety (monosaccharide), or chain containing multiple sugar moieties (oligosaccharide, polysaccharide). A glycan may consist only of sugar moieties or may include further moieties, such as one of 4E-methoxycinnamic acid, 4Z-methoxycinnamic acid, and 5-O-[5-O-Ara / Api-3,5-dihydroxy-6-methyl-octanoyl]-3,5-dihydroxy-6-methyl-octanoic acid, as found in QS-21, for example.

[0036] In relation to the names of sugar chains, the terms "Api / Xyl-" or "Api- or Xyl-" have their usual scientific meanings and, as used herein, refer to sugar chains that either contain an apiose (Api) moiety or a xylose (Xyl) moiety.

[0037] As will be apparent from this specification, a certain group of saponins having a terpenoid aglycone core will form part of the pharmaceutical compositions and therapeutic methods presented herein. Due to this aglycone core structure, saponins are classified as pentacyclic triterpene saponins, particularly those containing a 12,13-dehydrooleanane type aglycone core. The chemical structure of this aglycone core type is schematically shown in the saponins presented in the scheme (mode for carrying out the invention) of saponin A. Examples of 12,13-dehydrooleanane type aglycone cores include the saponin aglycone cores of chiric acid and gypsogenin, which, in addition, in their natural form, also contain an aldehyde functional group at the C-23 position of the aglycone core. For example, chiric acid has an aglycone glycoside core structure of SO1861, SO1832, AG1856.

[0038] Saponins may or may not be naturally occurring, and may be modified, for example, during isolation processes, partial degradation, chemical modification, or partially or completely synthesized.

[0039] Therefore, as used herein, the term “saponin” should be interpreted as any glycoside compound (whether free or conjugated with another compound) insofar as it contains at least one hydrophilic glycoside portion covalently bonded to a lipophilic aglycone core of a steroid or terpenoid structure, regardless of whether the glycoside compound is identical to a naturally occurring saponin, or in terms of structure it appears to largely coincide with a naturally occurring saponin, but has at least one chemical modification to either the glycoside portion or the aglycone core portion compared to its corresponding naturally occurring saponin, or a glycoside compound that does not appear to correspond to any natural saponin but is a saponin by the above definition, and can be obtained synthetically through chemical and / or biotechnological synthetic routes, and for this reason is it not similar to a naturally occurring saponin, but still clearly contains at least one hydrophilic glycoside portion covalently bonded to a lipophilic aglycone core of a steroid or terpenoid structure.

[0040] As already stated above, when used herein, the term saponin means (i) non-conjugate ("free") saponins, as further referred to herein using the term "saponin molecule," in relation to the saponin components of the pharmaceutical compositions and therapeutic methods disclosed herein, and (ii) A saponin that is covalently conjugated to another compound type and thus forms part of a conjugate containing at least one saponin as the saponin moiety of the conjugate, wherein the saponin moiety is conjugated to at least one non-saponin moiety such as a linker for further conjugation, and is conjugated as an effector molecule such as an oligonucleotide or a saponin that is conjugated as a targeted ligand recognized by a cell surface receptor, such as an endocytosis receptor. It shall be interpreted as encompassing the following. Accordingly, with respect to the saponin components of the pharmaceutical compositions and therapeutic methods disclosed herein, such covalently conjugated saponins are further referred to herein using the term “saponin portion” to distinguish them from unconjugated (“free”) saponins referred to herein using the term “saponin molecule” as described above.

[0041] As used herein, the term “saponin component” refers to a component of a pharmaceutical composition or therapeutic method (which should be interpreted as synonymous with the term “therapeutic method”), which includes saponins as defined above.

[0042] In accordance with the above description, saponins may be present in the pharmaceutical composition or provided as part of a therapeutic method in a non-conjugated form (as used herein, as a “saponin molecule”) or in a form covalently conjugated to at least one other compound that is not a saponin, thus forming part of a conjugate containing a saponin (as used herein, as the “saponin portion” of the conjugate) and at least one other compound that is not a saponin (as used herein, as the “non-saponin portion” of the conjugate). For example, as used herein, a “saponin molecule” may correspond to a natural saponin molecule found in or isolated from a natural source such as plant material, or to a non-natural saponin molecule having chemical modifications compared to a natural saponin. When such a saponin molecule is covalently conjugated to another compound that is a linker, for example, which can be used in a further conjugation step, the saponin portion of the formed conjugate will be referred to as the “saponin portion”. For comparison, in the case of a saponin component of a pharmaceutical composition, the saponin component may include a pentacyclic triterpene saponin comprising a 12,13-dehydrooleanane-type aglycone core and an acid-sensitive covalent bond having one or more atoms, where the bond can be considered to simply substitute for the aldehyde functional group at the C-23 position of the aglycone core for reasons such as the one or more atoms not being functionally further classifiable (e.g., the one or more atoms not being a linker with a chemical group for further conjugation reactions, nor a ligand for binding to a receptor) or not being structurally further classifiable (e.g., the one or more atoms not being an oligonucleotide, peptide, oligosaccharide, etc.), in which case such a saponin component is further referred to using the term "saponin molecule" rather than the term "saponin portion".However, if the saponin component includes a pentacyclic triterpene saponin comprising a 12,13-dehydrooleanane-type aglycone core and an acid-sensitive covalent bond to another functionally or structurally distinct non-saponin moiety (e.g., a linker, ligand, oligonucleotide, etc.), then such a saponin is further referred to using the term "saponin moiety" rather than "saponin molecule." The above distinction is obvious to those skilled in the art and does not require further explanation.

[0043] The term "Saponinum album" has its usual scientific meaning and, as used herein, refers to a mixture of saponins produced by Merck KGaA (Darmstadt, Germany) that contains saponins derived from Gypsophila paniculata and Gypsophila arostii, primarily SA1657 and SA1641.

[0044] The term "Quillaja saponin" has its usual meaning and, as used herein, refers to the saponin fraction of Quillaja saponaria, and therefore the source of all other QS saponins, primarily containing QS-18 and QS-21.

[0045] "QS-21" or "QS21" has its usual scientific meaning and, as herein it refers to a mixture of QS-21 A-apio (about 63%), QS-21 A-xylo (about 32%), QS-21 B-apio (about 3.3%), and QS-21 B-xylo (about 1.7%).

[0046] Similarly, "QS-21A" has its usual scientific meaning and, as used herein, refers to a mixture of QS-21 A-apio (about 65%) and QS-21 A-xylo (about 35%).

[0047] Similarly, "QS-21B" has its usual scientific meaning and, as used herein, refers to a mixture of QS-21 B-apio (about 65%) and QS-21 B-xylo (about 35%).

[0048] The term "Quil-A" refers to a commercially available semi-purified extract derived from Quillaja saponaria, which contains over 50 different saponins in varying amounts. Many of these saponins incorporate the triterpene trisaccharide substructure Gal-(1→2)-[Xyl-(1→3)]-GlcA-, found in QS-7, QS-17, QS-18, and QS-21, into the C-3 beta-OH group. The saponins found in Quil-A are listed in Table 2 of van Setten (1995) [Dirk C. van Setten, Gerrit van de Werken, Gijsbert Zomer and Gideon FAKersten, Glycosyl Compositions and Structural Characteristics of the Potential Immuno-adjuvant Active Saponins in Quillaja Saponaria Molina Extract Quil A, RAPID COMMUNICATIONS IN MASS SPECTROMETRY, VOL.9, 660-666 (1995)]. Quil-A and quillaya saponins are fractions of saponins derived from quillaya (Quillaja saponaria), and both contain a diverse range of different saponins with largely overlapping content. Because these two fractions are obtained by different purification procedures, they differ in their specific composition.

[0049] The terms "QS1861" and "QS1862" refer to QS-7 and QS-7 API, respectively. QS1861 has a molecular weight of 1861 daltons, and QS1862 has a molecular weight of 1862 daltons. QS1862 is listed in row 28 of Table 1 in Fleck et al. (2019) [Juliane Deise Fleck, Andresa Heemann Betti, Francini Pereira da Silva, Eduardo Artur Troian, Cristina Olivaro, Fernando Ferreira and Simone Gasparin Verza, Saponins from Quillaja saponaria and Quillaja brasiliensis: Particular Chemical Characteristics and Biological Activities, Molecules 2019, 24, 171; doi:10.3390 / molecules24010171]. The structure described is the API variant QS1862 of QS-7. Its molecular weight is 1862 daltons, which is the formal mass of glucuronic acid containing protons. At neutral pH, the molecule is deprotonated. When measured by mass spectrometry in anion mode, the measured mass is 1861 daltons.

[0050] The terms "SO1861" and "SO1862" refer to the same saponin from Saponaria officinalis, but in the deprotonated or API form, respectively. The molecular weight is 1862 daltons, which is the formal mass of glucuronic acid containing protons. At neutral pH, the molecule is deprotonated. When the mass is measured using mass spectrometry in anion mode, the measured mass is 1861 daltons.

[0051] The term “conjugate” has its usual scientific meaning and, as used herein, refers to at least one first molecule (further referred to as the “first part”) covalently bonded to at least one second molecule (the “second part”), thereby forming a covalently bonded aggregate containing or consisting of the first and second parts. Typical conjugates are ADC, AOC, and SO1861-EMCH (EMCH linked to the aldehyde group of the aglyconecoside core structure of a saponin, according to formula (I) (see below)). Thus, as used herein, the term “conjugate” should be interpreted as a combination of two or more distinct parts that are covalently bonded and were previously referred to as two or more molecules (as used herein purely to distinguish between the conjugated and unconjugated states). For example, the different parts that form a conjugate as disclosed herein may include one or more saponins or saponin moieties having one or more ligands that bind to endocytosis receptors present on the surface of neurons, glial cells, or tumor cells, preferably an antibody or its binding fragment, such as a single-domain antibody including IgG, a monoclonal antibody (mAb), a VHH domain, or another nanobody type, or a divalent nanobody molecule containing two single-domain antibodies. In some embodiments, the conjugates disclosed herein may be made by covalently linking different parts via one or more intermediate parts, such as linkers, for example, via linkage to a central linker or further linkers. In a conjugate, it is not necessary for all two or more different parts, such as three, to be directly covalently linked to each other. The covalent linkage of different parts in a conjugate may be due to both being covalently linked to the same intermediate part, such as a linker, or each being covalently linked to an intermediate part, such as a further linker or a central linker, and the two intermediate parts, such as two (different) linkers, being covalently linked to each other.According to this definition, as long as there is a chain of covalently bonded atoms between two different parts of a conjugate, many more intermediate parts, such as linkers, can exist.

[0052] As used herein, the term “effector component” should be interpreted herein as referring to a component of a composition or treatment, which includes or consists of an effector molecule or part thereof. Examples of effector components are nucleic acid therapeutics or oligonucleotide therapeutics, where the nucleic acid or oligonucleotide is the effector molecule or effector part. An effector component containing an oligonucleotide therapeutic may be referred to as an “oligonucleotide component” in such an example.

[0053] For example, when referring to an effector molecule as part of a covalent conjugate, such as an effector component containing a ligand for binding to an endocytic cell surface receptor and containing, for example, a nucleic acid, the terms “effector molecule” or “effector moiety” have their usual scientific meaning, and herein, they refer to a molecule that can selectively bind to one or more of the following: target molecules: proteins, peptides, carbohydrates, sugars such as glycans, (phospho)lipids, nucleic acids such as DNA and RNA, or enzymes, and modulate the biological activity of one or more such target molecules. In the effector molecules disclosed herein, the effector moiety exerts its effect, for example, in the cytosol (cytoplasm) and / or cell nucleus, and / or is delivered into the cell via endosomes and / or lysosomes, and / or is active after leaving or escaping the endosomal-lysosome pathway (simultaneously with entering the cytoplasm). An effector molecule is a molecule selected from one or more of the following: small molecules such as drug molecules, toxins such as protein toxins, nucleic acids or polynucleotides such as BNA, ASO, and PMO, siRNA, enzymes, peptides, proteins or their active fragments or active domains, or any combination thereof. Therefore, for example, an effector molecule or effector moiety is a molecule or moiety selected from one or more of the following: small molecules such as drug molecules, toxins such as protein toxins, nucleic acids or polynucleotides such as BNA, ASO, and PMO, siRNA, enzymes, peptides, proteins, or any combination thereof, and can selectively bind to one or more of the following target molecules: proteins, peptides, carbohydrates, sugars such as glycans, (phospho)lipids, nucleic acids such as DNA and RNA, and enzymes, and modulates the biological activity of such one or more target molecules upon binding to the target molecule. For example, the effector moiety is a toxin or its active-toxic fragment, active-toxic derivative, or active-toxic domain. Typically, an effector molecule can exert a biological effect inside cells, such as mammalian cells such as human cells, for example, within the cytosol or nucleus of the cell.Therefore, the effector molecules or parts disclosed herein are any substances that affect cellular metabolism through interaction with intracellular effector molecular targets, which are any molecules or structures inside the cell, including the membranes of these compartments and vesicles, but excluding the compartments and vesicle lumens of the endocytosis and recycling pathways. Therefore, the intracellular structures include the nucleus, mitochondria, chloroplasts, endoplasmic reticulum, Golgi apparatus, other transport vesicles, the inner part of the plasma membrane, and the cytosol. Therefore, typical effector molecules are drug molecules, enzymes, nucleic acids, e.g., plasmid DNA or ASO or siRNA or PMO, toxins, e.g., toxins contained in antibody-drug conjugates (ADCs), polynucleotides, e.g., siRNA, BNA, nucleic acids contained in antibody-polynucleotide conjugates (AOCs). For example, an effector molecule / part may act as a ligand that can increase or decrease (intracellular) enzyme activity, gene expression (e.g., gene silencing), or cellular signaling. Typically, the effector moiety included by the conjugate exerts its therapeutic effect (e.g., toxic, enzymatic inhibition, gene silencing, etc.) in the cytosol and / or cell nucleus. Typically, the effector moiety is delivered intracellularly within endosomes and / or lysosomes, and typically, the effector moiety is active after leaving or escaping the endosomal-lysosomal pathway. Within the saponin components disclosed herein, the saponin is not considered either an effector molecule or an effector moiety within the saponin components disclosed herein. Therefore, in saponin components containing a saponin, the saponin is not an effector moiety, and in effector components containing an effector moiety, the effector moiety is a different molecule from the conjugated saponin. In relation to the saponin components disclosed herein, the term saponin refers to a saponin that, when present in the endosomes and / or lysosomes of mammalian cells, such as human cells, is included by the effector components disclosed herein and exerts endosomal / lysosome evacuation-enhancing activity toward the effector portion present together with the saponin in the endosome / lysosome.

[0054] As used herein, the terms “nucleic acid” and “polynucleotide” are synonymous with each other and refer to any polymer molecule that is at least a nucleic acid base (or simply “base,” such as a standard nucleic acid base like adenine (A), cytosine (C), guanine (G), thymine (T), or uracil (U), or any known non-standard, modified, or synthetic nucleic acid base like 5-methylcytosine, 5-hydroxymethylcytosine, xanthine, hypoxanthine, 7-methylguanine, 5,6-dihydrouracil, etc.) or functionally equivalent thereto. It should be interpreted that this includes polymer molecules made up of naturally occurring nucleic acids such as deoxyribonucleic acid (DNA) or ribonucleic acid (RNA) (these naturally occurring nucleic acids should be understood as polymer molecules made up of units called nucleotides, where each nucleotide consists of a pentose sugar, a phosphate group, and one nucleic acid base) and equivalents that give the polymer molecules the ability to associate with such polymer molecules by hydrogen bond-based nucleic acid base pairing (such as Watson-Crick base pairing) under appropriate hybridization conditions.

[0055] Therefore, from a chemical standpoint, the term nucleic acid, as defined herein, can be interpreted to encompass polymer molecules that are chemically DNA or RNA, as well as polymer molecules that are nucleic acid analogs, also known as xeno nucleic acids (XNAs) or artificial nucleic acids, in which one or more (or all) units are modified nucleotides or functional equivalents of nucleotides. Nucleic acid analogs are well known in the art and are widely used in research and medicine due to various properties, including improved specificity and / or affinity, higher binding strength to their targets, and / or increased in vivo stability. Typical examples of nucleic acid analogs include, but are not limited to, locked nucleic acids (LNA) (also known as cross-linked nucleic acids (BNA)), phosphorodiamidate morpholino oligomers (PMO, also known as morpholino), peptide nucleic acids (PNA), glycol nucleic acids (GNA), threose nucleic acids (TNA), hexitol nucleic acids (HNA), 2'-deoxy-2'-fluoroarabino nucleic acids (FANA or FNA), 2'-deoxy-2'-fluororibonucleic acid (2'-F RNA or FRNA), althritol nucleic acids (ANA), and cyclohexene nucleic acids (CeNA).

[0056] In accordance with the foregoing, in some cases the nucleic acids of this disclosure may be modified. For example, nucleic acids may be modified on their backbone. Examples of modifications that may be carried out on the backbone of nucleic acids include, but are not limited to, phosphorothioates (PS), boranophosphates, phosphonoacate (PACE), morpholine, peptide nucleic acid backbone modifications (PNA), and amide-linked bases. Nucleic acids may also be modified on the sugar moiety and / or the base moiety. Examples of modifications that can be carried out on sugar and / or base moieties include locked nucleic acids (LNA), phosphoramidates (NP), 2'F-RNA, 2'-O-methoxymethyl (2'MOE), 2'O-methyl (2'OMe), 2'-O-fluoro(2'-F)5-bromouracil, 5-iodouracil, 5-methylcytosine, ethylene-crosslinked nucleic acids (ENA), diaminopurines, 2-thiouracil, 4-thiouracil, pseudouracil, hypoxanthine, 2-aminoadenine, 6-methyladenine, and guanine or adenine. Other alkyl derivatives of adenine and guanine, 2-propyladenine and guanine and other derivatives of adenine and guanine, 6-azo-uracil, 8-halo, 8-amino, 8-thiol, 8-hydroxyk and other 8-substituted adenine and guanine, restricted ethyl sugar moieties (cET), ribofuranosyl, 2'-0,4'-C-methylene and 2'-0,4'-C-ethylene bicyclic nucleotide analogs, acyclic nucleotides (UNA and PNA), and dihydrouridine modifications are not limited to these. Other modifications that can be performed on nucleic acids include, but are not limited to, modifications involving deoxyribonucleotide bases incorporated into the ribonucleotide sequence. The incorporation may be limited to overhangs in a standard siRNA structure or may be distributed within the sequence. Modifications to RNA molecules include, but are not limited to, blunt-terminated siRNA, 25-27 mer siRNA, single-stranded siRNA, short hairpin siRNA, dumbbell siRNA, asymmetric siRNA, short-spacing siRNA, and hybrids between siRNA and antisense oligonucleotides (ASOs). Other nucleic acid analogs may be considered, including those with a non-ribose backbone. In addition, naturally occurring nucleic acids, analogs, and mixtures of both can be produced.Nucleic acids include, but are not limited to, DNA, RNA, and hybrids. In hybrids, the nucleic acid contains any combination of deoxyribonucleotides and ribonucleotides, as well as any combination of bases, including uracil, adenine, thymine, cytosine, guanine, inosine, xatanine, hypoxatanine, isocytosine, isoguanine, 5-methylcytidine, and pseudouridine. Modified 5' cap structures, such as 3'-O-Me-m7G(5')ppp(5')G (anti-reverse cap analog), may also be used to enhance mRNA translation. Nucleic acids include any form of DNA, any form of RNA including triple-stranded, double-stranded, or single-stranded RNA, antisense, siRNA, ribozymes, deoxyribozymes, polynucleotides, oligonucleotides, chimeras, and their derivatives.

[0057] In accordance with the rules, the length of a nucleic acid is expressed herein by the number of units that make up a single strand of nucleic acid. Since each unit corresponds to exactly one nucleic acid base that has the ability to associate in one base-pairing event, the length is often expressed in so-called “base pairs” or “bp,” whether the nucleic acid in question is a single-stranded (ss) nucleic acid or a double-stranded (ds) nucleic acid. In naturally occurring nucleic acids, 1 bp corresponds to 1 nucleotide, abbreviated as 1 nt. For example, a single-stranded nucleic acid made up of 1000 nucleotides (or a double-stranded nucleic acid made up of two complementary strands, each made up of 1000 nucleotides) is described as having a length of 1000 base pairs or 1000 bp, and this length may also be expressed as 1 kilobase, abbreviated as 1000 nt or 1 kb. 2 kilobases or 2 kb is equal to the length of 2000 base pairs, which is considered equivalent to a single-stranded RNA or DNA of 2000 nucleotides. However, in order to avoid confusion, and considering that nucleic acids as defined herein may contain or consist of units that are not only chemically nucleotides but also functional equivalents thereof, the length of nucleic acids shall, in this specification, be expressed preferentially by "bp" or "kb" rather than the equally common notation "nt" in the art.

[0058] In advantageous embodiments, the nucleic acid does not exceed 1 kb, preferably not exceeding 500 bp, and most preferably not exceeding 250 bp.

[0059] In particularly advantageous embodiments, nucleic acids are oligonucleotides (or simply oligos) defined as nucleic acids not exceeding 200 bp, that is, oligonucleotides which are any polymer molecules consisting of 200 units or less, where each unit contains a nucleic acid base or an equivalent functionally equivalent thereof, which gives the oligonucleotide the ability to associate with DNA or RNA by hydrogen bond-based nucleic acid base pairing under appropriate hybridization conditions. Within the scope of the above definition, it will be immediately apparent that oligonucleotides disclosed herein may contain or consist of units that are not only nucleotides but also synthetic equivalents thereof. In other words, from a chemical standpoint, the term oligonucleotide as used herein is to be interpreted as including or potentially consisting of RNA, DNA or nucleic acid analogs, but not limited to LNA (BNA), PMO (morpholino), PNA, GNA, TNA, HNA, FANA, FRNA, ANA, CeNA, etc.

[0060] The term "proteinic" has its usual scientific meaning and, as used herein, refers to a molecule that is protein-like (meaning the molecule possesses the physicochemical properties of a protein to some extent), of a protein, relating to a protein, containing a protein, belonging to a protein, consisting of a protein, similar to a protein, or being a protein. The term "proteinic," when used, for example, in "proteinic molecule," refers to the presence of at least a portion of a molecule that is similar to a protein or is a protein, and "protein" should be understood to include a chain of amino acid residues of at least two residue lengths, and therefore includes peptides, polypeptides and proteins, as well as aggregates of protein or protein domains. In a proteinic molecule, at least two amino acid residues are linked by an amide bond, such as a peptide bond. In a proteinic molecule, the amino acid residues are native amino acid residues and / or artificial amino acid residues, such as modified native amino acid residues. In a preferred embodiment, a proteinic molecule is a molecule containing at least two amino acid residues, preferably 2 to about 2,000 amino acid residues. In one embodiment, a proteinic molecule is a molecule containing 2 to 20 (typical of peptides) amino acids. In one embodiment, the protein molecule is a molecule containing 21 to 1,000 amino acids (typical for polypeptides, proteins, protein domains, etc., ligands for receptors such as antibodies, Fab, scFv, and EGF). Preferably, the amino acid residues are linked (typically) by peptide bonds. As disclosed herein, the amino acid residues are or include (modified) (non)natural amino acid residues.

[0061] As used herein, the term “antibody or its binding fragment or its binding domain” refers to a polypeptide comprising at least one immunoglobulin variable domain or at least one antigenic determinant, such as a paratope that specifically binds to an antigen. In some embodiments, the antibody is a full-length antibody. In some embodiments, the antibody is a chimeric antibody. In some embodiments, the antibody is a humanized antibody. However, in some embodiments, the antibody is a Fab fragment, an F(ab') fragment, an F(ab')2 fragment, an Fv fragment, or an scFv fragment. In some embodiments, the antibody is a nanobody derived from a camelid antibody or a nanobody derived from a shark antibody. In some embodiments, the antibody is a diabody. In some embodiments, the antibody comprises a framework having a human germline sequence. In another embodiment, the antibody comprises a heavy chain constant domain selected from the group consisting of IgG, IgG1, IgG2, IgG2A, IgG2B, IgG2C, IgG3, IgG4, IgAl, IgA2, IgD, IgM, and IgE constant domains. In some embodiments, the antibody includes a heavy (H) chain variable region (abbreviated herein as VH) and / or (e.g., and) a light (L) chain variable region (abbreviated herein as VL). In some embodiments, the antibody includes a constant domain, e.g., an Fc region. An immunoglobulin constant domain refers to a heavy chain or light chain constant domain. The amino acid sequences and functional variations of human IgG heavy chains and light chain constant domains are known. With respect to the heavy chain, in some embodiments, the heavy chain of the antibody described herein may be an alpha (a), delta (D), epsilon (e), gamma (g), or mu (m) heavy chain. In some embodiments, the heavy chain of the antibody described herein may include a human alpha (a), delta (D), epsilon (e), gamma (g), or mu (m) heavy chain. In certain embodiments, the antibody described herein includes human gamma-1 CHI, CH2, and / or (e.g., and) CH3 domains. In some embodiments, the amino acid sequence of the VH domain includes the amino acid sequence of the human gamma(g) heavy chain constant region, such as any known in the art.Non-limiting examples of human constant region sequences are described in the Art, see, for example, U.S. Patent No. 5,693,780 and Kabat EA et al, (1991), cited above. In some embodiments, the VH domain contains an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, or at least 99% identical to any of the variable chain constant regions provided herein. In some embodiments, the antibody is modified, for example by glycosylation, phosphorylation, SUMOylation, and / or (e.g., and) methylation. In some embodiments, the antibody is a glycosylated antibody conjugated to one or more sugar or carbohydrate molecules. In some embodiments, one or more sugar or carbohydrate molecules are conjugated to the antibody by N-glycosylation, O-glycosylation, C-glycosylation, glycialysis (GPI anchor attachment), and / or (e.g., and) phosphoglycosylation. In some embodiments, one or more sugar or carbohydrate molecules are monosaccharides, disaccharides, oligosaccharides, or glycans. In some embodiments, one or more sugar or carbohydrate molecules are branched oligosaccharides or branched glycans. In some embodiments, one or more sugar or carbohydrate molecules include mannose units, glucose units, N-acetylglucosamine units, N-acetylgalactosamine units, galactose units, fucose units, or phospholipid units. In some embodiments, the antibody is a construct comprising polypeptides containing one or more antigen-binding fragments of the Disclosure linked to a linker polypeptide or an immunoglobulin constant domain. The linker polypeptide comprises two or more amino acid residues linked by peptide bonds and is used to link one or more antigen-binding moieties. Examples of linker polypeptides have been reported (see, for example, Holliger, P, et al. (1993) Proc. Natl. Acad. Sci. USA 90:6444-6448; Poljak, RJ, et al. (1994) Structure 2:1121-1123).Furthermore, antibodies may be part of larger immunoadhesion molecules formed by the covalent or noncovalent association of an antibody or antibody moiety with one or more other proteins or peptides. Examples of such immunoadhesion molecules include the creation of tetrameric scFv molecules using streptavidin core regions (Kipriyanov, SM, et al. (1995) Human Antibodies and Hybridomas 6:93-101) and the creation of divalent biotinylated scFv molecules using cysteine ​​residues, marker peptides, and C-terminal polyhistidine tags (Kipriyanov, SM, et al. (1994) Mol.Immunol.31:1047-1058).

[0062] The terms “single-domain antibody,” or abbreviated as “sdAb,” or “nanobody” have their usual scientific meanings and, as used herein, refer to an antibody fragment consisting of a single monomer variable antibody domain unless it is referred to as two or more monomer variable antibody domains, such as, for example, a bivalent sdAb containing two such monomer variable antibody domains in tandem. A bivalent nanobody is a molecule containing two single-domain antibodies that target an epitope on a molecule located outside the cell, such as an epitope on the extracellular domain of a cell surface molecule present on the cell. Preferably, the cell surface molecule is a cell surface receptor. A bivalent nanobody may also be called a bivalent single-domain antibody. Preferably, these two different single-domain antibodies are covalently bound directly or covalently bound through an intermediate molecule that covalently binds to the two different single-domain antibodies. Preferably, the intermediate molecule of the divalent nanobody has a molecular weight of less than 10,000 daltons, more preferably less than 5,000 daltons, even more preferably less than 2,000 daltons, and most preferably less than 1,500 daltons.

[0063] The term "GalNAc" has its usual scientific meaning and, as used herein, refers to N-acetylgalactosamine and its IUPAC name: 2-(acetylamino)-2-deoxy-D-galactose.

[0064] As used herein, the term “covalently linked” means that two or more molecules are linked together by at least one covalent bond, i.e., directly, or via a chain of covalent bonds, i.e., via a linker containing at least one atom.

[0065] As used herein, the term “part” typically refers to a molecule that is bound, linked, or conjugated to a further molecule, linker, molecular aggregate, etc., thereby forming a larger molecule, conjugate, or molecular aggregate. Typically, a part is a first molecule covalently linked to a second molecule (second part), and includes one or more chemical groups initially present on the first and second molecules. For example, when a saponin molecule is covalently linked to one or more GalNAc molecules via at least one linker, the saponin molecule is the saponin part in the formed saponin-GalNAc conjugate, and the GalNAc molecules are the part / parts in the conjugate. For example, a nucleic acid, such as an antisense oligonucleotide conjugated to an endocytosis receptor-binding ligand such as an antibody or one or more GalNAc molecules, is the nucleic acid part in the nucleic acid-GalNAc conjugate.

[0066] As used herein, the terms “approximately” or “about” mean, when applied to one or more target values, values ​​similar to the specified reference values. In certain embodiments, unless otherwise specified or otherwise evident from the context, the terms “approximately” or “about” mean a range of values ​​that are within the range of 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or less in any direction from the specified reference value (unless such figures would exceed 100% of the possible values).

[0067] The terms first, second, third, etc., used herein and in the claims are used, for example, to distinguish between similar elements, compositions, components in a composition, or distinct method steps, and are not necessarily used to describe a sequential or chronological order. These terms are interchangeable in appropriate circumstances, and the embodiments disclosed herein may function in any order other than those described or illustrated herein, unless otherwise specified.

[0068] The term “including” as used in the claims should not be construed to be limited, for example, to any element or process or component of a particular composition that is subsequently enumerated, and the term does not exclude other elements or processes or components in a particular composition. The term should be construed to specify the presence of a particular feature, complete, (process) process or component, but not to exclude the presence or addition of one or more other features, complete, processes or components or groups thereof. Accordingly, the scope of the expression “a method comprising processes A and B” should not be limited to a method comprising only processes A and B, but rather, with respect to this disclosure, it merely means that A and B are the only enumerated processes of that method, and furthermore, the claims should be construed to include equivalents of those processes. Accordingly, the scope of the expression “a composition comprising components A and B” should not be limited to a composition comprising only components A and B, but rather, with respect to this disclosure, it merely means that A and B are the only enumerated components of that composition, and furthermore, the claims should be construed to include equivalents of those components.

[0069] Furthermore, the use of the indefinite article "a" or "an" to refer to an element or component does not rule out the possibility of two or more elements or components existing, unless the context clearly requires that there is only one of that element or component. Therefore, the indefinite article "a" or "an" usually means "at least one."

[0070] Except for chemical and / or mathematical formulas, the use of terms in parentheses in the text generally means that the terms in parentheses specify possible options or possible meanings, and therefore should not be considered restrictive.

[0071] The embodiments described herein can work together in combination unless otherwise specified. Furthermore, various embodiments are referred to as “preferred,” “for example,” “as an example,” or “particularly,” but these are not limiting and should be interpreted as exemplary ways in which the concepts disclosed herein can be carried out.

[0072] For all figures, "Figure" and "Fig." refer to the same thing.

[0073] As used herein, the term “endocytosis receptor” should be understood as either a receptor or a cell surface molecule, such as a transporter, whose specific ligand is accessible from the outside or surface of the cell membrane (also known as the plasmalemma) and which has the ability to undergo internalization via the endocytosis pathway upon external stimulation, such as ligand binding to the receptor. In some embodiments, the endocytosis receptor may be internalized by clathrin-mediated endocytosis, but may also be internalized by clathrin-independent pathways, such as phagocytosis, macropinocytosis, caveolae-mediated and raft-mediated uptake, or constitutive clathrin-independent endocytosis. In some embodiments, the endocytosis receptor comprises an intracellular domain, a transmembrane domain, and / or an extracellular domain that may further optionally include a ligand-binding domain. In some embodiments, the endocytosis receptor becomes internalized by the cell after ligand binding. In some embodiments, the ligand may be a specific cell targeting agent, such as a native ligand (or a synthetic fragment thereof) or an antibody or a binding fragment thereof.

[0074] As used herein, the term “ligand” should be understood as any molecule that binds to or can be recognized by a receptor. Typical ligands may be antibodies, antibody-bound fragments, or simply antibody fragments. Alternatively, typical ligands may be proteins, peptides, polysugars, glycoproteins, or fragments of any one of these, which can be recognized by endocytosis receptors.

[0075] As used herein, the term “covalently linked” means that two or more molecules are linked together by at least one covalent bond, i.e., directly, or via a chain of covalent bonds, i.e., via a linker containing at least one atom.

[0076] The term “antibody-oligonucleotide conjugate” or “AOC” has its usual scientific meaning, and as used herein, it refers to IgG, Fab, scFv, immunoglobulin, immunoglobulin fragment, one or more V H Domain, single-domain antibody, V HH Camelidae V H This refers to any polynucleotide (oligonucleotide) molecule that can exert a therapeutic effect when it comes into contact with target cells such as those of a human patient, including any conjugate of antibodies such as BNA, antisense oligonucleotides (ASO, AON), short-chain or small interfering RNA (siRNA, silencing RNA), antisense DNA, antisense RNA, etc., and oligonucleotides selected from a sequence of natural or synthetic nucleic acids, including single-stranded or double-stranded molecules such as DNA, modified DNA, RNA, mRNA, modified RNA, and synthetic nucleic acids.

[0077] As used herein, the term "subject" refers to a person who is suffering from or at risk of suffering from a specific health-related disorder, such as a disease or other pathological condition. The terms "subject" and "patient" are used interchangeably herein.

[0078] As used herein, the term “treatment” has its traditional meaning and refers to a medical intervention or management of an object intended to cure, improve, stabilize or prevent a health-related disorder, such as an eye disorder. This term “treatment” includes, for example, active treatment, which is certain actions specifically directed toward the improvement of a health-related disorder, and causal treatment, which is treatment directed toward the removal of the cause associated with the health-related disorder. As used herein, the term “prevention” means a medical intervention or management of an object intended to maintain health or normal bodily function. As used herein, prevention should be interpreted as falling within the scope of treatment unless otherwise indicated.

[0079] As used herein, the term “ocular disorder” should be interpreted broadly to mean any health-related disorder of the eye that affects, in particular, the vision of the subject or the comfort of at least one of the eyes of the subject. Typically, the term “ocular disorder” refers to an ocular disease or pathological condition relating to at least one of the eyes of the subject.

[0080] Similarly, as used herein, the term “CNS disorder” should be broadly interpreted to refer to any health-related disorder of the CNS, particularly those involving changes in the brain and / or spinal cord. Typically, the term “CNS disorder” refers to a neurological disorder or pathological condition relating to at least a portion of the brain or spinal cord in question.

[0081] As used herein, the term “administer” should be interpreted as referring to a method of providing a substance, such as a compound, or a pharmaceutical composition, to a subject. Conversely, as used herein, the term “delivery” should be interpreted as referring to a method of reaching its target site, a specific zone, cell, or tissue type, such as the retina of the eye. For example, as used herein, administration may relate to a method of providing a compound into the body of a subject by intended delivery, such as intrathecal, intravenous, topical, intranasal, intraocular, etc., to the cerebellum or retina as the target site. Generally, the terms “administering” or “dosing” would be interpreted as relating to providing a substance that is physiologically and / or pharmacologically useful (for example, to treat a disease of the subject).

[0082] As used herein, the term “carrier” has its conventional meaning and refers to a pharmaceutically acceptable diluent, adjuvant, excipient, or vehicle to which a pharmaceutically active ingredient is administered together.

[0083] As used herein, the term “excipient” has its conventional meaning and refers to a pharmaceutically acceptable component commonly used in pharmaceutical techniques for preparing granular, solid, or liquid oral formulations. [Brief explanation of the drawing]

[0084] [Figure 1] Local co-administration of saponin components with ASO compounds in the CNS: Compared to controls (saponin component only and vehicle group), this study describes the enhancement of in vivo efficacy and effects in various brain regions near or surrounding the injection site by intraventricular administration of either 10 μg of Malat1 ASO or 3 μg of Malat1 ASO, or by co-administration of 3 μg of Malat1 ASO with a saponin component (SO1861 in this case) into the right ventricle. All data are presented as mean ± SEM, n=3. Two-way ANOVA, Tukey's post-hoc comparison: *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. [Figure 2A]This is the specificity of the enhancement of ASO compounds by co-administration of saponin components, as measured by Malat1 RNA knockdown in nerve cells. (A) Titration of Malat1 ASO with and without co-administration of a fixed amount of triterpenoid saponin component (SO1861 here as an example of a pentacyclic 12,13-dehydrooleanane type saponin) compared with steroid(like) saponins / molecular digitonin, tomatine, or digoxin; (B) Titration of terpenoid saponin component (SO1861) compared with steroid(like) saponins / molecular digitonin, digoxin, glycyrrhizin, and tomatine when co-administered with a fixed amount of 200 nM ASO. [Figure 2B] This is the specificity of the enhancement of ASO compounds by co-administration of saponin components, as measured by Malat1 RNA knockdown in nerve cells. (A) Titration of Malat1 ASO with and without co-administration of a fixed amount of triterpenoid saponin component (SO1861 here as an example of a pentacyclic 12,13-dehydrooleanane type saponin) compared with steroid(like) saponins / molecular digitonin, tomatine, or digoxin; (B) Titration of terpenoid saponin component (SO1861) compared with steroid(like) saponins / molecular digitonin, digoxin, glycyrrhizin, and tomatine when co-administered with a fixed amount of 200 nM ASO. [Figure 3] Compared to Malat1 ASO alone, this provides improved efficacy of a saponin component containing a payload (ASO-saponin) for delivery in nerve cells, obtained by covalent conjugation of the saponin molecule SO1861 to the payload Malat1 ASO, providing the saponin component ASO-saponin (Malat1-ASO-SC-SO1861). [Figure 4]This describes the improved efficacy of PMO targeting the CNS disease-associated gene Sod1 with a saponin component (here, 3 μM SO1861-SC-Mal) in nerve cells. The efficacy of PMO is measured by the increase in abnormal transcripts (leading to mRNA degradation) upon co-administration of a fixed amount of the saponin component alone. [Figure 5] This is an in vivo evaluation of the tolerability and efficacy of saponin (SO1861), a saponin component with or without an LNA payload, in the eye after topical intravitreal co-administration, assessed by corneal thickness of the treated eye (right, OD). [Figure 6A] This involves the enhancement of STAT3 mRNA reduction by co-administration of saponin components with PMOs or ASOs (which have different mechanisms of action) in targeted, conjugated, or free forms. (A) Regulation of STAT3 expression in nerve cells by co-administration of the saponin component saponin (3 μM SO1861-SC-Mal) and STAT3_ST6 PMO (exon skipping that results in an immature stop codon and therefore a reduction in STAT3 mRNA). [Figure 6B] (B) Regulation of STAT3 expression by either free STAT3_ST6 PMO (with or without co-administration of the saponin component saponin (SO1861-SC-Mal)) or an antibody-targeted PMO-SO1861-conjugate, based on conjugation of SO1861-SC (cetuximab (Cet-SO1861-STAT3_ST6 PMO)) in A431 cells, [Figure 6C] (C) Regulation of STAT3 expression by co-administration of different (targeted and untargeted) saponin components (saponin (SO1861), saponin (1) (SO1861-AH-blocked), saponin (2) (conjugated SO1861-AH)) and RNA-degradable STAT3 mRNA-targeted ASO (ribonuclease H-mediated RNA degradation). [Figure 6D](D) Regulation of STAT3 expression by splice switching of PMO (STAT3_ST2) that leads to an increase in STAT3β isoforms: The added PMO is either in free form (STAT3-ST2) or in targeted ligand conjugate form (Cet-STAT3_ST2 PMO) with or without co-administration of the saponin component saponin (SO1861-SC-Mal), or in antibody-targeted PMO-SO1861-conjugate in A431 cells (the saponin component is Cet-saponin-STAT3_ST2 PMO, and the saponin is SO1861). [Figure 7A] The study involved enhancing the efficacy of siRNA in human brain tissue-derived cells (U87, isolated from malignant gliomas) with co-administration of the saponin component (1.3 μM SO1861). The study also examined the efficacy of (A) AHA1 siRNA in combination with the saponin component (1.3 μM SO1861), as measured at the RNA level, and [Figure 7B] (B) The effectiveness of MMP14 siRNA (including chemically modified variants to improve stability against siRNA degradation). [Figure 8] This describes the synthesis and chemical structure of SO1861-SC-azide. [Figure 9A] This shows the synthesis and chemical structure of GN3-SC-SO1861. [Figure 9B] This shows the synthesis and chemical structure of GN3-SC-SO1861. [Figure 10A] The study focused on enhancing efficacy by co-administering targeted saponin components and targeted siRNA in vivo: efficacy and duration of effect (reduction of serum TTR protein) of co-administration of the saponin component (GN3-SC-SO1861) and oligonucleotide, in this case GN3-siTTR. GN3-siTTR was always administered on day 0, and the saponin component was administered at the time indicated by the arrow. All groups except the vehicle (n=3) consisted of n=6 mice, and mean serum TTR levels ± SD are shown. (A) GN3-siTTR was administered together with the saponin component on day 0. [Figure 10B] (B) GN3-siTTR was administered on day 0, and the saponin component was administered on day 7 (arrow). [Figure 10C] (C)GN3-siTTR was administered on day 0, and the saponin component was administered on day 28 (arrow). [Figure 11] This is the structure of a trivalent GalNAc oligonucleotide, such as trivalent GalNAc-siRNA (also called GN3-siRNA, or in certain cases, GN3-siTTR). [Figure 12A] This study describes the enhancement of in vivo efficacy in the CNS by local co-administration of (targeted) ASO compounds and saponin components: analysis of Malat1 expression in the brainstem (A), striatum (B), thalamus (C), right cerebral cortex (D), left cerebral cortex (E), right hippocampus (F), left hippocampus (G), cerebellum (H), and all other brain regions (I) upon administration of the vehicle (DPBS, group A), Malat1 ASO with co-administration of the saponin component (group B), saponin component alone (group C), 1-component Malat1 ASO-saponin (group D + group E), targeted aCD71-Malat1 ASO alone (group F), or aCD71-Malat1 ASO with co-administration of the saponin component (group G) via right ventricular administration. In this example, the saponin component is SO1861-SC-Mal, the saponin component Malat1 ASO-saponin contains saponin SO1861, and the saponin component saponin(1) is SO1861. All data are shown as mean ± SEM, n=3 (or n=2 for treatment group D). One-way ANOVA, Tukey's post-hoc comparison: *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. [Figure 12B]This study describes the enhancement of in vivo efficacy in the CNS by local co-administration of (targeted) ASO compounds and saponin components: analysis of Malat1 expression in the brainstem (A), striatum (B), thalamus (C), right cerebral cortex (D), left cerebral cortex (E), right hippocampus (F), left hippocampus (G), cerebellum (H), and all other brain regions (I) upon administration of the vehicle (DPBS, group A), Malat1 ASO with co-administration of the saponin component (group B), saponin component alone (group C), 1-component Malat1 ASO-saponin (group D + group E), targeted aCD71-Malat1 ASO alone (group F), or aCD71-Malat1 ASO with co-administration of the saponin component (group G) via right ventricular administration. In this example, the saponin component is SO1861-SC-Mal, the saponin component Malat1 ASO-saponin contains saponin SO1861, and the saponin component saponin(1) is SO1861. All data are shown as mean ± SEM, n=3 (or n=2 for treatment group D). One-way ANOVA, Tukey's post-hoc comparison: *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. [Figure 12C]This study describes the enhancement of in vivo efficacy in the CNS by local co-administration of (targeted) ASO compounds and saponin components: analysis of Malat1 expression in the brainstem (A), striatum (B), thalamus (C), right cerebral cortex (D), left cerebral cortex (E), right hippocampus (F), left hippocampus (G), cerebellum (H), and all other brain regions (I) upon administration of the vehicle (DPBS, group A), Malat1 ASO with co-administration of the saponin component (group B), saponin component alone (group C), 1-component Malat1 ASO-saponin (group D + group E), targeted aCD71-Malat1 ASO alone (group F), or aCD71-Malat1 ASO with co-administration of the saponin component (group G) via right ventricular administration. In this example, the saponin component is SO1861-SC-Mal, the saponin component Malat1 ASO-saponin contains saponin SO1861, and the saponin component saponin(1) is SO1861. All data are shown as mean ± SEM, n=3 (or n=2 for treatment group D). One-way ANOVA, Tukey's post-hoc comparison: *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. [Figure 12D]This study describes the enhancement of in vivo efficacy in the CNS by local co-administration of (targeted) ASO compounds and saponin components: analysis of Malat1 expression in the brainstem (A), striatum (B), thalamus (C), right cerebral cortex (D), left cerebral cortex (E), right hippocampus (F), left hippocampus (G), cerebellum (H), and all other brain regions (I) upon administration of the vehicle (DPBS, group A), Malat1 ASO with co-administration of the saponin component (group B), saponin component alone (group C), 1-component Malat1 ASO-saponin (group D + group E), targeted aCD71-Malat1 ASO alone (group F), or aCD71-Malat1 ASO with co-administration of the saponin component (group G) via right ventricular administration. In this example, the saponin component is SO1861-SC-Mal, the saponin component Malat1 ASO-saponin contains saponin SO1861, and the saponin component saponin(1) is SO1861. All data are shown as mean ± SEM, n=3 (or n=2 for treatment group D). One-way ANOVA, Tukey's post-hoc comparison: *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. [Figure 12E]This study describes the enhancement of in vivo efficacy in the CNS by local co-administration of (targeted) ASO compounds and saponin components: analysis of Malat1 expression in the brainstem (A), striatum (B), thalamus (C), right cerebral cortex (D), left cerebral cortex (E), right hippocampus (F), left hippocampus (G), cerebellum (H), and all other brain regions (I) upon administration of the vehicle (DPBS, group A), Malat1 ASO with co-administration of the saponin component (group B), saponin component alone (group C), 1-component Malat1 ASO-saponin (group D + group E), targeted aCD71-Malat1 ASO alone (group F), or aCD71-Malat1 ASO with co-administration of the saponin component (group G) via right ventricular administration. In this example, the saponin component is SO1861-SC-Mal, the saponin component Malat1 ASO-saponin contains saponin SO1861, and the saponin component saponin(1) is SO1861. All data are shown as mean ± SEM, n=3 (or n=2 for treatment group D). One-way ANOVA, Tukey's post-hoc comparison: *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. [Figure 12F]This study describes the enhancement of in vivo efficacy in the CNS by local co-administration of (targeted) ASO compounds and saponin components: analysis of Malat1 expression in the brainstem (A), striatum (B), thalamus (C), right cerebral cortex (D), left cerebral cortex (E), right hippocampus (F), left hippocampus (G), cerebellum (H), and all other brain regions (I) upon administration of the vehicle (DPBS, group A), Malat1 ASO with co-administration of the saponin component (group B), saponin component alone (group C), 1-component Malat1 ASO-saponin (group D + group E), targeted aCD71-Malat1 ASO alone (group F), or aCD71-Malat1 ASO with co-administration of the saponin component (group G) via right ventricular administration. In this example, the saponin component is SO1861-SC-Mal, the saponin component Malat1 ASO-saponin contains saponin SO1861, and the saponin component saponin(1) is SO1861. All data are shown as mean ± SEM, n=3 (or n=2 for treatment group D). One-way ANOVA, Tukey's post-hoc comparison: *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. [Figure 12G]This study describes the enhancement of in vivo efficacy in the CNS by local co-administration of (targeted) ASO compounds and saponin components: analysis of Malat1 expression in the brainstem (A), striatum (B), thalamus (C), right cerebral cortex (D), left cerebral cortex (E), right hippocampus (F), left hippocampus (G), cerebellum (H), and all other brain regions (I) upon administration of the vehicle (DPBS, group A), Malat1 ASO with co-administration of the saponin component (group B), saponin component alone (group C), 1-component Malat1 ASO-saponin (group D + group E), targeted aCD71-Malat1 ASO alone (group F), or aCD71-Malat1 ASO with co-administration of the saponin component (group G) via right ventricular administration. In this example, the saponin component is SO1861-SC-Mal, the saponin component Malat1 ASO-saponin contains saponin SO1861, and the saponin component saponin(1) is SO1861. All data are shown as mean ± SEM, n=3 (or n=2 for treatment group D). One-way ANOVA, Tukey's post-hoc comparison: *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. [Figure 12H]This study describes the enhancement of in vivo efficacy in the CNS by local co-administration of (targeted) ASO compounds and saponin components: analysis of Malat1 expression in the brainstem (A), striatum (B), thalamus (C), right cerebral cortex (D), left cerebral cortex (E), right hippocampus (F), left hippocampus (G), cerebellum (H), and all other brain regions (I) upon administration of the vehicle (DPBS, group A), Malat1 ASO with co-administration of the saponin component (group B), saponin component alone (group C), 1-component Malat1 ASO-saponin (group D + group E), targeted aCD71-Malat1 ASO alone (group F), or aCD71-Malat1 ASO with co-administration of the saponin component (group G) via right ventricular administration. In this example, the saponin component is SO1861-SC-Mal, the saponin component Malat1 ASO-saponin contains saponin SO1861, and the saponin component saponin(1) is SO1861. All data are shown as mean ± SEM, n=3 (or n=2 for treatment group D). One-way ANOVA, Tukey's post-hoc comparison: *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. [Figure 12I]This study describes the enhancement of in vivo efficacy in the CNS by local co-administration of (targeted) ASO compounds and saponin components: analysis of Malat1 expression in the brainstem (A), striatum (B), thalamus (C), right cerebral cortex (D), left cerebral cortex (E), right hippocampus (F), left hippocampus (G), cerebellum (H), and all other brain regions (I) upon administration of the vehicle (DPBS, group A), Malat1 ASO with co-administration of the saponin component (group B), saponin component alone (group C), 1-component Malat1 ASO-saponin (group D + group E), targeted aCD71-Malat1 ASO alone (group F), or aCD71-Malat1 ASO with co-administration of the saponin component (group G) via right ventricular administration. In this example, the saponin component is SO1861-SC-Mal, the saponin component Malat1 ASO-saponin contains saponin SO1861, and the saponin component saponin(1) is SO1861. All data are shown as mean ± SEM, n=3 (or n=2 for treatment group D). One-way ANOVA, Tukey's post-hoc comparison: *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. [Figure 13] Figure 12 summarizes the Malat1 expression analysis. It shows the relative expression of Malat1 in various brain regions compared to the vehicle after local co-administration of a saponin component and a (targeted) ASO compound, and is selected based on the efficacy of treatment group B. The saponin of the saponin component is SO1861-SC-Mal, and in this example, the Malat1 ASO-saponin of the saponin component contains the saponin SO1861, and the saponin (1) of the saponin component is SO1861. [Figure 14A]This study describes the enhancement of in vivo efficacy in the CNS by local co-administration of a saponin component with a (targeted) PMO compound: Sod1 expression analysis upon intracerebroventricular administration of a vehicle (DPBS, group A), saponin component alone (group C), SOD1 PMO alone (group H) or SOD1 PMO with co-administration of a saponin component (group I), targeted aCD71-SOD1 PMO alone (group J) or aCD71-SOD1 PMO with co-administration of a saponin component (group K) in the brainstem (A), striatum (B), thalamus (C), right cerebral cortex (D), left cerebral cortex (E), right hippocampus (F), left hippocampus (G), cerebellum (H) and all other brain regions (I). In this example, the saponin component is SO1861-SC-Mal, and the saponin component (1) is SO1861. All data are presented as mean ± SEM, n=3. One-way ANOVA, Tukey's post-hoc comparison: *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. [Figure 14B] This study describes the enhancement of in vivo efficacy in the CNS by local co-administration of a saponin component with a (targeted) PMO compound: Sod1 expression analysis upon intracerebroventricular administration of a vehicle (DPBS, group A), saponin component alone (group C), SOD1 PMO alone (group H) or SOD1 PMO with co-administration of a saponin component (group I), targeted aCD71-SOD1 PMO alone (group J) or aCD71-SOD1 PMO with co-administration of a saponin component (group K) in the brainstem (A), striatum (B), thalamus (C), right cerebral cortex (D), left cerebral cortex (E), right hippocampus (F), left hippocampus (G), cerebellum (H) and all other brain regions (I). In this example, the saponin component is SO1861-SC-Mal, and the saponin component (1) is SO1861. All data are presented as mean ± SEM, n=3. One-way ANOVA, Tukey's post-hoc comparison: *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. [Figure 14C]This study describes the enhancement of in vivo efficacy in the CNS by local co-administration of a saponin component with a (targeted) PMO compound: Sod1 expression analysis upon intracerebroventricular administration of a vehicle (DPBS, group A), saponin component alone (group C), SOD1 PMO alone (group H) or SOD1 PMO with co-administration of a saponin component (group I), targeted aCD71-SOD1 PMO alone (group J) or aCD71-SOD1 PMO with co-administration of a saponin component (group K) in the brainstem (A), striatum (B), thalamus (C), right cerebral cortex (D), left cerebral cortex (E), right hippocampus (F), left hippocampus (G), cerebellum (H) and all other brain regions (I). In this example, the saponin component is SO1861-SC-Mal, and the saponin component (1) is SO1861. All data are presented as mean ± SEM, n=3. One-way ANOVA, Tukey's post-hoc comparison: *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. [Figure 14D] This study describes the enhancement of in vivo efficacy in the CNS by local co-administration of a saponin component with a (targeted) PMO compound: Sod1 expression analysis upon intracerebroventricular administration of a vehicle (DPBS, group A), saponin component alone (group C), SOD1 PMO alone (group H) or SOD1 PMO with co-administration of a saponin component (group I), targeted aCD71-SOD1 PMO alone (group J) or aCD71-SOD1 PMO with co-administration of a saponin component (group K) in the brainstem (A), striatum (B), thalamus (C), right cerebral cortex (D), left cerebral cortex (E), right hippocampus (F), left hippocampus (G), cerebellum (H) and all other brain regions (I). In this example, the saponin component is SO1861-SC-Mal, and the saponin component (1) is SO1861. All data are presented as mean ± SEM, n=3. One-way ANOVA, Tukey's post-hoc comparison: *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. [Figure 14E]This study describes the enhancement of in vivo efficacy in the CNS by local co-administration of a saponin component with a (targeted) PMO compound: Sod1 expression analysis upon intracerebroventricular administration of a vehicle (DPBS, group A), saponin component alone (group C), SOD1 PMO alone (group H) or SOD1 PMO with co-administration of a saponin component (group I), targeted aCD71-SOD1 PMO alone (group J) or aCD71-SOD1 PMO with co-administration of a saponin component (group K) in the brainstem (A), striatum (B), thalamus (C), right cerebral cortex (D), left cerebral cortex (E), right hippocampus (F), left hippocampus (G), cerebellum (H) and all other brain regions (I). In this example, the saponin component is SO1861-SC-Mal, and the saponin component (1) is SO1861. All data are presented as mean ± SEM, n=3. One-way ANOVA, Tukey's post-hoc comparison: *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. [Figure 14F] This study describes the enhancement of in vivo efficacy in the CNS by local co-administration of a saponin component with a (targeted) PMO compound: Sod1 expression analysis upon intracerebroventricular administration of a vehicle (DPBS, group A), saponin component alone (group C), SOD1 PMO alone (group H) or SOD1 PMO with co-administration of a saponin component (group I), targeted aCD71-SOD1 PMO alone (group J) or aCD71-SOD1 PMO with co-administration of a saponin component (group K) in the brainstem (A), striatum (B), thalamus (C), right cerebral cortex (D), left cerebral cortex (E), right hippocampus (F), left hippocampus (G), cerebellum (H) and all other brain regions (I). In this example, the saponin component is SO1861-SC-Mal, and the saponin component (1) is SO1861. All data are presented as mean ± SEM, n=3. One-way ANOVA, Tukey's post-hoc comparison: *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. [Figure 14G]This study describes the enhancement of in vivo efficacy in the CNS by local co-administration of a saponin component with a (targeted) PMO compound: Sod1 expression analysis upon intracerebroventricular administration of a vehicle (DPBS, group A), saponin component alone (group C), SOD1 PMO alone (group H) or SOD1 PMO with co-administration of a saponin component (group I), targeted aCD71-SOD1 PMO alone (group J) or aCD71-SOD1 PMO with co-administration of a saponin component (group K) in the brainstem (A), striatum (B), thalamus (C), right cerebral cortex (D), left cerebral cortex (E), right hippocampus (F), left hippocampus (G), cerebellum (H) and all other brain regions (I). In this example, the saponin component is SO1861-SC-Mal, and the saponin component (1) is SO1861. All data are presented as mean ± SEM, n=3. One-way ANOVA, Tukey's post-hoc comparison: *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. [Figure 14H] This study describes the enhancement of in vivo efficacy in the CNS by local co-administration of a saponin component with a (targeted) PMO compound: Sod1 expression analysis upon intracerebroventricular administration of a vehicle (DPBS, group A), saponin component alone (group C), SOD1 PMO alone (group H) or SOD1 PMO with co-administration of a saponin component (group I), targeted aCD71-SOD1 PMO alone (group J) or aCD71-SOD1 PMO with co-administration of a saponin component (group K) in the brainstem (A), striatum (B), thalamus (C), right cerebral cortex (D), left cerebral cortex (E), right hippocampus (F), left hippocampus (G), cerebellum (H) and all other brain regions (I). In this example, the saponin component is SO1861-SC-Mal, and the saponin component (1) is SO1861. All data are presented as mean ± SEM, n=3. One-way ANOVA, Tukey's post-hoc comparison: *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. [Figure 14I]This study describes the enhancement of in vivo efficacy in the CNS by local co-administration of a saponin component with a (targeted) PMO compound: Sod1 expression analysis upon intracerebroventricular administration of a vehicle (DPBS, group A), saponin component alone (group C), SOD1 PMO alone (group H) or SOD1 PMO with co-administration of a saponin component (group I), targeted aCD71-SOD1 PMO alone (group J) or aCD71-SOD1 PMO with co-administration of a saponin component (group K) in the brainstem (A), striatum (B), thalamus (C), right cerebral cortex (D), left cerebral cortex (E), right hippocampus (F), left hippocampus (G), cerebellum (H) and all other brain regions (I). In this example, the saponin component is SO1861-SC-Mal, and the saponin component (1) is SO1861. All data are presented as mean ± SEM, n=3. One-way ANOVA, Tukey's post-hoc comparison: *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. [Figure 15] Figure 14 summarizes the Sod1 expression analysis. It shows the relative Sod1 expression in various brain regions compared to the vehicle after local co-administration of a saponin component and a (targeted) PMO compound, and treatment group K was selected based on its efficacy. The saponin of the saponin component is SO1861-SC-Mal, and in this example, saponin (1) of the saponin component is SO1861. [Figure 16A] Covalent conjugation of saponin components to the payload improves payload efficacy, and (A) Malat1 expression analysis in Neuro-2a cells treated with Malat1 ASO alone, conjugated Malat1 ASO-saponin (saponin component containing SO1861), or 400 nM saponin (1) (saponin component being SO1861-SC), [Figure 16B] (B) Analysis of Malat1 expression in Neuro-2a cells after titration treatment with Malat1 ASO alone, conjugated Malat1 ASO-saponin (saponin component containing SO1861), or unconjugated Malat1 ASO + saponin (1) (saponin component being SO1861-SC). [Figure 17A] When saponin components are administered co-administered with (targeted) ASO in nerve cells, they enhance mRNA reduction, and (A) regulation of MALAT1 expression by MALAT1 ASO or saponin components, saponin (1) and MALAT1 ASO administered co-administered at doses of 400 nM or 4 μM. [Figure 17B] (B) Regulation of MALAT1 expression by MALAT1 ASO or saponin (2) administered simultaneously with the saponin component, [Figure 17C] (C) Regulation of MALAT1 expression by CD71-targeted aCD71-Malat1 ASO or aCD71-Malat1 ASO administered simultaneously with the saponin component (2). In this example, the saponin component (1) is SO1861-SC, and the saponin component (2) is SO1861-AH (block). [Figure 18A] When saponin components are administered simultaneously with (targeted) ASO in nerve cells, they enhance mRNA reduction, and (A) induction of abnormal SOD1 transcripts by SOD1 ASO or SOD1 ASO administered simultaneously with saponin components. [Figure 18B] (B) Regulation of SOD1 expression by SOD1 ASO or SOD1 ASO administered simultaneously with a saponin component. [Figure 18C] (C) CD71-targeted aCD71-SOD1 ASO or induction of abnormal SOD1 transcripts by aCD71-SOD1 ASO administered simultaneously with a saponin component. [Figure 18D] (D) Regulation of SOD1 expression by CD71-targeted aCD71-SOD1 ASO or aCD71-SOD1 ASO administered co-administered with a saponin component. [Figure 18E] (E) Induction of abnormal SOD1 transcripts by high and low levels of aCD71-(saponin-SOD1 PMO) or a single-component conjugate aCD71-(saponin-SOD1 PMO). [Figure 18F](F) Regulation of SOD1 expression by aCD71-SOD1 ASO or a single-component conjugate aCD71-(saponin-SOD1 PMO) high and aCD71-(saponin-SOD1 PMO) low, where saponin (1) of the saponin component is SO1861-AH (block), and in this example, the saponin component is SO1861-SC. [Figure 19A] When saponin components are administered co-administered with various (targeted) ASOs to retinal pigment epithelial cells, they enhance mRNA reduction, and (A) regulation of MALAT1 expression by MALAT1 ASO or MALAT1 ASO administered co-administered with saponin components. [Figure 19B] (B) Regulation of SOD1 expression by SOD1 ASO or SOD1 ASO administered simultaneously with a saponin component. [Figure 19C] (C) Regulation of SOD1 expression by CD71-targeted aCD71-SOD1 ASO or aCD71-SOD1 ASO administered co-administered with a saponin component. In this example, the saponin component (1) is SO1861-EMCH. [Figure 20A] When saponin components are administered simultaneously with multiple targeted PMOs to retinal pigment epithelial cells, they induce exon skipping and enhance mRNA reduction, thus (A) regulating SOD1 exon 2 skipping by aCD71-PMO(1) or aCD71-PMO(1) administered simultaneously with saponin components. [Figure 20B] (B) Modification of SOD1 exon 3 or exon 2 / 3 skipping by aCD71-PMO(2) or aCD71-PMO(2) administered simultaneously with a saponin component. [Figure 20C] (C) The amount of residual full-length SOD1 gene product after treatment with aCD71-PMO(1) or aCD71-PMO(2) in the presence of a saponin component, in this example the saponin component saponin(1) is SO1861-EMCH. [Modes for carrying out the invention]

[0085] The innovative concepts presented herein will be described based on specific aspects and embodiments of this disclosure, but these should be considered descriptive and not to limit the scope beyond what is stated in the claims. The aspects and / or embodiments described herein may work together in combination unless otherwise specified. The innovative concepts disclosed herein will be described with reference to these aspects and embodiments, but it is intended that alternative forms, improved forms, variations and equivalents will become apparent to those skilled in the art by reading this specification and examining the drawings and / or graphs. The disclosed matters are not limited in any way to the exemplary embodiments and may be modified without departing from the scope defined by the appended claims.

[0086] Improved pharmaceutical compositions for therapeutic disorders affecting organs derived from the neural tube, i.e., organs of the CNS and the eye, comprising a saponin component and a nucleic acid therapeutic agent capable of treating or improving disorders of the CNS or the eye, wherein the composition is administered topically to the organ, i.e., the organ, or a body cavity that houses and protects the organ, or a fluid space in an unoccluded blood-tissue barrier that is in fluid communication with the cells of the organ.

[0087] The saponins of the novel compositions for CNS and ocular local delivery disclosed herein are endosome escape-enhancing (EEE) saponins.

[0088] While we do not wish to be bound by any theory, the pharmaceutical compositions disclosed herein are based on the observation that a certain group of pentacyclic triterpene saponins containing a 12,13-dehydrooleanane-type aglycone core appear to exhibit potent endosomal escape-enhancing properties. This particular type of saponin was characterized and reported, for example, in International Publication No. 2020126620, as possessing endosomal escape-enhancing (EEE) activity against various antibody-drug conjugates (ADCs) in several cancer cell types. This group of saponins is further disclosed in International Publication Nos. 2020126626, 2020126627, 2020126620, 2020126627, 2020126064, 2020126604, 2020126600, and 2020126609 as being capable of dramatically improving cancer treatment with oligonucleotide therapies, as demonstrated by the fact that saponin silencing of HSP27 gene transcripts using HSP27-specific BNA-based oligonucleotides is promoted in different tumor model cell lines.

[0089] As described herein and further demonstrated in the accompanying examples, the inclusion of a pentacyclic triterpene saponin containing a 12,13-dehydrooleanane-type aglycone core in combination with an oligonucleotide therapeutic agent after topical administration to the mouse brain in vivo was not only safe but also visually increased the bioavailability of the oligonucleotide therapeutic agent.

[0090] In line with these findings, in a first general embodiment, saponin components are provided for use in therapeutic methods for treating subjects suffering from disorders of (immunely privileged) neuron-rich organs, including vascular systems with blood-tissue barrier properties such as organs derived from the neural tube, and the method is Saponin components including a pentacyclic triterpene saponin containing a 12,13-dehydrooleanane type aglycone core, Effector components including nucleic acid therapeutics intended to be delivered to one or more cells of an organ, This includes administering the drug to the target organ, and the administration is carried out either directly to the organ or into a body cavity or fluid space that is in communication with the cells of the organ (i.e., the blood-tissue barrier is not blocked).

[0091] Furthermore, in accordance with the general embodiment, the pharmaceutical composition is provided for use in the treatment of disorders of (immunely privileged) neuron-rich organs, including vascular systems having blood-tissue barrier properties such as organs derived from the neural tube, and the pharmaceutical composition is Saponin components including a pentacyclic triterpene saponin containing a 12,13-dehydrooleanane type aglycone core, Effector components including nucleic acid therapeutics intended to be delivered to one or more cells of an organ, The pharmaceutical composition, which includes [the specified substance], is administered either directly to an organ or into a body cavity or fluid space that communicates with the tissue of the organ (i.e., the blood-tissue barrier is not blocked).

[0092] In advantageous embodiments, for example, a targeting option is provided for targeting specific cells without targeting other tissues. Accordingly, in advantageous embodiments compatible with the above embodiments, a saponin component or pharmaceutical composition for use disclosed herein is provided, wherein the saponin component further comprises a first ligand recognized by a first endocytosis receptor, and / or the effector component further comprises a second ligand recognized by a second endocytosis receptor, wherein the second endocytosis receptor is the same as the first endocytosis receptor, and further optionally the second ligand is the same as the first ligand, or instead the second endocytosis receptor is different from the first endocytosis receptor, however, the two different The endocytosis receptors are both present on the same cell, and preferably the first ligand and / or the second ligand are proteinogenic ligands, such as naturally occurring peptides or protein ligands (e.g., cytokines or growth factors such as EDF) or their receptor interaction moieties, or antibodies or their binding fragments, such as F(ab')2 fragment, Fab' fragment, Fab fragment, scFv, dsFv, scFv-Fc, reduced IgG (rIgG), minibody, diabody, triabody, tetrabody, Fc fusion protein, nanobody, variable V domain, single-domain antibody (sdAb), preferably V HH For example, camelid animals V H That is the case.

[0093] Possible embodiments using non-proteinogenic ligands are also feasible, as will be described in more detail later in relation to ligands. Typical such ligands include vitamin A, glutamate, or glycans such as glucose or mannose 6-phosphate units. A well-known and widely used targeting option in liver-related applications is the use of non-proteinogenic ligands containing one or more GalNAc moieties to specifically target asialoglycoprotein receptors (ASGPRs). Thus, in possible embodiments, the first ligand and optionally the second ligand are non-proteinogenic ligands recognized by endocytosis receptors on the cell surface of neurons or glial cells, for example, and containing at least partially, for example, one or more glucose units, targeting glucose transporters.

[0094] Saponin component In accordance with the foregoing, the “saponin components” disclosed herein include pentacyclic triterpene saponins (also called sapogenins or aglycones) whose structure contains a 12,13-dehydrooleanane type aglycone core, and are usually represented as a pentacyclic C30 terpene skeleton, often containing an aldehyde functional group at the C-23 position in their naturally occurring state. Examples of such known saponins are shown in Table 2A below and in the scheme of saponin A below.

[0095] A notable feature of these saponins is the aldehyde functional group at the C-23 position of the saponin aglycone core structure. While we do not wish to be bound by any theory, it has been observed that the presence of the aforementioned aldehyde functional group (sometimes referred to as the "aldehyde group," and should be interpreted as synonymous in this context) within the aglycone core may be particularly beneficial for the saponin's ability to stimulate and / or enhance the endosomal escape of therapeutic nucleic acids.

[0096] Therefore, in advantageous embodiments, a saponin component (or pharmaceutical composition) for use disclosed herein, wherein a pentacyclic triterpene saponin is, - Aldehyde functional group at the C-23 position of the aglycone core, or - An acid-sensitive covalent bond configured to cleave under acidic conditions to generate an aldehyde functional group at the C-23 position of the aglycone core, preferably selected from one or more of the following: a semicarbazone bond, a hydrazone bond, an imine bond, an acetal bond including a 1,3-dioxolane bond, a ketal bond, an ester bond, and / or an oxime bond, preferably selected from a semicarbazone bond and a hydrazone bond. A saponin component (or pharmaceutical composition) further comprising the above is provided.

[0097] Most of the known pentacyclic triterpene saponins found in nature, containing a 12,13-dehydrooleanane-type aglycone core that also includes an aldehyde functional group at the C-23 position in its natural or unconjugated form, are saponins in which the aglycone core is either chiric acid or gypsogenin. Exemplary chemical structures of such saponins are schematically depicted in the scheme of saponin A.

[0098] [ka]

[0099] In line with this, it has been observed that saponins comprising a chiric acid aglycone or gypsogenin aglycone core structure are particularly suitable for the purposes of this disclosure. Accordingly, in the following embodiments, which are compatible with the preceding embodiments, saponin components or pharmaceutical compositions for use disclosed herein are provided, wherein the pentacyclic triterpene saponins comprise an aglycone core selected from chiric acid, gypsogenin, and an aldehyde-substituted derivative of either chiric acid or gypsogenin, respectively, defined as a chiric acid-based or gypsogenin-based aglycone core, wherein the aldehyde functional group at the C-23 position is substituted by an acid-sensitive covalent bond configured to cleave under acidic conditions to produce an aldehyde functional group at the C-23 position of the aglycone core, preferably a cyanoacrylate. The ulacic acid or chiric acid-based aglycone cores are AG1856, AG1, AG2, agrostemoside E, GE1741, Gypsophila 1 (Gyp1), NP-017674, NP-017810, NP-003881, NP-017676, NP-017677, NP-017705, NP-017706, NP-017773, NP-017775, SA1657, saponarioside B, SO1542, SO1584, SO1674, SO1700, SO1730, SO1772, SO1832, SO1861, SO1862, SO1904, QS-7, QS-7 The aglycone core is selected from api, QS-17, QS-18, QS-21 A-apio, QS-21 A-xylo, QS-21 B-apio, and QS-21 B-xylo or any one of their aldehyde-substituted derivatives, or the gypsogenin or gypsogenin-based aglycone core is selected from SA1641, gypsoside A, NP-017772, NP-017774, NP-017777, NP-017778, NP-018109, NP-017888, NP-017889, NP-018108, SO1658, and phytracagenin or any one of their aldehyde-substituted derivatives.

[0100] Saponins can include one or more glycans bonded to the aglycone core structure. Preferred saponins for compositions for use according to this disclosure include single-chain (i.e., monodesmoside) or double-chain (i.e., bisdesmoside) saponins bonded to the aglycone core structure. In accordance with this, the following embodiments, which are compatible with the preceding embodiments, provide saponin components or pharmaceutical compositions for use disclosed herein, wherein the pentacyclic triterpene saponin is a monodesmoside or a bidesmoside, preferably comprising a first glycan bonded at the C-3 position of the aglycone core, more preferably the first glycan being selected from group A listed in Table 1A, even more preferably the first glycan comprising a glucuronic acid group, preferably a terminal glucuronic acid group, and most preferably the first glycan comprising Gal-(1→2)-[Xyl-(1→3)]-GlcA.

[0101] In certain embodiments compatible with prior embodiments, saponin components or pharmaceutical compositions for use disclosed herein are provided, wherein the pentacyclic triterpene saponins are isolated from Saponaria officinalis and are preferably one or more of saponarioside B, SO1542, SO1584, SO1658, SO1674, SO1700, SO1730, SO1772, SO1832, SO1861, SO1862 and SO1904, more preferably one or more of SO1832, SO1861 and SO1862, even more preferably SO1832 or SO1861, and most preferably SO1861.

[0102] The saponin components disclosed herein may include one or more unconjugated saponin molecules and / or conjugated saponin molecules further referred to as saponin moieties (purely to distinguish them from their unconjugated free molecular counterparts).

[0103] Accordingly, in possible embodiments compatible with the prior embodiments, saponin components or pharmaceutical compositions for use disclosed herein are provided, the saponin components comprising unconjugated saponin molecules (defined as pentacyclic triterpene saponins not covalently conjugated to a non-saponin portion, and optionally the saponin component comprising unconjugated saponin molecules).

[0104] In the preceding embodiments and alternative embodiments compatible with other prior embodiments, saponin components or pharmaceutical compositions for use disclosed herein are provided, the saponin components comprising a saponin moiety covalently conjugated with at least one non-saponin moiety via an acid-sensitive covalent bond, preferably an acid-sensitive covalent bond at the C-23 position of the aglycone core, and even more preferably an acid-sensitive covalent bond at the C-23 position of the aglycone core, which cleaves under acidic conditions to generate an aldehyde functional group at the C-23 position of the aglycone core, and thus the aglycone core The configuration is such that a pentacyclic triterpene saponin containing an aldehyde functional group at the C-23 position is released from the non-saponin moiety, and more preferably the acid-sensitive covalent bond is selected from one or more of the following: a semicarbazone bond, a hydrazone bond, an imine bond, an acetal bond including a 1,3-dioxolane bond, a ketal bond, an ester bond and / or an oxime bond, most preferably selected from a semicarbazone bond and a hydrazone bond, and / or the saponin moiety is covalently conjugated with at least one non-saponin moiety by an acid-stable bond, preferably via a glucuronic acid group if one is present.

[0105] In related embodiments, saponin components or pharmaceutical compositions for use disclosed herein are provided, the non-saponin portion being Linker, The first ligand according to claim 2, Effector components, and / or Scaffold Molecules The material comprises one or more of the above, preferably the saponin moiety is directly and covalently conjugated to the linker, more preferably the linker contains or is covalently conjugated to the saponin moiety via an acid-sensitive covalent bond, more preferably at the C-23 position of the aglycone core, or via an acid-stable bond, preferably at the glucuronic acid group if one is present, and even more preferably the linker is further covalently conjugated to the first ligand and / or effector component, optionally via a scaffold molecule, for example, the scaffold molecule is a polyfunctional linker scaffold molecule or optionally a polymer scaffold molecule containing a dendron, such as a polyamidoamine (PAMAM) dendrimer, or polyethylene glycol, such as PEG3 to PEG30.

[0106] As used herein, the term "scaffold molecule" refers to a portion of a conjugate that can function as a scaffold for conjugating other portions to the conjugate. In this regard, such a scaffold molecule may be used to create a covalent bond between the saponin portion and the effector portion, and optionally between the first ligand. Conjugation to the scaffold molecule may be carried out directly or via first and second linkers of any further linkers.

[0107] Typical scaffold molecules known in the art are often based on dendrons, such as polyamidoamine (PAMAM) dendrimers, or on oligomer or polymer structures of polyethylene glycol, such as any of PEG3 to PEG30. In advantageous embodiments of the present disclosure, any one of such scaffold molecules may be used. For example, it may be advantageous that the polymer or oligomer structure is any one of PEG4 to PEG12 or any one of G2, G3, G4, and G5 dendrons, more preferably G2 or G3 dendrons or PEG3 to PEG30. Dendrons appear to be particularly advantageous for ophthalmic applications because ophthalmic therapeutic formulations suffer from low retention rates, which leads to frequent injections. Providing scaffold molecules that can be retained for extended periods in ophthalmic solutions or CNS may offer advantages for longer exposure.

[0108] In another example that fits the above, a polyfunctional linker can be used as a scaffold (referred to above as the "polyfunctional linker scaffold molecule"). The polyfunctional linker scaffold molecule can be prepared from a trifunctional linker, for example, shown by structure A in the following example (represented here in a non-conjugated form).

[0109] [ka]

[0110] In possible embodiments, the conjugate may contain 1 to 4 such trifunctional linkers for each molecule of the targeted ligand contained in the conjugate, more preferably 1 to 2 trifunctional linkers, and most preferably an average of 1.2 to 1.8 trifunctional linkers.

[0111] In the conjugated form, the trifunctional linker of that conjugated form is structure B:

[0112] [ka]

[0113] (In the formula, S is at least one saponin moiety, L1 is a linker bound to the saponin portion. NA is an effector component that contains nucleic acids. L2 is a linker that is coupled to the effect component. A is preferably one or more molecules of a first ligand, which is an antibody or a binding fragment thereof. L3 is a linker that binds to the first ligand, (L1, L2, and L3 are either the same or different.) It is represented by [this].

[0114] In particularly advantageous embodiments, saponin components or pharmaceutical compositions for use disclosed herein are provided, wherein a saponin moiety is covalently conjugated with a non-saponin moiety comprising an effector component, the conjugation of which the saponin component and the effector component together yields a conjugate further referred to as a saponin-effector component, preferably the saponin-effector component further comprising a linker, more preferably the linker being directly and covalently conjugated with the saponin moiety, and optionally the saponin-effector component further comprising a first ligand (resulting in a conjugate further referred to as a targeted saponin-effector component).

[0115] In possible embodiments, the targeted saponin-effector component comprises 1 to 16 saponin moieties and 1 to 5 nucleic acid molecules (also referred to as effector moieties) per ligand moiety, preferably comprising 2 to 8 saponin moieties per ligand moiety, preferably 3 to 6 saponin moieties per ligand moiety, more preferably 4 to 5 saponin moieties per ligand moiety, and most preferably comprising an average of 4 to 4.5 saponin moieties per ligand molecule.

[0116] In advantageous embodiments compatible with prior embodiments, saponin components or pharmaceutical compositions for use disclosed herein are provided, the administration of which includes providing an effector component and a saponin component formulated as at least two pharmaceutical formulations (provided in physically separate containers or packages, e.g., in different containers or packages) which can be formulated as a single pharmaceutical formulation or administered simultaneously or sequentially (the first pharmaceutical formulation comprising a saponin component and the second pharmaceutical formulation comprising an effector component).

[0117] In certain advantageous embodiments, a boost application of a saponin component, further referred to as a boost saponin component, may be carried out after administration.

[0118] The inventors have observed that such boost application (booster) of a saponin component (boosted saponin component) can result in an extension of the duration of action of nucleic acid therapeutics, and / or an extension of the administration interval of nucleic acid therapeutics, and / or a reduction in the frequency of administration of nucleic acid therapeutics, and / or an enhancement of the effect (delay) of nucleic acid therapeutics.

[0119] In a favorable embodiment, a boost application of the boost saponin component and the further referred to saponin component is performed after an interval of at least 1 day, preferably at least 1 week, following the administration, wherein the boost saponin component is provided without an effector component and preferably comprises one saponin moiety of either a non-conjugated saponin molecule or its saponin moiety (preferably at least a linker, or at least a first ligand, or a saponin moiety covalently conjugated with a non-saponin moiety that is at least a linker and a first ligand).

[0120] In possible embodiments, the interval is at least 1 day after administration, preferably at least 2 days, at least 3 days, at least 1 week, at least 2 weeks, at least 3 weeks, at least 1 month, at least 2 months, at least 3 months, at least 4 months, at least 5 months, or at least 6 months.

[0121] In certain embodiments, the boost application may be carried out directly on an organ or within a body cavity or fluid space that communicates with the cells of the organ.

[0122] In certain embodiments, the boost application may be performed at the administration site, or, if the administration involves application at multiple sites, the boost application may be performed at one of these sites.

[0123] For example, in the case of administration at multiple sites or repeated administration, or administration that includes multiple partial doses, for example, if the administration involves the provision of two or more pharmaceutical preparations as separate, and possibly time-limited, doses, the site of administration should be interpreted as at least one of the sites of administration.

[0124] Alternatively, in certain advantageous embodiments, boost application may be carried out within a body cavity or fluid space communicating with organ cells, but via an application route that is less invasive and / or does not penetrate too deeply into the target body compared to the administration route.

[0125] For example, if intrathecal administration to the central nervous system (CNS) is performed, a boost dose may be administered epidurally only, which is a more standardized, less complex intervention that is better tolerated by the patient and more commonly used by anesthesiologists.

[0126] In another example, if the administration is performed intravitreously to the eye, the boost application of the saponin component may be applied via a less painful periorbital route or even more topically.

[0127] In the following embodiments, which are compatible with the preceding embodiments, saponin components or pharmaceutical compositions for use disclosed herein are provided, and the administration includes providing a single pharmaceutical formulation selected from one or more of the following: - A two-component free saponin preparation comprising a non-conjugate saponin molecule, defined here as a saponin component consisting of a pentacyclic triterpene saponin, and further comprising an effector component optionally containing a second ligand recognized by a second endocytosis receptor, - A two-component linker-saponin preparation defined as containing a saponin component consisting of a saponin moiety, wherein the saponin moiety is covalently conjugated with a linker, and the two-component linker-saponin preparation optionally further contains an effector component comprising a second ligand recognized by a second endocytosis receptor, - A two-component targeted saponin formulation defined as containing a saponin component including a saponin moiety, wherein the saponin moiety is covalently conjugated with a first ligand, preferably the non-saponin moiety includes a linker, and the two-component targeted saponin formulation optionally further includes an effector component containing a second ligand. A one-component formulation defined as containing a saponin-effector component, wherein the saponin-effector component is optionally a targeted saponin-effector component further containing a first ligand.

[0128] In the following embodiments, which are compatible with the preceding embodiments, a saponin component or pharmaceutical composition for use disclosed herein is provided, and the administration comprises providing at least two pharmaceutical formulations, including a combination of a first pharmaceutical formulation and a second pharmaceutical formulation selected from any one or more of the following: - A non-targeting combination, A first pharmaceutical formulation wherein the saponin component does not contain a ligand and preferably contains or comprises a non-conjugate saponin molecule and / or a saponin moiety, the saponin moiety being covalently conjugated to a linker, and A second pharmaceutical formulation, wherein the effector component does not contain a ligand, and Detargeting combinations defined as including A targeted effector combination, A first pharmaceutical formulation wherein the saponin component does not contain a ligand and preferably contains or comprises a non-conjugate saponin molecule and / or a saponin moiety, the saponin moiety being covalently conjugated to a linker, and A second pharmaceutical formulation, wherein the effector component comprises a second ligand and A targeted effector combination defined as including - A targeted saponin combination, A first pharmaceutical formulation comprising a saponin component including a saponin moiety, the saponin moiety being covalently conjugated with a first ligand, and preferably, the non-saponin moiety including a linker, A second pharmaceutical formulation, wherein the effector component may include a second ligand, and A targeted saponin combination is defined as one that includes [the specified ingredient / component].

[0129] In summary, as disclosed herein, the saponin component is, - A 12,13-dehydrooleanane-type pentacyclic triterpenoid saponin, and - Preferably, it contains an aldehyde functional group at the C-23 position of the aglycone core or is configured to generate an aldehyde functional group at the C-23 position of the aglycone core by cleavage under acidic conditions, and preferably, the acid-sensitive covalent bond is selected from any one or more of a semicarbazone bond, a hydrazone bond, an imine bond, an acetal bond including a 1,3-dioxolane bond, a ketal bond, an ester bond, and / or an oxime bond, preferably selected from a semicarbazone bond and a hydrazone bond, - It is a monodesmoside or bidesmoside, preferably a bidesmoside, and / or - It contains a first sugar chain bonded to its aglycone core structure selected from Group A listed in Table 1A, and / or contains a second sugar chain bonded to its aglycone core structure selected from Group B listed in Table 1A, and preferably, the first sugar chain and the second sugar chain are composed of a saponin molecule or a saponin moiety.

[0130]

Table 1

[0131]

Table 2

[0132]

Table 3

[0133]

Table 4

[0134] and / or - Preferably, it comprises a first sugar chain bonded to the C-3 position of its aglycone core structure, selected from group A listed in Table 1A, preferably the sugar chain of the saponin molecule contains a glucuronic acid group, or optionally the first sugar chain of the saponin moiety contains a glucuronic acid group, and / or - Preferably, comprising a first sugar chain containing terminal glucuronic acid residues and / or a second sugar chain containing at least four sugar residues in a branched configuration, and / or - Preferably comprising a branched second glycan of at least four sugar residues including the first glycan Gal-(1→2)-[Xyl-(1→3)]-GlcA and / or terminal fucose residues and / or terminal rhamnose residues, preferably selected from Table 1A and / or - Preferably comprising a first sugar chain at the C-3 position of the saponin aglycone core structure and / or a second sugar chain at the C-28 position of the saponin aglycone core, preferably the first sugar chain being a carbohydrate substituent at the C-3 beta-OH group of the saponin aglycone core structure and / or the second sugar chain being a carbohydrate substituent at the C-28-OH group of the saponin aglycone core structure and / or - Optionally, the first glycan and / or the second glycan, preferably the second glycan, contains at least one acetoxy (Me(CO)O-) group, and / or - below: Chiral acid, Gypsogenin, 2-alpha-hydroxyoleanolic acid, 16-alpha-hydroxyoleanolic acid, Hederagenin (23-hydroxyoleanolic acid), 16-alpha,23-dihydroxyoleanolic acid, Protoestigenin-21(2-methylbuta-2-enoate)-22-acetate, 23-Oxo-Baringtogenol C-21,22-Bis(2-methylbuta-2-enoate), 23-Oxo-Baringtogenol C-21(2-methylbuta-2-enoate)-16,22-diacetate, 3,16,28 - Trihydroxyolean - 12 - ene, gypsogenic acid, and its derivatives selected from the aglycone core structures including, and / or - preferably including an aglycone core structure selected from kiyasuric acid, gypsoigenin and their derivatives, and / or - preferably including the aglycone core structure kiyasuric acid, and / or - selected from any one or more of the saponins listed in Table 2A.

[0135]

Table 5

[0136]

Table 6

[0137]

Table 7

[0138]

Table 8

[0139]

Table 9

[0140]

Table 10

[0141]

Table 11

[0142]

Table 12

[0143] [Table 13]

[0144] [Table 14]

[0145] [Table 15]

[0146] [Table 16]

[0147] [Table 17]

[0148] [Table 18]

[0149] and / or - a) List A: - Quillaja saponaria saponin mixture or saponins isolated from Quillaja saponaria, e.g., Quil-A, QS-17-api, QS-17-xyl, QS-21, QS-21A, QS-21B, QS-7-xyl, - Saponinum album saponin mixture or saponins isolated from Saponinum album. - Saponaria officinalis saponin mixture or saponins isolated from Saponaria officinalis, and - Quillaja bark saponin mixture or saponins isolated from Quillaja bark, such as saponins selected from one or more of Quil-A, QS-17-api, QS-17-xyl, QS-21, QS-21A, QS-21B, QS-7-xyl, or b) List B: SA1641, Gypsoside A, NP-017772, NP-017774, NP-017777, NP-017778, NP-018109, NP-017888, NP-017889, NP-018108, SO1658, and Phytolaccagenin A saponin containing a gypsogenin aglycone core structure, selected from the following, or c) List C: AG1856, AG1, AG2, Agrostemoside E, GE1741, Gypsophila 1 (Gyp1), NP-017674, NP-017810, NP-003881, NP-017676, NP-017677, NP-017705, NP-017706, NP-017773, NP-017775, SA1657, Saponarioside B, SO1542, SO1584, SO1674, SO1700, SO1730, SO1772, SO1832, SO1861, SO1862, SO1904, QS-7, QS-7 api, QS-17, QS-18, QS-21 A-apio, QS-21 A saponin containing a chiral acid aglycone core structure, selected from A-xylo, QS-21 B-apio, and QS-21 B-xylo, or d) List D: Escin Ia, Escinate, Alpha-Hederin, AMA-1, AMR, AS6.2, AS64R, Assam Saponin F, Dipsacoside B, Esculentside A, Macrantoidin A, NP-005236, NP-012672, Primulic Acid 1, Saikosaponin A, Saikosaponin D, Tea Seed Saponin I and Tea Seed Saponin J One or more saponins comprising a 12,13-dehydrooleanane-type aglycone core structure without an aldehyde group at the C-23 position of the aglycone, selected from the following, preferably one or more selected from list A, B or C, more preferably one or more selected from list B or C, even more preferably one or more selected from list C, and / or - AG1856, GE1741, saponins isolated from Quillaja saponaria, Quil-A, QS-17, QS-21, QS-7, SA1641, saponins isolated from Saponaria officinalis, saponarioside B, SO1542, SO1584, SO1658, SO1674, SO1700, SO1730, SO1772, SO1832 having the formula "SO1832".

[0150] [ka]

[0151] , SO1861 having the formula "SO1861"

[0152] [ka]

[0153] , one or more of SO1862 and SO1904, preferably one or more of QS-21, SO1832, SO1861, SA1641, AG1856 and GE1741, more preferably AG1856, SO1832 or SO1861, most preferably SO1861 or SO1832, and / or - Saponins isolated from Saponaria officinalis, preferably one or more of saponarioside B, SO1542, SO1584, SO1658, SO1674, SO1700, SO1730, SO1772, SO1832, SO1861, SO1862 and SO1904, more preferably one or more of SO1832, SO1861 and SO1862, even more preferably SO1832 or SO1861, most preferably SO1861, and / or - Saponin molecules in which the carboxyl group of the glucuronic acid unit in the first sugar chain bonded to C-3 of the aglycone core structure of the saponin molecule is converted to an amide bond via a reaction with 2-amino-2-methyl-1,3-propanediol (AMPD), as shown for SO1861 in formula (3):

[0154] [ka]

[0155] It is either a saponin molecule having the formula (9) to (12) below.

[0156] [ka]

[0157] [ka]

[0158] In certain preferred embodiments, the saponin contains a glucuronic acid group in the carbohydrate substituent at a C-3 beta-OH group, and preferably the saponin is selected from the group consisting of the following (see Table 2A for structural details): NP-017777, NP-017778, NP-017774, NP-018110, NP-017772, NP-018109, NP-017888, NP-017889, NP-018108, SA1641, AE X55, SO1658, Gypsocide A, Gypsophila 1 (Gyp1), NP-017674, NP-017810, AG1, NP-003881, NP-017676, NP-017677, NP-017706, NP-017705, NP-017773, NP-017775, SA1657, AG2, GE1741, SO1542, S O1584, SO1674, SO1700, saponarioside B, SO1730, SO1772, SO1832 (protonated SO1831, also called saponarioside A), SO1861 (deprotonated SO1862), SO1862 (protonated SO1861, also called sapofectoside), SO1904, QS-7 (also called QS1861), QS-7 api (also known as QS1862), QS-17, QS-18, QS-21 A-apio, QS-21 A-xylo, QS-21 B-apio, QS-21 B-xylo, QS-21, agrostemoside E (also known as AG1856 or AG2.8), NP-005236, NP-012672, beta-escin (indicated as escin Ia), escinate, tea seed saponin I, tea seed saponin J, Assam saponin F, primulic acid 1.

[0159] In certain preferred embodiments, the saponin does not contain an aldehyde functional group linked to the C-4 atom of the aglycone core structure, and preferably the saponin is selected from the group consisting of the following (see Table 2A for structural details): NP-005236, AMA-1, AMR, alpha-hederin, NP-012672, beta-escin (denoted as escin Ia), escinate, dipsacocoid B, esculentside A, tea seed saponin I, tea seed saponin J, assam saponin F, primulic acid 1, AS64R, maculantoidin A, saikosaponin A, saikosaponin D, AS6.2.

[0160] In certain preferred embodiments, the saponin contains a glucuronic acid group in the carbohydrate substituent at the C-3 beta-OH group, and the saponin does not contain an aldehyde functional group linked to the C-4 atom of the aglycone core structure. Preferably, the saponin is selected from the group consisting of the following (see Table 2A for structural details): NP-005236, NP-012672, beta-escin (denoted as escin Ia), escinate, dipsacoside B, esculentside A, tea seed saponin I, tea seed saponin J, Assam saponin F, primulic acid I, maculantoidin A, saikosaponin A, saikosaponin D.

[0161] In some specific embodiments, adapted to the preceding embodiments, one, two, or three, preferably one or two, more preferably one, of the following saponin components or compositions for use disclosed herein may be provided: - At least one aldehyde group in the aglycone core structure of the saponin is derivatized, if present. - The carboxyl group of the glucuronic acid moiety in the first sugar chain of at least one saponin is derivatized if present in at least one saponin, and - At least one acetoxy (Me(CO)O-) group on the second sugar chain of at least one saponin is derivatized, if present.

[0162] In more specific embodiments, a saponin component or composition for use disclosed herein may be provided, wherein at least one saponin comprises: i. Aglycone core structure, - Reduction to alcohol, - Conversion to a hydrazone bond via reaction with N-ε-maleimidocaproic acid hydrazide (EMCH) (where the maleimide group of EMCH is optionally derivatized by the formation of a thioether bond with mercaptoethanol), - Conversion to a hydrazone bond via reaction with N-[β-maleimidopropionic acid]hydrazide (BMPH) (where the maleimide group of BMPH is optionally derivatized by the formation of a thioether bond with mercaptoethanol), or - Conversion to a hydrazone bond via reaction with N-[κ-maleimidoundecanoic acid]hydrazide (KMUH) (where the maleimide group of KMUH is optionally derivatized by the formation of a thioether bond with mercaptoethanol). an aglycone core structure containing an aldehyde group that has been derivatized by, or ii. A first sugar chain containing a carboxyl group, preferably a carboxyl group of the glucuronic acid portion, which has been derivatized by conversion to an amide bond through reaction with 2-amino-2-methyl-1,3-propanediol (AMPD) or N-(2-aminoethyl)maleimide (AEM), or iii. A second sugar chain containing an acetoxy group (Me(CO)O-) that has been derivatized by conversion to a hydroxyl group (HO-) by deacetylation, or iv. Any combination of two or three derivatizations i., ii. and / or iii., preferably any combination of two derivatizations i., ii. and iii.

[0163] In one specific embodiment, a saponin component or composition for use disclosed herein is provided, wherein the aldehyde functional group at the C-23 position of the aglycone core structure of at least one saponin is covalently bound to a linker EMCH, which in turn covalently binds via a thioether linkage to a sulfhydryl group of an oligomer or polymer molecule of a covalent saponin conjugate, such as the sulfhydryl group of cysteine. When the EMCH linker binds to the aldehyde group of the saponin aglycone, a hydrazone bond is formed. Such a hydrazone bond is a typical example of a bond that can be cleaved under acidic conditions inside endosomes and lysosomes.

[0164] When a saponin component contains a saponin moiety, the saponin moiety is one of the saponin molecules defined herein above, covalently bonded to the following: - A linker suitable for covalently bonding, for example, a saponin molecule to another molecule, wherein the linker comprises or, for example, the following: a. Polyethylene glycol (PEG) having any number of lengths from 2 to 60 (PEG2, PEG3, PEG4, PEG5, PEG6, PEG7-PEG10, PEG11-PEG25, PEG25-PEG50, etc.), b. Peptides, c. Linear, branched, or cyclic alkyl, linear, branched, or cyclic alkenyl, linear, branched, or cyclic alkynyl, d. For example, polymer structures or oligomer structures selected from the following: i. Poly- or oligo(amine), e.g., polyethyleneimine and poly(amideamine), ii. Polyethylene glycol, iii. Poly- or oligo(ester), e.g., poly(lactide), iv. Poly(lactam), v. Polylactide-co-glycolidopolymer, vi. Poly- or oligosaccharides, such as cyclodextrin and polydextrose. vii. Poly- or oligo(amino acids), such as proteins and peptides, and viii. DNA oligomers or polymers, RNA polymers, stabilized RNA polymers and PNA (peptide nucleic acid) polymers, and / or ix. G2, G3, G4, or G5 type dendrons, - A linker as defined above, for example, having a further molecule covalently bonded to the linker, wherein the further molecule is one or more of the following: a. Further linkers, e.g., the linker defined above, and / or b. An effector portion which is an oligonucleotide therapeutic agent, and / or c. Ligands for binding to endocytosis cell receptors, which are proteinogenic ligands, non-proteinogenic ligands, or combinations thereof, preferably proteinogenic ligands, for example, the following: a. A protein ligand capable of binding to an endocytic cell surface receptor, wherein the binding results in the internalization of the protein ligand, such as a cytokine or EGF. b. An antibody defined as an immunoglobulin (Ig) or a functional binding fragment or binding domain thereof.

[0165] Saponin components are suitable for passive or active translocation from outside a cell to inside the cell. Furthermore, saponins are suitable for translocation from outside a cell to inside the cell, and for translocation within the cell's endosomes. Saponin components are suitable for entering cells when a ligand for binding to an endocytic cell receptor, which is bound to the saponin portion composed of the saponin component, binds to the endocytic receptor via endocytosis. Upon ligand binding, endocytosis occurs, and the saponin component is delivered to the endosome of the cell carrying the cell receptor. Notable examples of such cell surface receptors are CD71 and CD63.

[0166] Ligands for binding to such endocytic cell surface receptors are composed of, for example, saponin components and / or effector components (such as nucleic acid components) if the effector molecule or effector portion composed of effector components is to exert its therapeutic or prophylactic activity in tumor cells.

[0167] Examples of endocytosis receptors that can be selected for targeting by ligands composed of saponin components (and / or effector components such as nucleic acid components) include: transferrin receptor (CD71), insulin-like growth factor 1 (IGF-I) receptor (IGF1R), tetraspanin CD63, muscle-specific kinase (MuSK), glucose transporter GLUT4, cation-independent mannose 6-phosphate receptor (CI-MPR), and LDL receptor. Ligands for binding to such endocytosis cell surface receptors are composed of saponin components and / or effector components (such as nucleic acid components), for example, when an effector molecule or effector portion composed of effector components is to exert its therapeutic or prophylactic activity in muscle cells.

[0168] When the protein ligand composed of saponin components (and suitable for binding to endocytic cell surface receptors) is an antibody, the antibody is selected from, for example, IgG, IgM, IgE, IgA, or IgD or any antigen-binding fragment thereof, and is preferably selected from monoclonal antibodies, polyclonal antibodies, human antibodies, humanized antibodies, chimeric antibodies, surface-reconstituted antibodies, anti-idiotype antibodies, mouse antibodies, rat antibodies, rat / mouse hybrid antibodies, llama antibodies, llama heavy chain only antibodies, heavy chain only antibodies, Vhh domains, Vh domains, Fab, scFv, Fv, single-domain antibodies (sdAb), F(ab)2, and molecules containing or consisting of Fcab fragments. Monoclonal antibodies and Fab and single sdAbs or a series of covalently bound sdAbs are preferred.

[0169] The linker (and, in some embodiments, a ligand covalently bound to the linker) covalently binds to the saponin molecule to form a saponin component including the saponin moiety and the linker, and in preferred embodiments, covalently binds to the saponin via a cleavable bond present in mammalian cells, e.g., endosomes of human cells, under conditions that enable cleavage. Such cleavable bonds are subject to cleavage under, for example, acidic, reducing, enzymatic, and / or photo-induced conditions, and preferably, the cleavable bonds are selected from the following: • Bonds that are cleaved under acidic conditions, such as semicarbazone bonds, hydrazone bonds, imine bonds, acetal bonds including 1,3-dioxolane bonds, ketal bonds, ester bonds and / or oxime bonds, Preferably, the bonds that are susceptible to proteolysis by cathepsin B, such as amide or peptide bonds, • Bonds that can be cleaved by redox reactions, such as disulfide bonds, or bonds that readily undergo thiol exchange reactions, such as thioether bonds. Preferably, the acid-sensitive bond is one that is cleaved in vivo under acidic conditions present in human cell endosomes and / or lysosomes, preferably at pH 4.0 to 6.5, more preferably at pH ≤ 5.5, and more preferably an acid-sensitive bond selected from one or more of the following: semicarbazone bond, hydrazone bond, imine bond, acetal bond including 1,3-dioxolane bond, ketal bond, ester bond, and / or oxime bond; even more preferably selected from semicarbazone bond and hydrazone bond, and most preferably a hydrazone bond.

[0170] In one embodiment of the present invention, the saponin molecule contains a glucuronic acid functional group having a carboxylic acid functional group in the carbohydrate substituent at the C-3 beta-OH group of the saponin, and the carboxylic acid functional group is converted to an active ester.

[0171] In one embodiment of the present invention, the saponin moiety comprises a glucuronic acid functional group having a carboxylic acid functional group in the carbohydrate substituent at the C-3 beta-OH group of the saponin, the carboxylic acid functional group being converted to an active ester when a linker is bonded to the carboxylic acid functional group. In one embodiment, the ligand defined above is covalently bonded to the linker, which is bonded to the saponin moiety. An example of such a saponin moiety containing an active ester is a moiety resulting from the activation of the carboxyl group of a saponin molecule selected to provide the saponin moiety via 1-[bis(dimethylamino)methylene]-1H-1,2,3-triazolo[4,5-b]pyridinium 3-oxide hexafluorophosphate (HATU).

[0172] In the embodiment, the linker bound to the saponin molecule in the saponin component is a dendron such as a polyamidoamine (PAMAM) dendrimer, or a polyethylene glycol such as any of PEG3 to PEG30, or further comprises an oligomer or polymer structure of any of these. Preferably, the polymer or oligomer structure is any one of PEG4 to PEG12 or any one of G2 dendron, G3 dendron, G4 dendron, and G5 dendron, more preferably G2 dendron or G3 dendron or PEG3 to PEG30.

[0173] For example, a saponin component contains a saponin moiety with a covalently bonded linker and is a molecule represented by one of formulas (I) to (V).

[0174] [Table 19]

[0175] [Table 20]

[0176] and / or for example, saponin components are - Saponins in which the carboxyl group of the glucuronic acid unit in the first sugar chain bonded to C-3 of the aglycone core structure of the saponin is converted to an amide bond via a reaction with N-(2-aminoethyl)maleimide (AEM) as shown in formula (18) as SO1861:

[0177] [ka]

[0178] Alternatively, it is a saponin having a formula determined by one of the following formulas (14) to (16) and (19) to (21).

[0179] [ka]

[0180] [ka]

[0181] [ka]

[0182] In a preferred embodiment, the saponin component is a molecule according to formula (I) above, or SO1861, or a conjugate of SO1861 and a first ligand.

[0183] Effector components The development of the advantageous compositions presented herein is based on the remarkable realization that because the conjugates presented herein contain endosomal escape-enhancing saponins, any nucleic acid can be delivered to CNS organs and / or intraocular cells with enhanced efficiency by topical administration, thereby facilitating the treatment of underlying diseases.

[0184] As previously described herein, the term "effector component" refers to a component that includes an effector portion or consists of an effector molecule, where the effector portion or effector molecule is a nucleic acid therapeutic agent, preferably an oligonucleotide therapeutic agent.

[0185] In the following embodiments, which are compatible with the preceding embodiments, saponin components or pharmaceutical compositions for use disclosed herein are provided, and the nucleic acid therapeutic agents are selected from the following: - Gene therapy drugs that can treat or improve a disorder by replacing an abnormal or non-functional gene related to the disorder with a functional variant, or by restoring the abnormal or non-functional gene by introducing repair into the gene, - An oligonucleotide therapeutic agent defined as a nucleic acid therapeutic agent having a length of 200 nt or less, preferably 5 to 150 nt, more preferably 8 to 100 nt, and most preferably 10 to 50 nt, which can treat or improve a disorder by preferably regulating the expression of a gene related to the disorder.

[0186] In the following embodiments, which are compatible with the preceding embodiments, saponin components or pharmaceutical compositions for use disclosed herein are provided, wherein the nucleic acid therapeutic agent comprises DNA and / or RNA and / or synthetic nucleic acids (also known as xeno nucleic acids, XNA), defined as modified equivalents of DNA and / or RNA, and comprising one or more nucleotide analogs and / or skeletal modifications, and preferably the nucleic acid therapeutic agent is - A DNA therapeutic agent comprising, for example, double-stranded DNA (dsDNA), optionally circular, e.g., plasmid or minicircle DNA, and / or e.g., single-stranded DNA (ssDNA), preferably selected from plasmids, minicircle DNA, CRISPR gene editing-related constructs, DNA aptamers and / or DNA antisense oligonucleotides (ASOs, AONs), e.g., DNA anti-microRNA ASOs (anti-miRNA ASOs, anti-miR ASOs), most preferably DNA ASOs. - RNA therapeutics comprising, for example, double-stranded RNA (dsRNA), such as short interfering RNA (siRNA) or small activating RNA (saRNA), and / or single-stranded RNA (ssRNA) such as mRNA or microRNA (miRNA), and optionally comprising non-coding RNA (ncRNA), such as transfer RNA (tRNA), ribosomal RNA (rRNA), circular RNA (circRNA) such as ecircRNA or ciRNA, small non-coding RNA, such as miRNA, siRNA, piRNA, snoRNA, snRNA, exRNA, scaRNA, or long non-coding RNA (lncRNA), such as long intercalating / intergenetic non-coding RNA (lincRNA), preferably, RNA-based therapeutics are selected from RNA ASO, siRNA, miRNA, RNA miRNA inhibitors (anti-microRNA, anti-miRNA, anti-miR) and / or RNA miRNA inhibitor ASO, RNA aptamers, ribozymes, RNA decoys, short hairpin RNA (shRNA), anti-hairpin microRNA, and most preferably, RNA therapeutics are RNA RNA therapeutics selected from ASO, siRNA, miRNA and / or RNA aptamers, - Preferably the following modifications: phosphoramide morpholino oligomers (PMO, morpholino), peptide nucleic acids (PNA), phosphorothioate-modified antisense oligonucleotides (PS-ASO), 2'-O-methyl (2'-OMe) phosphorothioate RNA, 2'-O-methoxyethyl (2'-O-MOE) RNA (2'-O-methoxyethyl-RNA (2'-MOE, MOE)), locked nucleic acids (LNA, cross-linked nucleic acids, BNA, e.g., 2'-O,4'-aminoethylene cross-linked nucleic acids (BNA-NC), BNA-based silicone A mixed DNA / RNA and / or synthetic nucleic acid therapeutic agent comprising or consisting of one of the following: RNA, BNA-based antisense oligonucleotides (BNA-ASO, BNA-based antimicroRNA, etc.), 2'-deoxy-2'-fluoroarabino nucleic acid (FANA), 3'-fluorohexitol nucleic acid (FHNA), glycol nucleic acid (GNA), or threose nucleic acid (TNA), more preferably a gapmer (mixmer), synthetic gapmer, synthetic CpG oligonucleotide, synthetic RNA decoy, synthetic ASO and / or synthetic antimicroRNA, e.g., antimicroRNA ASO, e.g., miRNA masking ASO (miR-Mask, BlockmiR, usually a single-stranded 2'-O-methyl-modified oligonucleotide) or antagonist (miRNA antagonist) or other LNA-based or 2-O-methylRNA-based antimicroRNA. The nucleic acid therapeutic agent is selected from, and more preferably from, synthetic ASOs, substantially DNA-based synthetic ASOs, preferably substantially RNA-based synthetic ASOs containing 2'-MOE modifications, substantially DNA-based synthetic aptamers, substantially RNA-based synthetic aptamers, synthetic gapmers, synthetic siRNAs, synthetic miRNAs, synthetic anti-miRNAs, and / or synthetic anti-miRNA ASOs.

[0187] For example, targeting the CNS with 2'-MOE-containing ASO is considered advantageous because it offers high stability in cerebrospinal fluid (CSF) after intrathecal injection, making it particularly suitable for CNS targeting (Khorkova et al., 2017).

[0188] In subsequent embodiments compatible with the preceding embodiments, saponin components or pharmaceutical compositions for use disclosed herein are provided, wherein the nucleic acid therapeutic agent is an oligonucleotide therapeutic agent, preferably an siRNA therapeutic agent or an antisense oligonucleotide (ASO) therapeutic agent, preferably comprising one or more nucleotide analogs and / or skeletal modifications, and more preferably a mutation-specific therapeutic agent, which is an oligonucleotide therapeutic agent, preferably an siRNA therapeutic agent or an antisense oligonucleotide (ASO) therapeutic agent, which comprises one or more nucleotide analogs and / or skeletal modifications designed to optionally silence a gene involved in the disorder and / or induce exon skipping.

[0189] In the following embodiments, which are consistent with the preceding embodiments, saponin components or pharmaceutical compositions for use disclosed herein are provided, and nucleic acid therapeutics include HTT, LRRK2, SNCA, Parkin gene, PINK1, DJ-1, DRP-1, SCN1A, SOD1, TDP-43, FUS, C9orf72, NEK1, UBQLN2, ATXN2, SMN2, SMN1, MAPT (tau gene), APP (amyloid precursor protein gene), BACE1, IL-4, IL-6, IL-7, IL-12RB2, IL-1R1, MBP, MIR29B, AR, FAS, C2orf72 UBE3A, UBE2A, GFAP, DMD, DYN2, DGAT2, MFSD8 (CLN7), TTR, VEGF, e.g., VEGF-A, VEGFR1, VEGFR2, RHO, NF2, CMV virus IE2, CEP290, USH2A, CASP2, TRPV1, RPGR, ITGA4, PCED, USH2A, GJA1, C5, OPA1, TGFB2, RTP801, ADRB2, COCH, VEGF-165, P2RX7, JUN, BAX, APAF1, IKBKB, RDS, GUCY1A1, GUCY1A2, CNG (e.g., CNGA1, CNG) The target is a gene selected from A2, CNGA3, CNGB1, CNGB3), DDIT4, HIF1A, FN1, CTGF, TXNIP, CYP4B1, CNR1 and CNR2, STAT3, KRAS, TGFB2, MIR21, BCL2, TP53, FOXP3, GRB2, ADRB2, PTGS2 / TGFB1, CEBPA, Malat1, AHA1, and MMP14, preferably one of the following genes: HTT, SOD1, MFSD8(CLN7), SMN1, SMN2, TTR, Malat1, AHA1, or MMP14.

[0190] In subsequent embodiments compatible with the preceding embodiments, saponin components or pharmaceutical compositions for use disclosed herein are provided, wherein the nucleic acid therapeutic agent is preferably an oligonucleotide therapeutic agent capable of silencing genes or inactivating gene products (e.g., inhibiting mRNA or miRNA, or being an aptamer such as pegatinib), and more preferably the oligonucleotide therapeutic agent is nusinersen (ASO for SMN2 splicing in SMA), inotercene (TTR in hATTR) ASO for (A) , aprontersen (ASO for TTR in hATTR), butrysilane (siRNA for TTR in hATTR), patisirane (siRNA for TTR in hATTR), tofersen (ASO for SOD1 in ALS), QRX-704 (ASO for HTT), jasifsen (ION-363, ASO for FUS), tominersen (IONIS-HTTRx or RG6042, ASO for HTT), WVE-003 (ASO for HTT), dyrganersen (alexiac) ASOs for GFAP in Thunder disease, cimdelirsen (ASO for GHR in acromegaly), ATL-1102 (ASO for CD49d in relapsing MS), BIIB-080 (ASO for tau / MAPT in Alzheimer's disease, frontotemporal degeneration, and AD dementia), GTX-102 (ASO for UBE2A), ION-464 (ASO for SNCA), ION-541 (ASO for ATXN2), ION-859 (ASO for LRRK2) IONIS-PKKRx (ASO for KLKB1), STK-001 (ASO for splicing SCN1A), WVE-004 (ASO for C9orf72), Travedersen (ASO for TGFB2), ISTH-0036 (ASO for TGFB2), STP-705 (siRNA for PTGS2 / TGFB1), Dambatilsen (ASO for STAT3), AZD-8701 (ASO for FOXP3), siG-12D-LODER (siRNA for KRAS), IONISAR-2.5Rx (ASO for AR), SR-063 (siRNA for AR), plexijebersen (ASO for GRB2), MTL-CEBPA (saRNA for activated CEBPA), oblimersen (ASO for Bcl-2 in melanoma), rademircene (anti-miR-21), homivirsen (ASO for CMV virus IE2), pegatinib (aptamer that binds to and blocks VEGF), bevacilanib (siRNA for VEGF-A), siRNA-027 (siRNA for VEGFR-1), aga The group consists of nilsen (ASO for IRS1), sepofalsen (ASO for CEP290 splicing), rufepilsen (CODA-001, ASO for connexin 43 (GJA1)), IONIS-FB-LRx (ASO for CFB), QR-1123 (ASO for RHO), urtebrusen (QR-421a, ASO for USH2A), QPI-1007 (siRNA for NAION), cibanishirane (siRNA for TRPV1), and bamosirane (siRNA for ADRB2).

[0191] An overview of oligonucleotide therapeutics and their indications can be found in Table 2B.

[0192] [Table 21]

[0193] [Table 22]

[0194] [Table 23]

[0195] [Table 24]

[0196] [Table 25]

[0197] In the following embodiments, which are compatible with the preceding embodiments, a saponin component or pharmaceutical composition for use disclosed herein is provided, wherein the first endocytosis receptor and / or the second endocytosis receptor are - CD71 (transferrin receptor), - CD63 (tetraspanin), - IGF1R (Insulin-like growth factor 1 (IGF-I) receptor), - InsR (insulin receptor), - GLUT4 (glucose transporter), - CI-MPR (cation-independent mannose 6-phosphate receptor), - LDL receptor, - TGFβ receptor, - EGFR, - Tropomyosin receptor kinase A (TrkA) receptor (NGF receptor), - IL13-R (interleukin-13 receptor), - AMPAR / NMDAR (AMPA and NMDA glutamate receptors) - Vascular endothelial growth factor receptor 1 or 2 (VEGFR1 or VEGFR2), - STRA6 (Retinol-binding protein (RBP) receptor) Selected from.

[0198] Receptors particularly suitable for the applications disclosed herein are: transferrin receptor (CD71), tetraspanin (CD63), insulin-like growth factor 1 (IGF-I) receptor (IGF1R), InsR (insulin receptor), glucose transporter GLUT4, cation-independent mannose 6-phosphate receptor (CI-MPR), LDL receptor, TrkA receptor, IL13-R, AMPAR / NMDAR, TGFb receptor, vascular endothelial growth factor receptors 1 and 2 (VEGFR1 and VEGFR2), and STRA6 (retinol-binding protein (RBP) receptor). STRA6 is of interest for retinal cell delivery, for example, because it is expressed on retinal pigment epithelial (RPE) cells.

[0199] Further examples of known cell surface receptors include CD71, CD63, CA125, EpCAM(17-1A), CD52, CEA, CD44v6, FAP, EGF-IR, integrin, syndecan-1, vascular integrin alpha-V beta-3, HER2, EGFR, CD20, CD22, folate receptor 1, CD146, CD56, CD19, CD138, CD27L receptor, prostate-specific membrane antigen (PSMA), CanAg, integrin-alpha-V, CA6, CD33, mesothelin, Cripto, CD3, CD30, and CD239. These include CD70, CD123, CD352, DLL3, CD25, Ephrin A4, MUC-1, Trop2, CEACAM5, CEACAM6, HER3, CD74, PTK7, Notch3, FGF2, C4.4A, FLT3, CD38, FGFR3, CD7, PD-L1, CTLA-4, CD52, PDGFRA, VEGFR1, VEGFR2, c-Met(HGFR), EGFR1, RANKL, ADAMTS5, CD16, CXCR7(ACKR3), and glucocorticoid-inducible TNFR-related protein (GITR). For example, preferred endocytic cell surface receptors for tumor targeting are HER2, c-Met, VEGFR2, CXCR7, CD71, EGFR, and EGFR1.

[0200] In the following embodiments, which are consistent with the preceding embodiments, a saponin component or pharmaceutical composition for use disclosed herein is provided, wherein the first ligand and / or second ligand are - An antibody or a conjugated fragment thereof that binds to any one of the receptors listed in the preceding embodiments, - A native ligand or fragment thereof recognized by any one of the receptors listed in the preceding embodiments. Selected from, preferably, the first ligand and / or the second ligand are - Transferrin (Tf) or fragments thereof recognized by CD71, - Insulin or fragments thereof - Insulin-like growth factor 1 (IGF-I) or a fragment thereof, - Insulin-like growth factor 2 (IGF-II) or its fragments, - Mannose 6-phosphate, preferably multiple units thereof, - Glucose, preferably multiple units thereof, for example, zymosan A, - TGFβ or a fragment thereof, - EGF or fragment thereof, - Neurotrophin (nerve growth factor, NGF) or fragments thereof - Interleukin-13 (IL-13) or its fragments, - Glutamic acid or its multiple units, - Vascular endothelial growth factor A (VEGF-A) or its fragments, - Retinol (vitamin A) or other forms of vitamin A, - Retinol-binding protein (RBP) or a fragment thereof, - Antibodies or their conjugate fragments that bind to endocytosis receptors selected from CD71, CD63, IGF1R, GLUT4, CI-MPR, and LDL receptors. The first ligand and / or second ligand are selected from the above, more preferably an antibody or a conjugation fragment thereof that binds to CD71, even more preferably a monoclonal or single-domain antibody that binds to CD71, and most preferably a monoclonal antibody that binds to CD71.

[0201] In embodiments of the present invention, the effector portion is one of the effector molecules defined above herein, covalently bonded as follows: - A linker selected from one or more linkers defined above for the saponin portion, - A linker, for example, a linker as defined above, having further molecules covalently bonded to it. The aforementioned further molecules are defined as defined above with respect to the saponin portion, and are one or more of the following: d. Further linkers, for example, the linkers defined above in this specification. e. A ligand for binding to endocytosis cell receptors. This ligand is a proteinogenic ligand, a non-proteinogenic ligand, or a combination thereof. A proteinogenic ligand is, for example, a. A protein ligand capable of binding to a cell surface receptor, wherein the binding results in the internalization of the protein ligand, such as cytokines or EGF. b. The antibody for the saponin portion as defined above. That is the case.

[0202] In embodiments of the present invention, the effector component comprises an effector moiety conjugated with a ligand for binding to an endocytic cell surface receptor, wherein the effector component comprises the same ligand as the saponin component, or the effector component comprises a ligand different from the ligand composed of the saponin component. When the ligands composed of the effector component and the saponin component are different, these different ligands typically both bind to the same endocytic cell surface receptor present on the same cell. Such endocytic receptors may be the same endocytic receptor or two different endocytic receptors.

[0203] For example, a ligand composed of an effector component may be an antibody capable of binding to a first tumor cell-specific receptor present on tumor cells, and a ligand composed of a saponin component may be an antibody or a ligand such as EGF capable of binding to a second tumor cell-specific receptor present on the same tumor cells.

[0204] In preferred embodiments, the saponin component includes an oligonucleotide therapeutic agent.

[0205] In a preferred embodiment, the saponin component includes a ligand that can bind to endocytic cell surface receptors.

[0206] In preferred embodiments, the oligonucleotide component includes a ligand capable of binding to endocytic cell surface receptors.

[0207] In a preferred embodiment, the saponin component comprises both a ligand capable of binding to an endocytic cell surface receptor as defined herein and an oligonucleotide as defined herein.

[0208] A preferred embodiment is a therapeutic combination of any one of the saponin components defined above and any one of the oligonucleotide components defined above, or a therapeutic composition comprising these.

[0209] A preferred embodiment is a therapeutic combination of any one of the saponin components defined above and any one of the oligonucleotide components defined above, or a therapeutic composition comprising these.

[0210] A preferred embodiment is a therapeutic combination or therapeutic composition comprising any one of the saponin components defined herein above (the saponin component comprising the ligand defined herein above) and any one of the oligonucleotide components defined herein above (the oligonucleotide component comprising the ligand defined herein above) for targeting endocytic cell surface molecules present on the same cells as the endocytic cell surface, which are targeted by ligands comprising saponin components.

[0211] A preferred embodiment is a saponin component comprising a saponin moiety and an oligonucleotide.

[0212] A preferred embodiment is a saponin component consisting of saponin molecules.

[0213] A preferred embodiment is an oligonucleotide component consisting of an oligonucleotide molecule.

[0214] A preferred embodiment is a therapeutic combination of a saponin molecule and an oligonucleotide molecule, or a therapeutic composition containing them.

[0215] A preferred embodiment is a therapeutic combination of any of the saponin component a defined above and any one of the oligonucleotide components defined herein, or a therapeutic composition comprising them.

[0216] A preferred embodiment is a therapeutic composition comprising or consisting of an oligonucleotide and a saponin component comprising a ligand as defined herein above.

[0217] Any one of the therapeutic compositions preferably comprises a therapeutically acceptable excipient and / or a therapeutically acceptable diluent.

[0218] Last but not least, and equally important, this specification provides embodiments of pharmaceutical compositions disclosed herein, further comprising one or more components selected from: pharmaceutically acceptable excipients and / or pharmaceutically acceptable diluents, and / or analgesics, and / or immunosuppressants, and / or anti-inflammatory agents, and / or antibiotics. Anti-inflammatory agents include, but are not limited to, non-steroidal anti-inflammatory agents such as bromfenac, nepafenac, ketorolac, diclofenac, flurbiprofen, corticosteroids such as dexamethasone, difluprednate, loteprednol, fluocinolone, fluorometholone, triamcinolone, rimexolone, prednisone, prednisolone, and ligitegrast, which are integrin antagonists. Immunosuppressants include, but are not limited to, antimetabolites such as azathioprine, methotrexate, and mycophenolate mofetil; calcineurin inhibitors such as cyclosporine, tacrolimus, and voclosporine; alkylating agents such as cyclophosphamide and chlorambucil; TNF inhibitors such as etanercept, infliximab, and adalimumab; lymphocyte inhibitors such as rituximab and abatacept; interferons such as interferon alfa; and interleukin antagonists such as the IL-1 antagonist anakinra and the IL-2 antagonist decrizumab. Examples of antibiotics include, but are not limited to, ofloxacin, moxifloxacin, levofloxacin, ciprofloxacin, gatifloxacin, azithromycin, becifloxacin, tobramycin, polymyxin b, trimethoprim, trifluridine, vidarabine, gentamicin, chloramphenicol, neomycin, erythromycin, and bactiricin. Examples of analgesics include, but are not limited to, the nonsteroidal anti-inflammatory drugs and corticosteroids mentioned above, as well as local anesthetics such as tetracaine, propalacine, and lidocaine.

[0219] CNS and CNS-specific uses Central nervous system disorders represent a significant burden on patients, their families, and society, and are associated with high costs. The majority of these disorders are related to the brain.

[0220] In accordance with the foregoing, particularly advantageous embodiments provide a saponin component or (neuro) pharmaceutical composition, the organ being part of the central nervous system (CNS), preferably the brain.

[0221] The complexity of the brain makes identifying causes difficult, and often both genetic and environmental factors play a role in their pathophysiology. The importance and recognition of genetic components can differ among neurodegenerative disorders, for example, Huntington's disease is clearly associated with the huntingtin (HTT) gene, while other diseases, such as Alzheimer's disease (AD) and amyotrophic lateral sclerosis (ALS), involve lesions in many different genes, or have larger environmental components, such as Parkinson's disease (PD). In oncology, the location and size of tumors within the CNS are factors that influence the severity of the disability and the chances of survival. Glioblastoma (GBM) is one of the best-known cancers in the CNS and is also one of the most deadly.

[0222] For both oncological and other CNS disorders such as neurodegenerative disorders in the CNS, reaching the target site is challenging because the brain is protected by the blood-brain barrier (BBB), limiting access to pharmacological interventions. In particular, the BBB makes standard systemic administration routes, such as intravenous or subcutaneous administration, virtually impossible for oligonucleotide therapies. As a result, other administration routes, including, to name a few, epidural, intrathecal, intraventricular, or intranasal delivery, must be considered. For oncological disorders, postoperative injection into the tumor lumen may also be considered. Anatomically, the brain and spinal cord are covered by four membranes called meninges, whose function is to protect the central nervous system. Starting from the area furthest from the brain's nerve tissue and spinal cord, these are the dura mater (the meninge closest to the skull and vertebral column), the arachnoid mater, the subarachnoid lymphoid membrane (SLTM), and the pia mater. The arachnoid mater and pia mater are sometimes collectively called the pia mater.

[0223] Typically, three distinct spaces are defined with respect to the dura mater and pia mater. The first and outermost is the epidural space, between the skull or vertebral column and the dura mater of the brain and spinal cord. The spinal cord ends between the first and second lumbar vertebrae, where only cerebrospinal fluid is present. This is a relatively safe site for performing epidural injections and is the site of lumbar puncture ("spinal puncture"), which is frequently used for analgesics and anesthesia. Below the epidural space is the subdural space between the dura mater and the arachnoid mater, which is not a space under normal conditions but can open in the case of cerebral hemorrhage or other medical conditions. The last one is the subarachnoid space between the arachnoid mater and the pia mater, which is filled with cerebrospinal fluid (CSF) that buffers and protects the brain and spinal cord and is in direct contact with their tissues and cells. With respect to the above anatomical sites, different administration sites known to medical professionals can be defined.

[0224] In subsequent embodiments consistent with the preceding embodiments, saponin components or (neuro) pharmaceutical compositions for use disclosed herein are provided, wherein administration comprises a postoperative injection into a tumor lumen formed after surgery, selected from the epidural, intrathecal, ventricular, cisterna magna, intraparenchymal, and / or intranasal, preferably the administration is selected from the intrathecal, ventricular, cisterna magna and / or intranasal, and more preferably the administration is intrathecal.

[0225] Due to the possibility of direct access to nerve tissue, the preferred route is intrathecal, which means that administration takes place in the subarachnoid space (having the advantage that the neuropharmaceutical composition containing saponin and effector components reaches the CSF).

[0226] A further advantageous pathway is within the nasal cavity, which uses olfactory neurons to reach the brain. Olfactory neurons are bipolar neurons that extend their dendrites into the mucous layer, terminating as olfactory receptors and protruding into the olfactory bulb. This provides a direct portal between the nose and the central nervous system. Furthermore, their unmyelinated axons are continuous with the meninges and consequently lined with olfactory nerve sheath cells (OECs) and olfactory neurofibroblasts that are continuous with the subarachnoid space (Cassano et al., 2021).

[0227] In a subsequent embodiment compatible with the preceding embodiments, a saponin component or (neuro) pharmaceutical composition for use disclosed herein is provided, administered to the dura mater, or arachnoid mater, or subarachnoid space, or pia mater and / or brain tissue, preferably administered to the arachnoid mater or subarachnoid space, more preferably administered to the subarachnoid space, thereby enabling the neuropharmaceutical composition comprising the saponin component and effector component to reach the CSF.

[0228] Further embodiments conforming to the preceding embodiments provide saponin components or (neuro) pharmaceutical compositions for use disclosed herein, and CNS disorders are treated as follows: - Preferably, a neurodegenerative disorder selected from one or more of the following: Huntington's disease (HD), Alzheimer's disease (AD), Parkinson's disease (PD), amyotrophic lateral sclerosis (ALS), spinal muscular atrophy (SMA), multiple system atrophy (MSA), multiple sclerosis (MS), and / or Lewy body dementia (DLB). - Preferably, a neurological disorder selected from stroke, epilepsy such as Dravet syndrome (DS), and / or spinal cord disorders. - Preferably one or more selected from glioblastoma, meningioma, (oligodendron)glioma, astrocytoma, ependymoma, medulloblastoma, CNS lymphoma, and metastasis to the CNS, more preferably selected from glioblastoma, meningioma, (oligodendron)glioma and / or metastasis to the CNS, - Preferably selected from autoimmune diseases of the CNS, immune-related diseases caused by gene deficiencies, diseases caused by infection or inflammation, and more preferably selected from meningitis, encephalitis, prion diseases and / or COVID-19. - A mental disorder preferably selected from one or more of the following: Tourette syndrome (TS), mood disorders, personality disorders, anxiety disorders, substance use or addiction disorders, obsessive-compulsive disorder, neurodevelopmental disorders, and eating disorders, and more preferably selected from mood disorders which are anxiety disorders, obsessive-compulsive disorder, eating disorders and / or preferably treatment-resistant mood disorders. Selected from.

[0229] In some embodiments compatible with prior embodiments, saponin components or (neuro) pharmaceutical compositions for use disclosed herein are provided, and the CNS disorders are selected from neurological disorders associated with spinal muscular atrophy (for which the therapeutic agent nusinersen has been approved), hereditary transthyretin amyloidosis (hATTR), amyotrophic lateral sclerosis (ALS), preferably SOD1-associated amyotrophic lateral sclerosis (for which the therapeutic agent tophasen has been developed), Huntington's disease (for which the therapeutic agent tominasene has been developed), Alzheimer's disease, Parkinson's disease, Batten disease (for which a proof-of-concept has been made for a personalized therapeutic agent called mirasen), frontotemporal dementia, spinocerebellar degeneration type 3, multiple system atrophy, Rett syndrome, Alexander disease, Angelman syndrome, Lafora disease, GFAP astrocytopathy, prion diseases, and acromegaly.

[0230] Further embodiments compatible with the preceding embodiments provide saponin components or (neuro) pharmaceutical compositions for use disclosed herein, and nucleic acid therapeutics include HTT, LRRK2, SNCA, parkin gene, PINK1, DJ-1, DRP-1, SCN1A, SOD1, TDP-43, FUS, C9orf72, NEK1, UBQLN2, ATXN2, SMN2, SMN1, MAPT (tau gene), APP (amyloid precursor protein gene), BACE1, IL-4, IL-6, IL-7, IL-12RB2, IL-1R1, MBP, MIR29B, AR, FAS, C2orf72 UBE3A, UBE2A, GFAP, DMD, DYN2, DGAT2, MFSD8 (CLN7), TTR, VEGF, e.g., VEGF-A, VEGFR1, VEGFR2, RHO, NF2, CMV virus IE2, CEP290, USH2A, CASP2, TRPV1, RPGR, ITGA4, PCED, USH2A, GJA1, C5, OPA1, TGFB2, RTP801, ADRB2, COCH, VEGF-165, P2RX7, JUN, BAX, APAF1, IKBKB, RDS, GUCY1A1, GUCY1A2, CNG (e.g., CNGA1, CNG) The target is a gene selected from A2, CNGA3, CNGB1, CNGB3), DDIT4, HIF1A, FN1, CTGF, TXNIP, CYP4B1, CNR1 and CNR2, STAT3, KRAS, TGFB2, MIR21, BCL2, TP53, FOXP3, GRB2, ADRB2, PTGS2 / TGFB1, CEBPA, Malat1, AHA1, and MMP14, preferably one of the following genes: HTT, SOD1, MFSD8(CLN7), SMN1, SMN2, TTR, Malat1, AHA1, or MMP14.

[0231] Further embodiments conforming to the preceding embodiments provide saponin components or (neuro) pharmaceutical compositions for use disclosed herein, the nucleic acid therapeutics being nusinersen (ASO for SMN2 splicing in SMA), inotercene (ASO for TTR in hATTR), aprontersen (ASO for TTR in hATTR), butricirane (siRNA for TTR in hATTR), patisirane (siRNA for TTR in hATTR), tofersen (ASO for SOD1 in ALS), Q RX-704 (ASO for HTT), Jasifsen (ION-363, ASO for FUS), Tominersen (IONIS-HTTRx or RG6042, ASO for HTT), WVE-003 (ASO for HTT), Zilganersen (ASO for GFAP in Alexander disease), Atesidorsen, Simderilsen (ASO for GHR in acromegaly), ATL-1102 (ASO for CD49d in relapsing MS), BIIB-080 (Tau / MAP in Alzheimer's disease, frontotemporal degeneration, and AD dementia) ASO for T), GTX-102 (ASO for UBE2A), ION-464 (ASO for SNCA), ION-541 (ASO for ATXN2), ION-859 (ASO for LRRK2), IONIS-PKKRx (ASO for KLKB1), STK-001 (ASO for splicing SCN1A), WVE-004 (ASO for C9orf72), Travedersen (ASO for TGFB2), ISTH-0036 (ASO for TGFB2), STP-705 (ASO for PTGS2 / TGFB1) This is an oligonucleotide therapeutic agent selected from the group consisting of RNA, dambatilsen (ASO for STAT3), AZD-8701 (ASO for FOXP3), siG-12D-LODER (siRNA for KRAS), IONISAR-2.5Rx (ASO for AR), SR-063 (siRNA for AR), plexijebersen (ASO for GRB2), MTL-CEBPA (saRNA for activated CEBPA), oblimersen (ASO for Bcl-2 in melanoma), and rademircene (anti-miR-21).

[0232] In one embodiment compatible with prior embodiments, a saponin component or (neuro) pharmaceutical composition for use disclosed herein is provided, comprising a first ligand and / or a second ligand, wherein the first endocytosis receptor and / or second endocytosis receptor is present on cells and / or tissues within the CNS, preferably the cells being selected from one or more of neurons, astrocytes, oligodendrocytes, microglia, endothelial cells, blood cells and / or tumor cells, more preferably the cells being selected from one or more of neurons, astrocytes, oligodendrocytes, microglia, endothelial cells and / or tumor cells, most preferably the first endocytosis receptor and / or second endocytosis receptor is - CD71 (transferrin receptor), - CD63 (tetraspanin), - IGF1R (Insulin-like growth factor 1 (IGF-I) receptor), - InsR (insulin receptor), - GLUT4 (glucose transporter), - CI-MPR (cation-independent mannose 6-phosphate receptor), - LDL receptor, - TGFβ receptor, - EGFR, - Tropomyosin receptor kinase A (TrkA) receptor (NGF receptor), - IL13-R (interleukin-13 receptor), - AMPAR / NMDAR (AMPA and NMDA glutamate receptors) Selected from.

[0233] In one embodiment adapted to a prior embodiment, a saponin component or (neuro) pharmaceutical composition for use disclosed herein is provided, comprising a first ligand and / or a second ligand, the first ligand and / or the second ligand, - An antibody or a conjugated fragment thereof that binds to any one of the receptors listed in the preceding embodiments, - A native ligand or fragment thereof recognized by any one of the receptors listed in the preceding embodiments. Selected from, preferably, the first ligand and / or the second ligand are - Transferrin (Tf) or fragments thereof recognized by CD71, - Insulin or fragments thereof - Insulin-like growth factor 1 (IGF-I) or a fragment thereof, - Insulin-like growth factor 2 (IGF-II) or its fragments, - Mannose 6-phosphate, preferably multiple units thereof, - Glucose, preferably multiple units thereof, for example, zymosan A, - TGFβ or a fragment thereof, - EGF or fragment thereof, - Neurotrophin (nerve growth factor, NGF) or fragments thereof - Interleukin-13 (IL-13) or its fragments, - Glutamic acid or its multiple units, - Antibodies or their conjugate fragments that bind to endocytosis receptors selected from CD71, CD63, IGF1R, GLUT4, CI-MPR, and LDL receptors. The first ligand and / or second ligand are selected from the above, more preferably an antibody or a conjugation fragment thereof that binds to CD71, even more preferably a monoclonal or single-domain antibody that binds to CD71, and most preferably a monoclonal antibody that binds to CD71.

[0234] Further embodiments compatible with the preceding embodiments provide saponin components or (neuro)pharmaceutical compositions for use disclosed herein, wherein the effector component comprises an oligonucleotide therapeutic targeting one of STAT3, SOD1, Malat1, AHA1, MMP14, TTR and HTT, or an oligonucleotide therapeutic selected from nusinersen, tominersen, tofersen, inotercene, eprontersen, butricilane, patisirane and travedersen, and the saponin component comprises SO1861 or SO1861, wherein the aldehyde functional group at the C-23 position is substituted by an acid-sensitive covalent bond configured to cleave under acidic conditions to produce an aldehyde functional group at the C-23 position of the aglycone core, and preferably the administration is intrathecal and preferably comprises the two-component free saponin formulation, or two-component linker-saponin formulation, or one-component formulation as defined above.

[0235] Eyes and their uses Improving the bioavailability of ocular nucleic acid therapies is one of the further objectives of this disclosure. The solutions presented herein are considered to have the advantage of enabling reductions in the concentration, dose, and optionally injectable volume of existing nucleic acid therapies, which would also preferably lead to a reduction in the failure of clinical trials of novel drugs that are highly promising for ocular delivery but are still not approved.

[0236] Accordingly, in certain embodiments compatible with the prior embodiments, saponin components or pharmaceutical (ophthalmic) compositions for use disclosed herein are provided, where the organ is the eye and the disorder is further referred to as an ophthalmic disorder.

[0237] Despite its peripheral location, the nerve portion of the eye (retina) is classified as part of the CNS (Purves D et al., 2001). The eye, brain, and spinal cord are related organs that developmentally derive from the same embryonic CNS precursor in all vertebrates, known as the neural tube (Marchesi et al., 2021). The eye shares neural similarities not only with the brain but also with blood vessels, and the blood-retinal barrier (BRB) is very similar to the blood-brain barrier (BBB), both of which are composed of non-fenestrated endothelial cells linked by tight junctions (Jindal, 2015). In particular, neurodegenerative conditions of the central nervous system (CNS), including Alzheimer's disease (AD) and Parkinson's disease (PD), show characteristic changes at the ocular level (Guidoboni, 2020), and a significant number of ocular disorders exhibit characteristics of neurodegenerative diseases at the histopathological and / or gene expression levels, indicating a correlation between retinal biobarkers and neurological conditions including AD, PD, ALS, multiple sclerosis (MS), and prion diseases (Yap et al., 2019).

[0238] Simply put, for example, glaucoma is a progressive optic nerve degeneration and can be considered a neurodegenerative disorder of both the eye and the brain (Chan, 2021; Stein, 2021). AMD, in addition to causing visual recognition difficulties, is associated with a higher rate of cognitive decline and a higher risk of dementia (Zhuang, 2021; Ashok, 2020). For example, there is also evidence that retinitis pigmentosa (RP) correlates with a significant reduction in gray matter volume, mainly in the occipital cortex of RP patients (Rita Machado, 2017). ALS is a fatal, progressive loss of upper motor neurons located in the brain and brainstem, as well as lower motor neurons located in the spinal cord. Autopsies of ALS patients frequently show asymmetric contralateral damage and axonal degeneration of retinal ganglion cells, along with significant thinning of the retinal nerve fiber layer (RNFL) and a decrease in overall macula thickness (Soldatov, 2021).

[0239] The above similarities are further supported by the fact that many genes associated with neurodegeneration are also associated with retinal diseases, which is not considered unexpected in this field, given that the retina shares an ontogenetic relationship with the brain (Soldatov, 2021). An example of a CNS / ocular disease-related gene product is the antioxidant enzyme superoxide dismutase 1 (SOD1), which is abundant (among other diverse components) in protein inclusions observed in the spinal cord of ALS patients. SOD1 has been reported to protect retinal cells from oxidative damage (Dong et al., 2006), and Sod1-deficient mice exhibit typical characteristics of age-related macular degeneration (AMD) in humans (Imamura et al., 2006). A genetic link exists between glaucoma and ALS, including polymorphic variants of the OPTN, TBK1, PFN1, and ATXN2 genes, and several other genes or their products (including TDP-43, OPTN, and C9ORF72) associated with aggregate formation in motor neurons in ALS have also been linked to visual impairment and / or retinal damage (Soldatov, 2021). Other examples include IncRNA Malat1 (Song & Kim, 2021; Carella et al., 2021; Nasrolahi et al., 2023), which is overexpressed in glaucoma and resembles a non-coding RNA involved in diabetic retinopathy and other retinal lesions, or miR-124 (Liu et al., 2011), which is known to be involved in neurogenesis in both optic vesicles and the forebrain.

[0240] The above-mentioned obvious similarities between the eye and other organs of the CNS are highly specific to the anatomical structure of the eye and its surrounding structures; however, to better understand the eye-related embodiments of this disclosure, the following definitions are provided.

[0241] Definitions related to ophthalmic use As used herein, in relation to administration, the terms “topical” or “topical to the eye” should be interpreted as including any one of the following routes of administration: directly onto the eyeball (i.e., “topically”), or inside the eyeball (i.e., “intraocular”), or near the eyeball (i.e., “periocular”). Typically, a pharmaceutical composition is introduced from any container or other device (examples of containers or other devices include applicators, syringes, capsules, strips, etc.) that it is held in prior to the administration action, so as to come into contact with the surface of the eyeball, or is introduced inside or in the periocular space (i.e., around the eyeball, e.g., the space within the orbit). Examples of such topical administration include topical administration to the surface of the eyeball (e.g., by eye drops or ointment formulations), subconjunctival injection or implant placement in any periocular zone, most preferably intraocular injection and / or implant placement, e.g., administration near the eyeball by intravitreal, choroidal, etc.

[0242] As used herein, in relation to administration, the term “intraocular” shall be understood to include administration to any structure (including layers, tissues, parts, or chambers, etc.) located within the eyeball, typically involving passage through the fibrous layers of the eyeball, i.e., through either the sclera or the cornea. In accordance with this definition, the following routes shall be understood as non-limiting examples of intraocular administration: into the anterior chamber, sclera or intrasclera, suprachoroidal, subretinal, vitreous, intravitreous, etc.

[0243] As used herein, for example in relation to the route of administration by injection, the term “intra-chamber” should be interpreted as referring to local intraocular administration into any of the spaces containing aqueous humor, usually into the anterior chamber of the eye. Intra-chamber injection may be called ICM injection.

[0244] To better understand local delivery to the eye, the eye is often seen as having two parts: the anterior segment and the posterior segment.

[0245] As used herein, the term “anterior segment” is synonymous with “anterior cavity” and should be interpreted to mean (roughly) the anterior third of the eye, including the following ocular structures located in front of the vitreous fluid: the cornea, iris, ciliary body, and lens. The anterior segment contains two spaces filled with an aqueous fluid, also called “aqueous humor” as used herein. These spaces are: (i) the anterior chamber, located between the posterior surface of the cornea and the iris, and (ii) the posterior chamber, located between the iris and the anterior surface of the vitreous fluid. In accordance with the foregoing, as used herein, the term “posterior chamber” shall be used to mean the posterior chamber of the anterior segment of the eye. Similarly, the term “anterior chamber” shall be interpreted to mean the anterior chamber of the anterior segment of the eye.

[0246] The aqueous humor, which fills both the anterior chamber spaces (i) and (ii), is a clear, watery fluid similar to plasma but with a lower protein concentration, and contains immunoglobin. The aqueous humor provides nutrients (e.g., amino acids and glucose) to the perivascular structure of the eye, maintains intraocular pressure, expands the eyeball, and prevents dryness of the eye. The aqueous humor is continuously produced by the ciliary body, and its production is balanced by the trabecular network with equal drainage rates. The aqueous humor is usually 15 mmHg higher than atmospheric pressure, so when injected into the anterior chamber with a syringe, it flows easily.

[0247] As used herein, for example in relation to the route of administration by injection, the term “intra-atrial” should be interpreted as referring to local intraocular administration into any of the spaces containing aqueous humor, usually into the anterior chamber of the eyeball. Intra-atrial injection may be called ICS injection.

[0248] Aqueous humor should not be confused with "vitreous fluid," which is located in the space between the lens and the retina. This space is also known as the "vitreous chamber" and is located inside the "posterior segment" or "posterior cavity" of the eyeball (eye).

[0249] As used herein, the terms “posterior segment” and “posterior cavity” should be interpreted as synonymous with the posterior two-thirds of the eye, which includes the vitreous cavity containing the vitreous fluid, the layer of collagen covering the vitreous fluid and further referred to as the “hyaloid membrane” (synonymous with the terms “vitreous membrane” or “vitreous cortex”), and all the structures of the eye posterior to the anterior part of the hyaloid membrane, including the retina, choroid, and optic nerve.

[0250] As used herein, the term "vitreous fluid" is synonymous with the term "vitreous body" or simply "vitreous," and refers to the thick, transparent, gel-like substance encapsulated within the hyaloid membrane that maintains the shape of the eye. The vitreous body contains 99% water and no cells to allow effective light passage without deflection toward the retina. As used herein, the term "anterior hyaloid membrane" refers to the portion of the hyaloid membrane that separates the vitreous body from the lens, while the term "posterior hyaloid membrane" refers to the portion of the hyaloid membrane that separates the vitreous body from the retina.

[0251] In line with the above, the eye (referring to the eye of a human or other vertebrate) is thought to contain three chambers: the anterior chamber, the posterior chamber, and the vitreous chamber. The eye can also be thought of as having two parts (cavities) on either side of the lens: the anterior segment and the posterior segment. Both the anterior and posterior chambers are located in the anterior space, while the vitreous chamber is located in the posterior space. The vitreous chamber is the largest of the three chambers and is located behind the lens and in front of the optic nerve and retina.

[0252] As used herein, in relation to administration, the term “intravitreous” should be interpreted as referring to a local form of intraocular administration, such as by injection, into the vitreous fluid (i.e., the vitreous body or simply the vitreous). An intravitreous injection may be referred to as an IVI injection.

[0253] As used herein, in relation to administration, the term “periocular” shall be understood as administration within the space defined by the orbit or where the orbit ends, i.e., the medial space of the eyelid, which is usually the space between the sclera and the orbital wall, involving administration in the vicinity of the eyeball. Consistent with this definition, the following routes shall be understood as non-limiting examples of periocular administration: subconjunctival, subtenon (sub-tenon or sub-Tenon's), e.g., anterior or posterior subtenon, near the sclera, e.g., posterior near the sclera, periocular, posterior, etc.

[0254] As used herein, in relation to administration, the term “topical” shall be understood to mean a superficial, or usually non-invasive, administration to the eyeball, i.e., the cornea and / or sclera.

[0255] Embodiments and circumstances related to ophthalmic applications Eye disorders are a major disease burden worldwide. They are frequently associated with aging, and consequently, their incidence and complexity are constantly increasing along with the increase in life expectancy in the human population. Age-related macular degeneration (AMD), glaucoma, dry eye, cataracts, and temporal arteritis are some typical conditions that affect the aging eye. Regardless of age, they can also be caused by other underlying conditions such as diabetes, the example being diabetic retinopathy (DR), or they can be caused by a genetic condition of the underlying condition, such as retinitis pigmentosa (RP), Leber congenital amaurosis (LCA), and USH2A retinopathy (Singh et al., 2018). Regarding the pathophysiological origin, eye disorders can be infectious, inflammatory, and / or autoimmune in nature.

[0256] Ocular neuronal degeneration is the primary cause of irreversible blindness in glaucoma, AMD, DR, and RP, for example, although varying degrees of degeneration are observed in the majority of eye disorders, ultimately including Stargardt disease, cone-rod dystrophy, and color blindness (Jindal, 2015; Ahmad et al., 2020). Furthermore, consistent with the established histological and physiological relationships between the eye and the rest of the CNS, there is ample evidence that most neurodegenerative processes in the latter also tend to involve retinal neurons in their pathogenesis (Yap et al., 2019).

[0257] The eye is a complex organ with internal structures arranged concentrically in three tissue layers: from the outside, the sclera and cornea; in the center, the vascular layer called the uvea (subdivided into the iris, ciliary body, and choroid); and on the innermost layer, the retina, which is an extension of the nerve tissue of the brain itself (Purves D et al., 2001). Eye disorders can result from any one of these layers. For example, in diabetic retinopathy, the site of damage is in the endothelium of the retinal blood vessels. In retinoblastoma, the cells of origin are thought to be neuropyrean precursors (Bremner & Sage, 2017), while in many other disorders, including early-onset retinal dystrophy known as macular retinopathy and several types of hereditary RP, the causative mutations are thought to result in genes expressed in the retinal pigment epithelium (RPE or simply "retinal epithelium").

[0258] RPE is a monolayer of pigmented cells that absorb light focused on the retina and directly cover the photosensitive outer segments of rods and cones. It forms part of the BRB and delivers nutrients and ions to photoreceptors via richly expressed transcytosis receptors such as Na, K-ATPase, GLUT1, GLUT3, insulin, and transferrin (CD71) receptors. It also performs cis / trans retinal reisomerization necessary to maintain photoreceptor excitability and secretes immunosuppressive factors that support the immune privilege of the eye. Mutations in genes expressed in RPE (e.g., MerTK or RPE65) can lead to photoreceptor degeneration, and vice versa (e.g., ABCR expressed in photoreceptors). In fact, the functions of RPE and photoreceptors are so closely related and interdependent that these cell types are often considered to be a single functional unit within the retina (Strauss 2005). The above is perhaps best reflected by the fact that the accumulation of photo-oxidation products in RPE is considered to be the underlying cause of AMD, the most prevalent retinal disease in the Western world and the most common cause of blindness in developed countries (Kevany & Palczewski, 2010) (Wong et al., 2014).

[0259] Depending on the etiology, there are many different treatment options for eye disorders, and depending on the given drug, there are also different formulations and routes of administration.

[0260] Advances in our understanding of the molecular basis of eye diseases and their underlying genetic factors have led to the development of numerous nucleic acid-based therapies for eye treatment. A comprehensive overview of these therapies can be found in Guzman-Aranguez et al., 2013, British Journal of Pharmacology, 170:730-747. Doi:10.1111 / bph.12330.

[0261] For severe, incurable eye diseases, considerable hope currently lies in inducing RNA interference (RNAi), a process in which short non-coding RNAs (siRNA or miRNA) cooperate with cytosolic proteins to disrupt gene expression by causing degradation or translational repression of target mRNA (Lam JKD et al., Mol Ther Nucleic Acids, 2015). However, the clinical use of RNAi and other nucleic acid-induced therapeutic effects is known to be hindered by the insufficient bioavailability of these therapeutics due to their high sensitivity to enzymatic hydrolysis, rapid elimination from the circulatory system, extremely low cellular uptake, and potential immunogenicity and other off-target effects (Cai X et al., 2017).

[0262] To overcome these drawbacks, various vector systems for nucleic acid delivery have been developed, which can be divided into viral and nonviral types. Compared to nonviral vectors, viral vectors have limited payload capacity and higher potential immunogenicity. Consequently, nonviral vectors are not only more socially accepted but are also considered safer and more preferable due to their lower immunogenicity and associated costs. Many types of nonviral vectors exist, such as polymers and peptides, and have so far proven to be promising tools for gene delivery due to their ability to incorporate ligands for targeting specific cell types (Vicentini FTMDC et al. Pharm Res 2013).

[0263] Due to considerations of stability and clearance, the choice of administration route is a crucial factor for nucleic acid-based therapeutics. Methods of delivering ophthalmic drugs are primarily divided into systemic and topical administration, i.e., periorbital or intraocular administration. Compared to topical administration, systemically administered drugs are usually prevented from entering the eye due to the presence of the blood-ocular barrier (Patel et al., 2010; Cabrera et al., 2019) and are more likely to trigger a systemic immune response (Urtti, 2006). Consequently, topical administration is often the only option for treating many eye disorders.

[0264] Local ocular administration can be divided into non-invasive and invasive routes. Invasive routes offer better control over drug delivery and dose control.

[0265] While non-invasive methods such as eye drops may seem like an easy approach to treating anterior segment eye disorders, topical ocular administration of therapeutic nucleic acids faces many challenges due to nuclease degradation and the fact that the anterior segment exhibits continuous tear flow, leading to faster clearance. The above process further limits the bioavailability of nucleic acid therapeutics, which requires more frequent drug administration and potentially raises issues of patient adherence and safety from a long-term management perspective. Consequently, current formulation strategies for topical ocular therapeutics aim to increase tear film retention (e.g., for the treatment of dry eye) in order to achieve the desired therapeutic outcome. Further considerations for selecting topical delivery include whether the drug can be absorbed by the cornea or conjunctiva (e.g., for the treatment of keratitis or conjunctivitis), or whether it can penetrate and infiltrate the cornea and / or conjunctiva to reach deeper target tissues such as the trabecular network, iris, or ciliary body. As a result, if local administration fails, intra-chamber (ICM) injection or ICM implant insertion may be considered, but this is far more complex and requires skilled personnel (Liebmann et al., 2020).

[0266] The delivery and uptake of therapeutic nucleic acids into the posterior segment of the eye is further challenging, primarily due to their deeper placement within the skull (and thus further limiting their ability to reach affected cells), anatomical and physiological separation from the anterior chamber, and especially the high degree of neovascularization in the retina. For example, in the case of topical intravenous therapies for treating retinal epithelium (RPE), they would need to be able to pass through both aqueous and vitreous humor to reach their target site. Consequently, in the case of posterior segment treatment, nucleic acid-based drugs are typically administered intraocularly, intravitreously, or less frequently via subretinal pathways, or particularly in areas surrounding the eyeball but still within the bony orbit.

[0267] Examples of intravitreous deliverable nucleic acid therapies approved by the U.S. FDA include homivirsen (Vitravene®), a 21-nucleotide phosphorothioate antisense oligodeoxynucleotide for the treatment of cytomegalovirus retinitis, and pegaptanib (Macugen®), a VEGF-targeted aptamer for the treatment of neovascular age-related macular degeneration. Several other nucleic acid-based therapies currently in different stages of clinical development include bevacilanib, a VEGF-targeted siRNA developed by Opko Health Inc., VEGF receptor 1 (VEGFR1)-targeted siRNA-027 developed by Allergan for the treatment of neovascular eye diseases such as age-related macular degeneration, and RTP801-targeted siRNA developed by Quark Pharmaceuticals for the treatment of diabetic retinopathy and corneal neovascularization. PF-655 is one example. In addition to VEGF and VEGFR1 and 2, other known potential targets for nucleic acid-based intraocular therapies include RhoA, cochrine (COCH), Na-K-ATPase, purine receptor P2Y2, c-Jun, apoptosis regulator Bax, Apaf-1, caspase-2, TGF-β2 and IκB kinase β (IKKβ) for glaucoma, rhodopsin, delayed retinal degeneration (RDS) peripherin, guanylate cyclase 2 and cyclic nucleotide-sensitive ion channels for retinitis pigmentosa, RTP801 for AMD and HIF1A for DR, fibronectin, connective tissue growth factor (CTGF) and thioredoxin-interacting protein (TXNIP) (Guzman-Aranguez et al., 2013).

[0268] With regard to the invasive route of topical ocular administration, the advantages of this composition stem from its potential to reduce the volume or overall size of the therapeutic load that needs to be introduced into or around the eye. This not only may result in fewer or less severe side effects, but also contributes to less patient discomfort and thus may have a more positive impact on treatment adherence. Furthermore, as the bioavailability of therapeutic nucleic acids increases at lower doses, treatment is generally expected to become more efficient, and therefore the frequency of repeated injections or implant insertions may be reduced.

[0269] Advantageous invasive routes for local ocular delivery include intraocular and periocular routes.

[0270] In some embodiments compatible with prior embodiments, saponin components or pharmaceutical (ophthalmic) compositions for use disclosed herein are provided, wherein the administration is intraocular, preferably selected from intrascleral, superchoroidal, subretinal, anterior chamber, intravitreal, and vitreoretinal, more preferably comprising one selected from anterior chamber injection, anterior chamber implant, intravitreal injection, subretinal injection, intravitreal implant, and scleral plug, even more preferably the administration is intravitreous, even more preferably the administration comprises intravitreal injection or intravitreal implant, and most preferably the administration comprises intravitreal injection.

[0271] Alternative potential routes for drug delivery include periorbital administration, encompassing subconjunctival, sub-Tenon's capsule, posterior-ocular, periorbital, and near-posterior-scleral delivery routes. Drugs delivered via these routes may be delivered to different layers of the eye in a specific order, depending on the source concentration and the barrier properties of these and other intermediate layers between the administration site and the target. Periorbital delivery routes are potentially attracting attention as a safer alternative for delivering drugs to the retina while avoiding the risk of intraocular damage associated with intravitreal injection. While the risk of systemic drug exposure increases, it remains considerably lower compared to systemic or topical drug delivery. Therefore, periorbital delivery may allow for the delivery of drugs at high concentrations to the desired site with a relatively long duration of action, while avoiding most systemic side effects.

[0272] Accordingly, possible embodiments compatible with the prior embodiments provide saponin components or pharmaceutical (ophthalmic) compositions for use disclosed herein, wherein topical administration is periorbital, preferably subconjunctival, and more preferably subconjunctival injection or subconjunctival implant.

[0273] Although there are still some limitations to the periorbital pathway, such as lower bioavailability of drugs in the retina compared to the intravitreous pathway, it still offers the advantage of bypassing the blood-tissue barrier. Furthermore, the provision of saponin components according to this disclosure appears to allow for at least partial removal of them, even when administered in separate formulations.

[0274] Similar considerations apply to non-invasive routes involving local application.

[0275] Non-invasive administration routes minimize eye damage. Therefore, non-invasive treatments are preferred by healthcare professionals and patients whenever possible. However, due to their low bioavailability, this route is often less suitable for nucleic acid therapeutics, yet it still offers the advantage of bypassing the blood-tissue barrier and can be explored in combination with the saponin components disclosed herein. Therefore, topical application routes still have potential value for developing ophthalmic compositions and saponin components for use according to this disclosure, as they can offer significant benefits to patients, even with limited delivery options. This is because invasive administration routes are unfortunately usually painful, lead to numerous side effects, and are therefore associated with poor medication adherence (Geroski et al., 2001). Consequently, there is also a need to improve bioavailability in topical ophthalmic treatments, and the saponin components and compositions presented herein appear well-suited to address this objective as well.

[0276] Accordingly, in possible embodiments compatible with the prior embodiments, saponin components or pharmaceutical (ophthalmic) compositions for use disclosed herein are provided, and topical administration is topical and preferably comprises one of the following: eye drops, ointments, and a lens adapted to release the pharmaceutical composition.

[0277] Regarding local pathways, the disclosed compositions have the potential to reduce the toxicity associated with the high concentrations of various components otherwise required for higher nucleic acid doses. Furthermore, because they generally increase the bioavailability of therapeutic agents upon delivery to the target zone, they can correct, to some extent, human error in self-medication protocols. Last but not least, and equally important, because they can be formulated as milder and less aggressive compositions, they are likely to contribute to improved patient adherence to medication.

[0278] The choice of delivery route for nucleic acid therapeutics ultimately depends on the location of the diseased area within the eye. Based on anatomical location, the eye disorder can be associated with the anterior or posterior segment of the eye.

[0279] Common anterior segment eye diseases include dry eye, blepharitis, conjunctivitis, infections, cataracts, or various types of trauma. Some of the most common posterior segment eye diseases include glaucoma, neovascular eye diseases such as AMD, and retinal or choroidal diseases, including congenital disorders such as choroidal neovascularization (CNV) or diabetic retinopathy (DR) and retinitis pigmentosa (RP).

[0280] In some embodiments compatible with prior embodiments, saponin components or pharmaceutical (ophthalmic) compositions for use disclosed herein are provided, wherein the ocular disorder is a disorder of the posterior segment of the eye, preferably a disorder of the retina, choroid, optic nerve, or vitreous body, more preferably the disorder is selected from one or more of the following: glaucoma, posterior uveitis, posterior scleritis, retinitis, exudative or atrophic age-related macular degeneration (AMD) such as neovascular AMD (nvAMD, also known as exudative AMD), geographic atrophy, diabetic retinopathy, diabetic or non-diabetic macular edema, choroidal neovascularization, retinoblastoma, and congenital disorders of the retina, choroid, optic nerve, or vitreous body, and even more preferably a congenital disorder of the retina selected from one of the following: retinitis pigmentosa (RP), Leber congenital amaurosis (LCA), USH2A retinopathy, and neurofibromatosis type 2 (NFT2).

[0281] In certain embodiments compatible with prior embodiments, saponin components or pharmaceutical (ophthalmic) compositions for use disclosed herein are provided, where the ocular disorder involves abnormalities in the retinal pigment epithelium (RPE). For example, many of the aforementioned disorders of the posterior segment of the eye already fall into this category, as they typically exhibit not only typical features of neurodegeneration but also abnormal changes and / or depositions in the RPE. For example, AMD lesions are characterized by macular atrophy of the RPE (Horani et al., 2019, Horani et al., 2020) and yellowish extracellular deposits of lipids and proteins between the RPE and Bruch's membrane (called drusen, thought to cause retinal cell abnormalities exhibiting photoreceptor degeneration and Müller glial activation). RPE abnormalities are generally also often observed in so-called “macular dystrophy,” which historically combines a group of diseases that may be unrelated but are inherited in a Mendelian manner, and which, like AMD, begin to show lesions within the macula when symptoms first appear. Examples of macular dystrophy include Stargardt disease (involved gene: ABCA4), Stargardt-like dominant macular dystrophy (ELOVL4), pattern dystrophy (PRPH2), Best macular dystrophy (BEST1), Sorsby fundus dystrophy (TIMP3), autosomal dominant radial drusen (EFEMP1), North Carolina macular dystrophy, macular cystic dystrophy, dominant cystoid macular edema, and fenestrated glossy macular dystrophy (gene unknown). Consistent with the above, approaches targeting abnormal processes such as gene expression in other cell types, such as RPE, as well as ocular neurons, may occupy a position in specific embodiments of this disclosure as treatments for different forms of ocular degenerative diseases, particularly those resulting in blindness.

[0282] For anterior segment eye diseases, conventional topical ophthalmic delivery systems typically aim for non-invasive local administration. In fact, direct infusion of siRNA into the ocular surface has typically been attempted in vivo for the treatment of ocular surface and anterior segment disorders (Crooke et al., 2009; Martin-Gil et al., 2012). Exemplary formulations include various forms of eye drops, such as ointments, gels or solutions, suspensions or emulsions. The first RNAi-based compound administered to humans as eye drops was SYL040012, a β2-adrenergic receptor (ADRB2) targeted siRNA developed by Sylentis for the treatment of glaucoma. Currently, several other nucleic acid-based therapeutics are in various stages of clinical development utilizing this delivery route.

[0283] Further embodiments compatible with the preceding embodiments provide saponin components or pharmaceutical (ophthalmic) compositions for use disclosed herein, wherein the ocular disorder is a disorder of the anterior segment of the eye, preferably selected from one or more of the following: anterior uveitis, iritis, blepharitis, conjunctivitis, palpebral conjunctivitis, keratitis, anterior scleritis, episcleritis, dry eye disease, cataract, corneal abrasion, corneal neovascularization, and trauma to the anterior segment or part thereof.

[0284] The treatment of posterior segment eye diseases such as age-related cancerous disease (AMD) or diabetic retinopathy (DR) presents particularly challenging problems for ophthalmologists due to the complex anatomical structure and physiology of the eye. This specialized organ is composed of various static and dynamic barriers that limit drug delivery to the target site of action. Despite much effort, effective intraocular drug delivery remains unresolved, and therefore, improving current treatments for diseases affecting the posterior space is highly desirable.

[0285] Further embodiments compatible with the preceding embodiments provide saponin components or pharmaceutical (ophthalmic) compositions for use disclosed herein, wherein the ophthalmic disorder is selected from cytomegalovirus retinitis infection, age-related macular degeneration (AMD), autosomal dominant retinitis pigmentosa, Leber hereditary optic neuropathy, Stargardt disease, Usher syndrome, ophthalmic disorders associated with acromegaly, or ophthalmic disorders associated with myotonic dystrophy.

[0286] Further embodiments compatible with the preceding embodiments provide saponin components or pharmaceutical (ophthalmic) compositions for use disclosed herein, where nucleic acid therapeutic agents include VEGF, e.g., VEGF-A, VEGFR1, VEGFR2, RHO, NF2, CMV virus IE2, CEP290, USH2A, CASP2, TRPV1, RPGR, ITGA4, PCED, USH2A, GJA1, C5, OPA1, TGFB2, RTP801, TTR, MAPT (tau gene), APP (amyloid precursor protein gene), BACE1, IL-4, IL-6, IL-7, AR, FAS The target genes are selected from ADRB2, COCH, VEGF-165, P2RX7, JUN, BAX, APAF1, IKBKB, RDS, GUCY1A1, GUCY1A2, CNG (e.g., CNGA1, CNGA2, CNGA3, CNGB1, CNGB3), DDIT4, HIF1A, FN1, CTGF, TXNIP, CYP4B1, CNR1 and CNR2, STAT3, KRAS, TGFB2, MIR21, BCL2, TP53, FOXP3, GRB2, ADRB2, PTGS2 / TGFB1, CEBPA, Malat1, AHA1, and MMP14.

[0287] Further embodiments compatible with the preceding embodiments provide saponin components or pharmaceutical (ophthalmic) compositions for use disclosed herein, which are nucleic acid therapeutic agents. Homivirsen (ASO for CMV virus IE2), pegatinib (aptamer that binds to and blocks VEGF), bevacilanib (siRNA for VEGF-A), siRNA-027 (siRNA for VEGFR-1), aganilsen (ASO for IRS1), sepofalsen (ASO for CEP290 splicing), lufepilsen (ASO for CODA-001, connexin 43 (GJA1)), IONIS-F B-LRx (ASO for CFB), QR-1123 (ASO for RHO), Urtebrusen (ASO for QR-421a, USH2A), QPI-1007 (siRNA for NAION), Cibanishirane (siRNA for TRPV1) and Vamosirane (siRNA for ADRB2), Trabedersen (ASO for TGFB2), ISTH-0036 (ASO for TGFB2), STP-705 (for PTGS2 / TGFB1) The treatment is an oligonucleotide therapy selected from the group consisting of (siRNA against), dambatilsen (ASO for STAT3), AZD-8701 (ASO for FOXP3), siG-12D-LODER (siRNA for KRAS), IONISAR-2.5Rx (ASO for AR), SR-063 (siRNA for AR), plexijebersen (ASO for GRB2), MTL-CEBPA (saRNA for activated CEBPA), oblimersen (ASO for Bcl-2 in melanoma), rademircene (anti-miR-21), inotercene (ASO for TTR in hATTR), aprontersen (ASO for TTR in hATTR), butricirane (siRNA for TTR in hATTR), patisirane (siRNA for TTR in hATTR), atesidorsen, simderilsen (ASO for GHR in acromegaly), or An oligonucleotide therapeutic agent designed to reduce or inhibit the expression of VEGF, preferably VEGF-A, or preferably one of its receptors selected from VEGFR1 or VEGFR2, or Preferably, the oligonucleotide therapeutic agent is designed to induce exon skipping of the human RPGR gene, or the SH2A gene, or the NF2 gene.

[0288] In a subsequent embodiment compatible with the preceding embodiments, a saponin component or pharmaceutical (ophthalmic) composition for use disclosed herein is provided, comprising a first ligand and / or a second ligand, wherein the first endocytosis receptor and / or the second endocytosis receptor is present on cells and / or tissues within the eye, preferably the cells being retinal cells or retinal vascular cells, and most preferably the first endocytosis receptor and / or the second endocytosis receptor is selected from the following: - CD71 (transferrin receptor), - CD63 (tetraspanin), - IGF1R (Insulin-like growth factor 1 (IGF-I) receptor), - InsR (insulin receptor), - GLUT4 (glucose transporter), - CI-MPR (cation-independent mannose 6-phosphate receptor), - LDL receptor, - TGFβ receptor, - EGFR, - Vascular endothelial growth factor receptor 1 or 2 (VEGFR1 or VEGFR2), - STRA6 (Retinol-binding protein (RBP) receptor).

[0289] In a subsequent embodiment compatible with the preceding embodiment, a saponin component or pharmaceutical (ophthalmic) composition for use disclosed herein is provided, comprising a first ligand and / or a second ligand, the first ligand and / or the second ligand, - An antibody or a conjugated fragment thereof that binds to any one of the receptors listed in the preceding embodiments, - A native ligand or fragment thereof recognized by any one of the receptors listed in the preceding embodiments. Selected from, preferably, the first ligand and / or the second ligand are - Transferrin (Tf) or fragments thereof recognized by CD71, - Insulin or fragments thereof - Insulin-like growth factor 1 (IGF-I) or a fragment thereof, - Insulin-like growth factor 2 (IGF-II) or its fragments, - Mannose 6-phosphate, preferably multiple units thereof, - Glucose, preferably multiple units thereof, for example, zymosan A, - TGFβ or a fragment thereof, - EGF or fragment thereof, - Vascular endothelial growth factor A (VEGF-A) or its fragments, - Retinol (vitamin A) or other forms of vitamin A, - Retinol-binding protein (RBP) or a fragment thereof, - Antibodies or their conjugate fragments that bind to endocytosis receptors selected from CD71, CD63, IGF1R, GLUT4, CI-MPR, LDL receptor, VEGFR1, VEGFR2, and STRA6. The first ligand and / or second ligand are selected from the above, more preferably an antibody or a conjugation fragment thereof that binds to CD71, even more preferably a monoclonal or single-domain antibody that binds to CD71, and most preferably a monoclonal antibody that binds to CD71.

[0290] In certain embodiments compatible with prior embodiments, saponin components or pharmaceutical (ophthalmic) compositions for use disclosed herein are provided, the effector components comprising oligonucleotide therapeutics targeting one of STS3, SOD1, Malat1, AHA1, MMP14, TTR and HTT, or homivirsen, pegatinib, inotercene, aprontersen, butricirane, patisirane, sepofalsen, QR-421a, urtebrusen, cibanishiran and QPI-10 An oligonucleotide therapeutic agent selected from 07, wherein the saponin component is preferably SO1861 or SO1861, wherein the aldehyde functional group at the C-23 position is substituted by an acid-sensitive covalent bond configured to cleave under acidic conditions to produce an aldehyde functional group at the C-23 position of the aglycone core, most preferably administered intravitreously, and preferably comprises a two-component free saponin preparation, a two-component linker-saponin preparation, or a one-component preparation. [Examples]

[0291] The following examples illustrate the broad applicability of topical co-administration of various saponin components and various oligonucleotides. In summary, these examples demonstrate that co-administration of saponin components and oligonucleotides significantly improves their efficacy: (1) In related target tissues, including but not limited to the central nervous system and the eyes, including examples of treatment for sporadic and hereditary (familial) hereditary disorders and non-hereditary disorders that benefit from gene / RNA regulation and various types of cancer originating from or spreading to the CNS or the eyes, (2) By targeting disease-related genes for preferred tissues, including but not limited to STAT3, SOD1, Malat1, AHA1, MMP14, and TTR, (3) By targeting these genes (e.g., PMO, or phosphorothioate-modified (PS) 2'-MOE ASO, or PS 2'-locked nucleic acid (LNA) ASO, or siRNA with different stabilizations) using various oligonucleotide modalities, and enabling different mechanisms of action, for example, (a) Exon skipping, (i) results in premature termination codons and nonsense-mediated mRNA decay (RNA degradation), or (ii) Modification of a viable transcript, followed by exon skipping to induce a frameshift resulting in a different / functional protein (isoform), or (b) Splice site blocking to induce alternative splicing / abnormal transcripts that result in RNA degradation, or (c) by stimulating RNA cleavage (degradation) through the recruitment of ribonuclease (RNase) H to cleave the RNA strand of the DNA-RNA double helix, or (d) By post-transcriptional arrest or silencing of the gene expression of target mRNA using siRNA, (4) By using specific pentacyclic 12,13-dehydrooleanane type saponin components rather than steroid(like) saponins / molecules, (5) By using a specific pentacyclic 12,13-dehydrooleanane-type saponin component that is free / unconjugated (e.g., SO1861, or SO1861-AH-block, or SO1861-SC-Mal) or covalently conjugated (e.g., for any oligonucleotide such as ASO-SC-SO1861, Cet-SO1861-STAT3_ST6 PMO, Cet-SO1861-STAT3_ST2 PMO, or GN3-SC-SO1861), i.e., co-administered with or without a cell receptor targeting ligand, (6) In vivo administration routes such as intravitreous (IVT) and intraventricular (ICV) are examples, but are not limited to, other routes of administration.

[0292] The data presented herein demonstrate that pentacyclic 12,13-dehydrooleanane saponin components, whether directly conjugated, ligand-conjugated, or unconjugated, enhance the potency of oligonucleotide therapeutics delivered to CNS or ocular tissues without inducing / substantially increasing therapy-related neurotoxicity. The data also suggest that direct conjugation of oligonucleotide therapeutics with pentacyclic 12,13-dehydrooleanane saponin components appears beneficial for reaching specific brain regions, particularly those far from the injection site or less exposed to CSF ​​flow. It is shown that such covalent conjugations further ensure the desired synchronization of cellular delivery between the oligonucleotide therapeutic and the saponin component, thereby resulting in improved therapeutic efficacy compared to ASO administered co-administered with a saponin, as well as ASO alone. Last but not least, the data further suggest that ligand-targeted conjugates of oligonucleotide therapeutics and pentacyclic 12,13-dehydrooleanane saponins ("one-component conjugates") are particularly advantageous for carrying out endosomal enrichment and synchronous delivery of the saponin component and therapeutic payload to the same cellular compartment.

[0293] Example 1: Enhancement of in vivo efficacy by topical co-administration of saponin components and ASO compounds in the brain / CNS. Malat1 (also known as MALAT1) is involved in the pathology of Parkinson's disease and is known to enhance the stability of alpha-synuclein protein, which leads to aggregation and Lewy body formation, resulting in neuronal degradation. Malat1 acts as a decoy to suppress miR-124, leading to enhanced apoptotic signaling. This effect causes neurodegeneration (Liu et al., 2017; Front. Biosci. (Landmark Ed) 2019, 24(7), 1203-1240). It also plays an important role in proliferative vitreoretinopathy, influencing apoptosis of retinal ganglion cells in glaucoma rats by regulating the PI3K / Akt signaling pathway (Li et al., Long Non-Coding RNA-MALAT1 Mediates Retinal Ganglion Cell Apoptosis Through the PI3K / Akt Signaling Pathway in Rats with Glaucoma, Cellular Physiology and Biochemistry (2018) 43(5):2117-2132, 2017), and targeting Malat1 alleviates retinal neurodegeneration in diabetic mice (Zhang et al., Targeting long non-coding RNA MALAT1 alleviates retinal neurodegeneration in diabetic mice, Int J Ophthalmol 2020, 13(2), 213-219).

[0294] In vivo trial design Male C57Bl / 6 mice (n=15, 7-8 weeks old upon arrival) were randomly assigned to five treatment groups (n=3). Mice received 10 μL of their assigned treatment solution, i.e., vehicle (PBS), SO1861 (2.23 μg), Malat1-ASO (10 μg), Malat1-ASO (3 μg), or Malat1-ASO (3 μg) + SO1861, administered unilaterally via intraventricular (ICV, right ventricle) in combination according to Table A1. Mice were euthanized on day 10 of the study after administration. The brains were immediately dissected and separated into cerebral (left / right), cerebellar, and brainstem tissue samples. Tissue samples were stored in RNALater for 24 hours and then frozen at -80°C until analysis of Malat1 RNA expression levels.

[0295] [Table 26]

[0296] Analysis of Malat1 in brain tissue shows that topical co-administration of ASO and a saponin component significantly enhances the efficacy of ASO (Figure 1). For this purpose, Malat1 RNA expression after topical ICV administration of either 10 μg Malat1 ASO or 3 μg Malat1 ASO, or co-administration of 3 μg Malat1 ASO + saponin component SO1861 into the right ventricle, was compared with control conditions (SO1861 alone and vehicle group) in different brain regions near or peripheral to the injection site. Co-administration of 3 μg Malat1 ASO + SO1861 resulted in a significant reduction in Malat1 RNA levels not only in tissues near the injection site (right cerebrum) but, surprisingly, also in the tissues most distal to the injection site (brainstem). Most importantly, when compared to dose-matched conditions (i.e., 3 μg Malat1 ASO, without SO1861, approximately 83.7% Malat1 RNA), treatment with SO1861 alone also reaches approximately 85.3% Malat1 RNA in the right cerebrum. In contrast, the effect of topical co-administration of 3 μg Malat1 ASO + SO1861 is not only greater (44.3% remaining Malat1), but even greater than the effect of a 3.33 times higher ASO dose in the right cerebrum (10 μg Malat1 ASO, 72.3% remaining Malat1 RNA). Even in the left cerebrum (further away from the injection site due to cerebrospinal fluid (CSF) flow), topical co-administration of 3 μg Malat1 ASO + saponin component SO1861 remains the most potent condition for reducing Malat1 RNA levels, and this co-administration also has a significant effect in the cerebellum (least exposed to CSF ​​flow). In particular, even in the brainstem, the most distal brain region and the one furthest from the injection site but heavily exposed to CSF, local co-administration of 3 μg of Malat1 ASO + SO1861 had a comparable RNA reduction size (45.0% of remaining Malat1) to that of the right cerebrum. In conclusion, the Malat1-ASO (3 μg) + SO1861 combination effectively reduced Malat1 expression in all brain regions tested compared to the vehicle and SO1861 alone.The combination of Malat1-ASO (3 μg) + SO1861 showed improved efficacy in the brainstem and right cerebrum compared to Malat1 ASO (10 μg and 3 μg, respectively). Both dose-dependent effects of Malat1 ASO and synergistic effects of the combined dose of Malat1-ASO (3 μg) + SO1861 were observed in the brainstem and right cerebrum.

[0297] Example 2: Specificity of enhancement of ASO efficacy by co-administration with the saponin component according to the present invention, compared to steroid(like) saponin / molecule as measured by the efficacy of Malat1 mRNA knockdown in nerve cell lines. To evaluate the specificity of the enhancing effect of saponin components on ASO-induced Malat1 RNA reduction in co-administration, Malat1 ASO was titrated in Neuro-2a cells with either the saponin component SO1861 or a fixed amount of a different steroid(like) saponin / molecule (digitonin, digoxin, and tomatine) (Figure 2A). Surprisingly, in this setting, only co-administration of Malat1 ASO with the saponin component SO1861 resulted in a significant reduction in Malat1 mRNA and an IC50 shift of approximately four orders of magnitude compared to all other co-administrations of ASO with ASO alone or with the steroid(like) saponins / molecule digitonin, digoxin, and tomatine (Figure 2A). More noteworthy, even a dose of approximately 30 nM of ASO in co-administration with the saponin component SO1861 (at 1 μM) resulted in complete loss of Malat1 mRNA. Neither digitonin, digoxin, nor tomatine (all at 1 μM) enhanced the efficacy of Malat1 ASO in co-administration compared to ASO alone. Even at 20,000 nM ASO, Malat1 RNA was still measurable (approximately 10-15%) for co-administration of ASO with digitonin, digoxin, or tomatine, or for ASO alone. This indicates that the co-administration enhancing effect in neurons is specific to the saponin component SO1861 and is not observed with the steroid(like) saponin / molecule digitonin, digoxin, and tomatine. Next, to explore the minimum dose of saponin component required to achieve maximum enhancement in co-administration, titrations were performed of saponin components (SO1861 or SO1861-AH-block) or steroid(like) saponin / molecule digitonin, digoxin, glycyrrhizin, and tomatine with a fixed amount of 200 nM ASO (Figure 2B). This analysis showed that co-administration of the saponin component SO1861 resulted in significant mRNA reduction and complete loss even at relatively low doses: exposure concentrations of SO1861 less than 650 nM were sufficient to reveal the near-complete potency of 200 nM ASO (i.e., >95% mRNA reduction). Saponin component SO1861-AH-blocking is also effective when compared to ASO alone or to steroid(like) saponins / molecules.In contrast, digoxin, glycyrrhizin, and tomatine showed no enhancing effect when co-administered with 200 nM ASO. No reduction in mRNA was observed at any of the exposure concentrations tested. As expected, digitonin (known to permeate the plasma membrane) showed approximately 70% reduction in Malat1 mRNA at a relatively high dose of 10,000 nM, and therefore was less effective against SO1861-AH-blocking, an endosomal selective escape enhancer that had already achieved complete loss of Malat1 mRNA expression above 3200 nM.

[0298] Example 3: Enhancement of the efficacy of covalently conjugated ASO saponin components in nerve cells. To improve and synchronize the delivery of ASO and saponins to the same cell / compartment, ASO was directly (covalently) conjugated to SO1861 via an SC-containing linker, thereby providing a saponin component containing covalently bound ASO. Neurons (Neuro-2a) were treated with either the ASO-SC-SO1861 conjugate or ASO alone as a comparator, and Malat1 mRNA reduction was measured (Figure 3). This revealed that the covalent conjugation improved the IC50 from 160 nM without the saponin component to 60 nM with the saponin component. More importantly, while 4000 nM of ASO alone achieved only a 70% reduction in Malat1 mRNA expression, surprisingly, the 2000 nM ASO-SC-SO1861 conjugate already showed a complete (100%) reduction in Malat1 mRNA expression (Figure 3). This data indicates that the synchronization of ASO and SO1861 via covalent conjugation results in improved efficacy in neuronal cell lines, and that the conjugation of saponin molecules to the payload does not create limiting (inhibitory) factors. In contrast, such co-delivery by delivery of saponin components including the conjugated ASA optimizes in vivo / intracellular distribution by delivering ASO and saponin together to the same cells and cell compartments, thereby ensuring enhanced efficacy.

[0299] Example 4: Enhancement of the efficacy of Sod1-targeted PMO by co-administration of saponin components in nerve cells. Mutations in SOD1 are associated with familial amyotrophic lateral sclerosis (ALS), and knockout of mutant SOD1 is associated with disease improvement. Therefore, reducing mutant SOD1 RNA has emerged as a potential therapeutic. Tofersen (Qalsody), an ASO that targets mutant SOD1 RNA, was approved by the FDA in 2023. Here, we evaluated the knockdown-enhancing effect of a saponin component on the efficacy of PMO in reducing Sod1 RNA in neuronal cell lines. For this purpose, we designed a splice site that blocks SOD1 PMO (SEQ ID NO: 20) to induce abnormal Sod1 transcripts, thereby resulting in an early termination codon (i.e., effectively reducing Sod1 mRNA). PMOs were added to Neuro-2a cells in dose ranges with or without a fixed amount of the saponin component (SO1861-SC-Mal), and the levels of abnormal Sod1 RNA transcripts were determined by PCR. In particular, PMO alone (without the saponin component) did not induce abnormal Sod1 transcripts even at the highest concentration (50 μM PMO, Figure 4). However, remarkably, co-administration of PMO + 3 μM of the saponin component (SO1861-SC-Mal) resulted in a significant increase of up to 90% in abnormal Sod1 transcripts at 50,000 nM (Figure 4). Co-administration of a second PMO (SEQ ID NO: 23), which binds to a different region on Sod1 mRNA but is designed to induce the same effect, with the saponin component yielded similar results in the induction of large amounts of abnormal Sod1 transcripts (data not shown). This indicates that such co-administration of PMO and the saponin component enhances the delivery of PMO to neurons, thereby beneficially inducing abnormal transcripts of disease-related genes for the purpose of reducing the expression of mutant and pathogenic genes in neurons, and in this example, leading to the prevention or treatment of ALS by nucleic acid therapy.

[0300] Example 5: In vivo evaluation of the tolerability and efficacy of saponin components containing or not containing an LNA payload in the eye. PS2'-locked nucleic acid (PS2'LNA) ASOs are antisense oligonucleotides (DNA / RNA gapmers) that have a phosphorothioate (PS) stabilized backbone and modified RNA nucleotides within a "gapmer wing" in which a methylene crosslink is introduced between the 2'C and 4'C atoms. PS2'LNA ASOs are generally described as being more toxic (in vitro, but also in vivo in mice and NHP) compared to other 2'-modified PS ASOs (such as 2'-MOE ASO or 2'-OMe PS ASO). In clinical settings, several different PS2'LNA ASOs have been observed to be toxic, accompanied by severe thrombocytopenia, severe hepatotoxicity, and nephrotoxicity (Crooke et al., Antisense technology: A review, J. Biol. Chem., Volume 296, 2021, 100416, 2021). Corneal pachymetry is a non-invasive method for evaluating corneal thickness. The most common cause of corneal thickening over time is edema or swelling.

[0301] In vivo trial design Sixteen male Brown Norway (BN) rats were included in the study. The animals were divided into four groups (3 or 5 animals per group, as shown in Table A2) and received a single intravitreal (IVT) injection of the vehicle or test material. The injection was administered to the right eye (OD), while the left eye (OS) was left untreated and served as the control eye.

[0302] [Table 27]

[0303] On the day of injection, animals underwent clinical examinations including health monitoring using a modified Irwin screen, anterior chamber slit-lamp examination, intraocular pressure (IOP), and corneal thickness measurement, in addition to retinoscopy to confirm that the eye was normal before injection. Subsequently, the animals were anesthetized and 3 μL of vehicle or test material was injected into the vitreous fluid of the right eye. Immediately after each administration, the eye was examined to control its integrity. Slit-lamp and ophthalmic examinations were performed on both eyes before administration and 24 and 72 hours after injection. Weight measurement and health monitoring were performed 24 and 72 hours after injection.

[0304] Effects of LNA and saponin components, or LNA + saponin components administered simultaneously, on the eye As shown in Figure 5, IVT injection of the vehicle did not affect the corneal thickness of the treated right eye over 72 hours, indicating that the injection treatment itself was ineffective. Similarly, IVT injection of either 5 μg of LNA or 3 μg of the saponin component (SO1861) did not cause an increase in corneal thickness of the treated right eye. In all cases, the corneal thickness of the treated right eye was similar to that of the untreated left eye (data not shown). Surprisingly, however, co-administration of LNA + SO1861 (5 + 3 μg) injection caused a significant increase in corneal thickness at 24 hours post-injection, and even more so at 72 hours post-injection. Notably, the untreated left eye did not show corneal thickening (data not shown). This data suggests that saponin components can be administered to the eye without causing edema or swelling on their own. More importantly, this also shows that the corneal thickening process is activated only when saponin compounds and LNA ASO are administered simultaneously, indicating that the saponin component effectively releases LNA.

[0305] Example 6: Enhancement of efficacy by co-administration of saponin components with different antisense oligonucleotide modalities having different mechanisms of action that target disease-related STAT3 genes. Abnormal activation of the transcriptional regulatory gene STAT3 is associated with Alzheimer's disease (AD). Therefore, STAT3 phosphorylation is dramatically increased in the hippocampus of AD mouse models and in postmortem AD brains. Furthermore, STAT3 may act as a transcriptional regulator of BACE1, a key enzyme in amyloid-beta (Aβ) production. Similarly, the STAT protein is activated by phosphorylation in the spinal cord of patients with amyotrophic lateral sclerosis (Ohgomori et al, Differential activation of neuronal and glial STAT3 in the spinal cord of the SOD1G93A mouse model of amyotrophic lateral sclerosis, EJN, Volume 46, Issue 4, August 2017, Pages 2001-2014). STAT3 is also a biologically relevant therapeutic target in H3K27M-mutant diffuse midline glioma (Zhang et al., STAT3 is a biologically relevant therapeutic target in H3K27M-mutant diffuse midline glioma, Neuro Oncol, 2022 Oct 3;24(10):1700-1711.doi:10.1093 / neuonc / noac093). Antisense oligonucleotides targeting STAT3 are currently in clinical development (Hong et al., AZD9150, a Next-Generation Antisense Oligonucleotide Inhibitor of STAT3 with Early Evidence of Clinical Activity in Lymphoma and Lung Cancer, Sci Transl Med. 2015 Nov 18;7(314):314ra185.doi:10.1126 / scitranslmed.aac5272).

[0306] Here, we evaluated the enhancing effect of co-administration of saponin components with different antisense oligonucleotides having different mechanisms of action on the regulation of STAT3 RNA levels. First, mouse neurons were incubated with STAT3_ST6 PMO ([SEQ ID NO: 36]; Zammarchi et al., Antitumorigenic potential of STAT3 alternative splicing modulation, Proc Natl Acad Sci USA. 2011 Oct 25; 108(43): 17779-17784, Published online 2011 Oct 17. doi: 10.1073 / pnas.1108482108 (Zammarchi et al., 2011)) with and without the saponin component. The resulting effects on Stat3 mRNA expression levels were then assessed. STAT3_ST6 PMO has been previously shown to induce nonsense-mediated disruption of STAT3 mRNA by inducing STAT3 exon 6 skipping, which effectively reduces STAT3 mRNA levels in various human cancer cell lines both in vitro and in vivo. Here, as shown in Figure 6A, in mouse neurons, STAT3_ST6 PMO alone induced only minimal reductions (4–7%) in Stat3 mRNA levels at 0.8 μM or 3.1 μM doses. However, co-administration of STAT3_ST6 PMO plus 3 μM of the saponin component (SO1861-SC-Mal) showed significantly improved efficacy, reducing Stat3 mRNA levels by up to 56% with 3.1 μM of STAT3_ST6 PMO (Figure 6A). Even with 0.8 μM PMO plus 3 μM of the saponin component (SO1861-SC-Mal), a reduction of approximately 21% in Stat3 mRNA levels was still observed. This data indicates that saponin components can effectively enhance exon skipping PMOs and reduce Stat3 mRNA levels in nerve cells.

[0307] Next, both STAT3_ST6 PMO and the saponin component (SO1861-SC-Mal) were covalently conjugated to an EGFR-targeting ligand (monoclonal antibody cetuximab, Cet) to obtain Cet-SO1861-STAT3_ST6 PMO. This was then titrated within a dose range for EGFR-expressing A431 cell lines and compared to the dose range of unconjugated STAT3_ST6 PMO with or without the fixed concentration of the saponin component. This confirmed that STAT3_ST6 PMO alone did not show a reduction in STAT3 mRNA levels even at the highest concentration tested, while STAT3_ST6 PMO + 3 μM SO1861-SC-Mal showed a dose-dependent reduction in STAT3 mRNA levels in A431 cells (Figure 6B). Interestingly, the synchronized delivery of STAT3_ST6 PMO and the saponin component (SO1861-SC) to cells in the form of a targeted conjugate Cet-SO1861-STAT3_ST6 PMO showed even greater efficacy, resulting in a dose-dependent reduction of STAT3 mRNA levels at very low concentrations of STAT3_ST6 PMO, with an IC50 of approximately 1 nM (Figure 6B). This data suggests that the saponin component functions effectively after being conjugated and targeted with an exon-skipping PMO to reduce STAT3 RNA levels.

[0308] Next, the inventors evaluated the enhancement of STAT3 expression modification ASO (antisense nucleotides with different mechanisms of action, i.e., ribonuclease H-mediated RNA degradation) by different saponin components (targeted and untargeted). For this purpose, human A431 squamous cell carcinoma cells were incubated with RNA-degrading STAT3-ASO (Hong et al., 2015) and various saponin components (SO1861, SO1861-AH-Maleimide-block, or Cet-AH-SO1861, respectively). Treatment with ASO alone for 48 hours resulted in a significant reduction of STAT3 expression to a residual 32% in A431 cells, while co-administration of ASO in addition to a saponin component (targeted or untargeted) showed a reduction of 11% to 18%, regardless of which saponin component was used (Figure 6C). This data demonstrates that co-administration of RNA degradation-inducing ASOs and saponin components, whether targeted or not, also yields excellent efficacy, providing confidence in the combination and use of different payload types in combination with saponin components to modulate STAT3 mRNA levels.

[0309] Furthermore, the co-administration enhancing effect of saponin components was evaluated against the splice switch-inducing PMO STAT3_ST2 PMO ([SEQ ID NO: 37]). This STAT3_ST2 PMO has been shown to regulate STAT3 preRNA splicing, thereby promoting the expression of STAT3β isoforms beyond STAT3α isoforms that may have beneficial therapeutic effects (Zammarchi et al., 2011). In particular, nusinersen (Spinraza) is an ASO designed to regulate alternative splicing to enable the SMN2 gene to produce a full-length and functionally normal protein, as a treatment for spinal muscular atrophy (SMA), an autosomal recessive disorder caused by loss or mutation of the SMN1 gene and retention of the SMN2 gene. To evaluate the co-administration enhancing effect of saponin components on STAT3_ST2 PMO, human A431 squamous cell carcinoma cells were titrated within the dose ranges of (1) STAT3_ST2 PMO with and without saponin components, (2) Cet-STAT3_ST2 PMO with and without saponin components (a conjugate in which STAT3_ST2 PMO is covalently conjugated to the EGFR-conjugated monoclonal antibody cetuximab), or (3) Cet-SO1861-STAT3_ST2 PMO (a conjugate in which both STAT3_ST2 PMO and the saponin component (SO1861-SC) are covalently conjugated to the EGFR-conjugated monoclonal antibody cetuximab). Since STAT3_ST2 PMO has been previously shown to induce splice switching of STAT3 mRNA from STAT3α to STAT3β (Zammarchi et al., 2011), the levels of STAT3β mRNA expression were determined under different treatment conditions (Figure 6D). This revealed that neither STAT3_ST2 PMO nor Cet-STAT3_ST2 PMO alone showed activity across the entire dose range tested. However, co-administration of STAT3_ST2 PMO plus a saponin component showed dose-dependent efficacy, resulting in a PMO with an apparent IC50 of 1700 nM (Figure 6D).Notably, the targeted Cet-STAT3_ST2 PMO + saponin component (SO1861-SC-Mal) showed the most potent increase in efficacy at a PMO with an IC50 of 0.2 nM, while similarly, the single component (a saponin component containing both Cet-SO1861-STAT3_ST2 PMO, oligonucleotides, and endocytosis cell surface receptor-targeting ligands, referred to herein as monoclonal antibodies) showed the most potent, improved, dose-dependent increase in STAT3β mRNA expression at a PMO with an IC50 of 4.0 nM (Figure 6D).

[0310] In summary, these data indicate that the enhanced effectiveness of targeting disease-related genes (STAT3 in this case) by saponin components can be achieved by different modalities (PMO, ASO), or by conjugating PMO / ASO with or without cell-targeting ligands (endocytosis cell surface targeting ligands), and / or by conjugating saponin components, with different mechanisms of action (exon skipping resulting in RNA degradation by PMO or RNase H-mediated RNA degradation by ASO, or PMO-mediated exon skipping resulting in isoform reduction / increase in another (beneficial) isoform).

[0311] Example 7: Enhancement of efficacy by in vitro co-administration of saponin components with various modified AHA1 and MMP14 siRNAs. Microtubule-associated protein tau (MAPT, tau) forms neurotoxic aggregates that promote cognitive impairment in tauopathies, most commonly Alzheimer's disease (AD). AHA1 has been shown to contribute to tau fibril formation and neurotoxicity via Hsp90. This suggests that therapeutic agents targeting AHA1 may reduce toxic tau oligomers and slow or prevent the progression of neurodegenerative diseases (Shelton et al., Hsp90 activator Aha1 drives production of pathological tau aggregates, Proc Natl Acad Sci USA 2017;114(36):9707-9712). MMP-14 overexpression correlates with the neurodegenerative process in familial amyloidotic polyneuropathy (FAP) (Martins et al., MMP-14 overexpression correlates with the neurodegenerative process in familial amyloidotic polyneuropathy, Dis Model Mech. 2017 Oct 1;10(10):1253-1260), and its upregulation is associated with glioma enlargement. In patients with Alzheimer's disease (AD), MMP-14 has been found to be overexpressed in the brain.

[0312] To evaluate the co-administration enhancing effect of saponin components on siRNA oligonucleotides in human brain cells, Neuro-2a cells were incubated with 2000 nM AHA1 siRNAs having different modifications: (1) modified with 2'O-methyl, (2) the commercially available stabilizing chemical siSTABLE (Thermo Scientific), or (3) the commercially available stabilizing chemical Accel (Thermo Scientific) with or without 1.3 μM of the saponin component (SO1861). After 48 hours of treatment in human brain cells, it was revealed that improved siRNA stability improved the reduction of AHA1 mRNA expression. Co-administration of SO1861 significantly enhanced this effect (Figure 7A). Regardless of modification, co-administration with the saponin component SO1861 was the most effective treatment for all siRNAs.

[0313] In another example, we tested stabilized siRNA against MMP14 (this time using 2'-fluoromodification). We tested the efficacy of the siRNA in human brain cells and the co-administration enhancement effect with a saponin component (SO1861). Treatment with 2000 nM siRNA alone did not reveal any efficacy, but co-administration with the saponin component improved the efficacy of the stabilized siRNA. This data suggests that the efficacy of (stabilized) siRNA can also be enhanced by a saponin component.

[0314] Example 9: Enhancement of in vivo efficacy by local co-administration of saponin components in the brain / CNS and (targeted) ASO / PMO compounds. The pathophysiology of Parkinson's disease and CNS disorders such as familial amyotrophic lateral sclerosis (ALS) are associated with mutations in the MALAT1 and SOD1 genes, and are therefore recognized as potential therapeutic targets for downregulation. Topical co-administration of saponin components significantly enhances the potency of Malat1-targeted ASOs and reduces Malat1 expression levels in several (larger) brain regions of mice (Figure 1). To further indicate which specific brain regions exhibit significant enhancement, Malat1 gene expression was examined in more detail in (structurally and functionally) defined brain regions (Table A8). In addition, to analyze the effects of saponins on different payload types in the brain / CNS, Sod1-targeted PMOs were also tested, and efficacy and tolerability were compared between naked (unconjugated) ASO / PMOs and ligand-conjugated ASO / PMOs, both with and without co-administration of saponin components. Finally, we tested the effects of a single-component approach in vivo, including Malat1 ASO-saponin conjugates (Figure 3), in which ASO, which showed improved activity in vitro in a neuronal cell model, was directly (covalently) conjugated to a saponin component.

[0315] [Table 28]

[0316] [Table 29]

[0317] Figures 12 and 13 show the relative Malat1 mRNA expression in different brain regions of each treatment group, with and without the saponin component, compared to the vehicle treatment group. A significant reduction in CNS Malat1 mRNA expression was observed in almost all brain regions 10 days after unilateral ICV administration of Malat1 ASO combined with saponin (Group B), which was equivalent in efficacy to Study 1 (Figure 1) and confirmed the initial findings. A significant reduction in CNS Malat1 mRNA expression was also observed for the single-component Malat1 ASO-saponin conjugate in almost all brain regions (Groups D and E), and as expected, higher doses were potenter than lower doses, confirming a specific (dose-dependent) effect. The efficacy of high-dose directly conjugated Malat1 ASO-saponin was equivalent to co-administration of Malat1 ASO + saponin component in most brain regions. The potency of targeted ligand-conjugated ASOs (i.e., aCD71-Malat1 ASO conjugated treatment group, group F + group G) was not improved compared to unconjugated ASOs when either was co-administered with a saponin component. While the addition of a saponin component was necessary to unlock the high potency of either aCD71-Malat1 ASO or unconjugated ASO in almost all brain regions, ligand targeting did not significantly contribute to increased potency in the case of this ASO, which has a fully phosphorothioate-treated skeleton. It can be concluded that the saponin component enhances endosomal escape of both unconjugated (naked) and ligand-targeted ASOs with negative skeleton charges.

[0318] Notably, very similar relative efficacy response profiles were observed in all brain regions except the cerebellum for various treatments (Figure 13). Absolute responses (i.e., the magnitude of the response) differed, with the region closest to the injection site (right ventricle) being the most responsive. Thus, the hippocampus (right) showed up to 88% downmodulation of Malat1 for co-administration of Malat1 ASO + saponin (group B), while only 12% downmodulation was observed in the cerebellum. Interestingly, conjugated Malat1 ASO-saponin performed better in the cerebellum than co-administered Malat1 ASO + saponin or other aCD71-Malat1 ASO + saponin treatments, meaning that a greater increase in potency was observed with conjugated ASO-saponin than with co-administration. This suggests that direct conjugation of the ASO and saponin components is beneficial for reaching specific brain regions, including those far from the injection site or less exposed to CSF ​​flow.

[0319] Figures 14 and 15 show the relative Sod1 mRNA expression profiles in different brain regions for different treatment groups with or without a saponin component and with or without antibody conjugation (i.e., aCD71 targeting) of SOD1 PMO, compared to vehicle treatment. Importantly, no downregulation of Sod1 mRNA was observed in any SOD1 PMO treatment group without a saponin component, i.e., under treatment conditions without a saponin component. However, in the presence of a saponin component with a SOD1 PMO compound (i.e., co-administration), a clear and significant reduction was observed in almost all brain regions, with a maximum reduction of 22% in Sod1 mRNA compared to vehicle. Interestingly, and unlike the aCD71-ASO conjugate, the group treated with ligand-conjugated aCD71-SOD1 PMO + saponin (group K) showed a clear increase in potency compared to treatment with unconjugated (naked) SOD1 PMO + saponin (group I). These results suggest that, for (neutral-charged) PMO, the ligand is likely to increase PMO endosomal / cellular uptake, and since the saponin component mediates endosomal release, ligand conjugation, in combination with the saponin component, has a beneficial effect in achieving increased potency. Here again, the strongest response was observed near the injection site in the hippocampus (right) and, as expected, lower in areas away from the injection site and CSF flow (e.g., the cerebellum and cerebral cortex (left) (Figure 15)).

[0320] In conclusion, these analyses demonstrate that saponin components, whether administered simultaneously or via (covalent) conjugation, elucidate and potently enhance the effects of oligonucleotide treatments in the brain / CNS, e.g., ASOs with negatively charged / fully phosphorothioated skeletons or (charge-neutral) PMOs. Depending on the chemical properties and characteristics of the oligonucleotide (e.g., neutral or negative skeleton charge), conjugation to a targeted ligand further improved and / or demonstrated potency (over unconjugated oligonucleotides). Whether directly conjugated, ligand-conjugated, or unconjugated, saponin components increased the potency of oligonucleotides.

[0321] Example 10: Enhancement of the efficacy of covalently conjugated ASO-saponins in nerve cells. Direct (covalent) conjugation of saponin components to ASO (i.e., ASO-saponin conjugate) improves ASO efficacy in neurons because it synchronizes the delivery of ASO and saponin to the same intracellular compartment where the saponin leads to ASO release (Figure 3). To further evaluate and enhance the improvement of ASO efficacy by conjugation of oligonucleotides, e.g., saponin components to ASO, additional experiments were conducted in neurons. For this purpose, unconjugated (naked) ASO was first co-administered with a low dose (400 nM) of saponin (1) (which is of the same type and in a similar amount as the ASO-saponin conjugate). This co-administration was compared to treatment with either the ASO-saponin conjugate or ASO alone (Figure 16A). Cell viability was not affected by either of the applied treatments (data not shown). Notably, and as previously shown, gene expression analysis confirmed that covalent conjugation of saponins to ASO (i.e., ASO-saponin conjugate) significantly improves potency compared to saponins administered (low dose) with ASO alone or co-administered with ASO, as target gene expression levels were completely suppressed only for covalent conjugation at 2000 nM. To confirm the benefit of conjugation, cells were also treated with unconjugated ASO and saponin components (ASO + titration saponin (1)), both of which were titrated at equal compound ratios against the ASO-saponin conjugate at each data point on the curve (Figure 16B). This confirmed that, when compared at equal concentrations, conjugated ASO-saponin was indeed more potent than unconjugated ASO + titration saponin (1). In summary, this data demonstrates that the synchronization of ASO and saponin cell delivery via covalent conjugation results in improved efficacy in neuronal cell lines, not only compared to ASO alone but also to ASO administered co-administered with saponin.

[0322] Example 11: Enhancement of the efficacy of (targeted) ASO by co-administration of saponin components in nerve cells. Neuro-2a cells were treated with Malat1 ASO with and without a saponin component (4 μM saponin(1) or saponin(2)). Gene expression analysis revealed that unconjugated ASO (without the saponin component) resulted in up to a 50% reduction in Malat1 transcripts at 2000 nM ASO (Figure 17A). However, when ASO was administered co-administered with saponin(1), the efficacy increased dramatically by approximately 2000-fold, resulting in a state where a 50% reduction in transcripts was already achieved at approximately 1 nM ASO (Figure 17A). In the second example, unconjugated ASO (without saponin component) resulted in up to a 50% reduction in Malat1 transcripts at approximately 100 nM ASO (Figure 17B), and when ASO was administered co-administered with saponin (2), the efficacy increased by approximately 1000-fold, resulting in a 50% transcript reduction at just 0.1 nM ASO (Figure 17B). Both examples demonstrate a clear and potent increase in efficacy with co-administration of ASO and saponin components.

[0323] To evaluate whether the saponin component enhances the potency of targeted ASOs in the nervous system, Malat1 ASO was conjugated to an aCD71-targeted mAb to obtain aCD71-Malat1 ASO. Neuro-2a cells were treated with this targeted ASO in the presence and absence of the saponin component (4 μM saponin(2)). Interestingly, treatment with only about 10 nM of targeted ASO induced a 50% reduction in Malat1 transcripts (Figure 17C), while targeted ASO (aCD71-Malat1 ASO) + saponin(2) exhibited even higher potency with only 0.01 nM of ASO (absolute concentration in the conjugate), which was sufficient to produce a 50% reduction in Malat1 transcripts. These results suggest that ligand conjugation (i.e., endosomal targeting) of ASO increases its potency, but that the potency enhancement is at least 1000 times greater only when ASO (targeted or untargeted) is combined with a saponin component.

[0324] Example 12: Enhancement of the efficacy of PMO conjugates by saponin components in nerve cells. In Example 4, the inventors demonstrated that treatment of mouse neurons with Sod1-targeted PMO combined with a saponin component significantly enhanced the efficacy of PMO compared to treatment with PMO alone (see Example 4). To confirm and expand upon these findings, the complete efficacy of the treatment was determined by determining the abnormal transcripts and remaining full-length transcripts, i.e., the effect of PMO on the induction of exon skipping or abnormal transcripts and nonsense-mediated mRNA decay. For this purpose, neurons were treated with Sod1 PMO combined with a saponin component. This treatment induced an increase of up to 47% in abnormal transcripts (Figure 18). Determining the amount of remaining full-length Sod1 transcripts after treatment confirmed that, without the saponin component, PMO could not reduce the transcripts. However, in the presence of the saponin component, a 70% reduction in Sod1 transcripts was observed with 1600 nM PMO (Figure 18B). These results indicate that PMO is highly active and induces nonsense-mediated mRNA, but this high on-target activity and potency are only evident in the presence of saponins.

[0325] To evaluate the effect of ligand-mediated uptake (for increasing endosomal PMO content), PMO was conjugated to an aCD71-targeted mAb to obtain aCD71-SOD1 PMO. Neurons were treated with aCD71-SOD1 PMO (compound 2) in the presence and absence of the saponin component to evaluate how the saponin component enhances the activity of targeted aCD71-SOD1 PMO compared to untargeted PMO. After treatment, both untargeted and targeted aCD71-SOD1 PMO showed no activity at any of the concentrations tested (i.e., no abnormal transcript induction (Figure 18C) or nonsense-mediated mRNA decay (Figure 18D)). However, a surprising effect was observed when targeted aCD71-SOD1 PMO was administered co-administered with the saponin component. In the presence of saponins, abnormal transcripts were already detected at 0.18 nM aCD71-SOD1 (equivalent to 0.26 nM PMO), and this increased abnormal transcripts by up to 66% at 114 nM aCD71-SOD1 (equivalent to 160 nM PMO) (Figure 18C). After treating cells with conjugates and co-administering saponin compounds, the amount of remaining full-length SOD1 transcripts was determined to be sufficient at just 0.18 nM aCD71-SOD1 (equivalent to 0.26 nM PMO) to reduce Sod1 expression, and at the maximum concentration tested (114 nM aCD71-SOD1, equivalent to 160 nM PMO), a reduction of over 80% in Sod1 transcripts was measured (Figure 18D).

[0326] In the next step, the saponin component is conjugated to the targeted aCD71-SOD1 PMO at either a high or low conjugation ratio to generate two different single-component conjugates, each being aCD71-(saponin-SOD1 PMO) 高 and aCD71-(saponin-SOD1 PMO) 低were obtained. These conjugates enable targeted (and thus endosomally enriched) and synchronous delivery of the saponin component and the payload to the same cellular compartment. Neurons were treated with these one-component conjugates as well as aCD71-SOD1 PMO (without the saponin compound), and aberrant transcripts were quantified (Figure 18E). The data show that aCD71-(saponin-SOD1 PMO) 低 and aCD71-(saponin-SOD1 PMO) 高 induce aberrant transcripts (already starting at exposure concentrations of 267 nM and 23 nM of the conjugate, respectively). At the highest concentration tested, aCD71-(saponin-SOD1 PMO) 低 achieved 64% aberrant transcripts, aCD71-(saponin-SOD1 PMO) 高 achieved 23% aberrant transcripts, while aCD71-SOD1 PMO (without saponin) had no effect on the Sod1 transcript at any of the concentrations tested (Figure 18E). When determining the efficacy of such conjugates on the reduction of the Sod1 transcript (i.e., measuring the remaining full-length Sod1 transcript), both aCD71-(saponin-SOD1 PMO) 低 and aCD71-(saponin-SOD1 PMO) 高 were very effective in reducing the full-length Sod1 RNA, while aCD71-SOD1 PMO (without saponin) also had no effect. The reduction could be measured starting from the 23 nM aCD71-(saponin-SOD1 PMO) 高 conjugate, which increased to a maximum of 47% reduction in the Sod1 transcript at 571 nM of the conjugate (Figure 18F). aCD71-(saponin-SOD1 PMO) 低 showed a maximum 83% reduction of the Sod1 transcript at 1333 nM of the conjugate. These data show that conjugation of the saponin component enables obtaining the effect of the PMO on the induction of aberrant transcripts and the reduction of the full-length Sod1 transcript.

[0327] Example 13: Enhancement of oligonucleotide efficacy by saponin components in retinal cells The ARPE-19 cell line is a naturally occurring retinal pigment epithelium (RPE) cell line with functional characteristics similar to natural RPE cells, making it a central epithelial cell model in ophthalmic research. Here, we evaluated the enhancement of the knockdown effect of different oligonucleotides targeting CNS / ocular disease-related RNA targets such as MALAT1 and SOD1 by saponin components on a monolayer of ARPE-19 cells. Cell viability was not affected by any of the applied treatments (data not shown). Cells treated with MALAT1 ASO alone showed little to no reduction in MALAT1 expression at relevant concentrations, and only a 30% reduction at 8 μM ASO. However, co-administration with a saponin component clearly enhanced the ASO's efficacy (Figure 19A): with co-administration, a reduction of over 30% in MALAT1 RNA was already observed at 2.5 nM ASO, which increased to nearly 100% knockdown at 320 nM ASO in the presence of the saponin component. To further demonstrate these findings and relevance, we tested an ASO targeting human SOD1 (a SOD1 ASO with the same sequence and modifications as the FDA-approved ASO tofersen (marketed under the brand name Qalsody)). Tofersen is a mixed scaffold structure consisting of a 5-10-5 MOE gapmer. It is composed of 19 internucleotide bonds, 15 of which are 3'-O to 5'-O phosphorothioate diesters, and the remaining 4 are 3'-O to 5'-O phosphate esters. Treatment with this ASO alone resulted in a mere 41% reduction in SOD1 expression at 8 μM ASO (Figure 19B). When this ASO was co-administered with a saponin component, a clear enhancement of efficacy of at least 100-fold was observed, with a 50% reduction at approximately 64 nM ASO and again almost complete knockdown at 320 nM ASO in the presence of the saponin component.

[0328] Next, SOD1 ASO was conjugated to an aCD71-targeted mAb to obtain aCD71-SOD1 ASO. ARPE-19 cells were treated with this targeted ASO with and without co-administration of a saponin component (Figure 19C). Cell viability was not affected by either treatment (data not shown). However, aCD71-SOD1 ASO treatment also did not result in downregulation of SOD1 at any of the concentrations tested. Importantly, when targeted ASO (i.e., aCD71-SOD1 ASO) was co-administered with a saponin component, the potency was significantly increased (IC50 of ASO at 1–10 nM), achieving an even greater enhancement factor than (unconjugated) ASO + saponin treatment. In summary, these data indicate that saponin components can enhance the potency of targeted ASO as well as unconjugated ASO in retinal cells.

[0329] PMO(1) and PMO(2) were selected to evaluate whether the saponin component enhances the potency of a neutral-charged oligonucleotide payload against the same target (SOD1) in retinal cells. These PMOs were designed to induce exon skipping of exon 2 and (exon 3 + exon 2 / 3), respectively, which leads to an immature stop codon in exon 4. Two different targeted PMOs were generated, consisting of an aCD71-targeted mAb and either PMO(1) or PMO(2), yielding aCD71-PMO(1) and aCD71-PMO(2), respectively. The conjugates were evaluated on ARPE-19 retinal cells in the presence and absence of the saponin component. Cell viability was not affected by either of the applied treatments (data not shown). Even without treatment, ARPE-19 retinal cells were shown to exhibit low levels of basal exon skipping activity (approximately 3% SOD1 exon 2 skipping). Interestingly, treatment with aCD71-PMO(1) did not enhance this exon skipping at any of the concentrations tested (Figure 20A). However, co-administration of aCD71-PMO(1) plus the saponin component not only increased exon skipping even at very low concentrations, i.e., already 0.02 nM PMO (equivalent to a 0.01 nM conjugate), but also enhanced exon skipping by up to 28% at 320 nM PMO (or 160 nM conjugate). Similarly, treatment with aCD71-PMO(2) alone did not result in exon skipping of exon 3 or exon 2 / 3 at any of the tested concentrations without the saponin component (Figure 20B). Here too, in the presence of the saponin component, aCD71-PMO(2) also showed clear exon skipping at very low concentrations exceeding just 0.02 nM PMO (equivalent to a 0.01 nM conjugate), with exon skipping enhanced by up to 46% at 320 nM PMO (or 160 nM conjugate). In addition to exon skipping, the amount of residual full-length SOD1 gene product was determined by quantitative PCR. These analyses revealed the full potency of the applied treatment, as it measures the combined effect of the treatment (i.e., exon skipping and nonsense-mediated mRNA decay).This analysis confirmed that the targeted PMO conjugate is active in the presence of the saponin component (Figure 20C), and that in the presence of the saponin compound, a minimum amount of PMO (as part of the aCD71-PMO conjugate) is sufficient to induce a significant reduction in the amount of full-length SOD1 transcript. Notably, in the presence of the saponin component, the maximum combined effect of aCD71-PMO(1) and aCD71-PMO(2) on exon skipping and nonsense-mediated mRNA decay resulted in an 80% and 91% reduction in full-length SOD1 transcript, respectively, at the highest concentrations of targeted PMO tested.

[0330] Materials and methods Abbreviation Ab antibody AH Acylhydrazone bond AEM N-(2-aminoethyl)maleimidotrifluoroacetate AMPD 2-amino-2-methyl-1,3-propanediol BOP (benzotriazole-1-yloxy)tris(dimethylamino)phosphonium hexafluorophosphate Cet cetuximab d2 Divalent dendron (2nd generation) DAR drug-antibody ratio DBCO (Dibenzocyclooctin) DCM Dichloromethane DIPEA N,N-diisopropylethylamine DMF (N,N-dimethylformamide) DMSO (Dimethyl Sulfoxide) DTT (Dithiothreitol) EDCI.HCl 3-((ethylimino)methyleneamino)-N,N-dimethylpropane-1-aminium chloride EDTA (Ethylenediaminetetraacetic acid) EMCH.TFA N-(ε-maleimidocaproic acid)hydrazide, trifluoroacetate GalT β-1,4-galactosyltransferase Y289L HATU 1-[bis(dimethylamino)methylene]-1H-1,2,3-triazolo[4,5-b]pyridinium 3-oxide hexafluorophosphate IPA Isopropyl Alcohol Mal Maleimide min mTz methyltetrazine MWCO Molecular Weight Cutoff NEM (N-ethylmaleimide) NHS N-hydroxysuccinimide NMM 4-methylmorpholine PEG Poly(ethylene glycol) PEG4-SPDP (2-pyridyldithio)-PEG4-NHS ester PDT Pyridine-3-thiol RPM (Revolutions per minute) rt retention time SC semicarbazone bond SH Thiol SMCC succinimidyl-4-(N-maleimidomethyl)cyclohexane-1-carboxylate TBS Tris-buffered saline TCO trans-cyclooctene TCEP Tris(2-carboxyethyl)phosphine hydrochloride Temp Temperature TFA (Trifluoroacetic Acid) TFL Trifunctional Linker THF (Tetrahydrofuran) THPP Tris(3-hydroxypropyl)phosphine UDP-GalNAz Uridine diphosphate-N-azidoacetylgalactosamine disodium

[0331] [Table 30]

[0332] [Table 31]

[0333] [Table 32]

[0334] SO1861 was isolated and purified from a live plant extract obtained from Saponaria officinalis L by Analyticon Discovery GmbH, Germany or Extrasynthese, France.

[0335] Analysis method LC-MS method 1 Instrument: Waters IClass, Binary pump: UPIBSM, SM: UPISMFTN SO attached, UPCMA, PDA: UPPDATC, 210~320nm, SQD: ACQ-SQD2 ESI, Mass range depends on the molecular weight of the product: Neg or neg / pos within the range of 1500-2400 or 2000-3000, ELSD: gas pressure 40 psi, drift tube temperature: 50°C, column: Acquity C18, 50 × 2.1 mm, 1.7 μm, temperature: 60°C, flow rate: 0.6 mL / min, linear gradient depends on the polarity of the product: A t0 = 2%A, t 5.0分 =50%A, t 6.0分 =98%A B t0 = 2%A, t 5.0分 =98%A, t 6.0分 =98%A Post-treatment time: 1.0 minute, Elution A: Acetonitrile, Elution B: 10 mM ammonium bicarbonate in water (pH=9.5).

[0336] LC-MS method 2 Instrument: Waters IClass, Binary pump: UPIBSM, SM: UPISMFTN SO attached, UPCMA, PDA: UPPDATC, 210~320nm, SQD: ACQ-SQD2 ESI, Mass range depends on product molecular weight: pos / neg 100~800 or neg 2000~3000, ELSD: Gas pressure 40psi, Drift tube temperature: 50℃, Column: Waters XSelect(trademark) CSH C18, 50×2.1mm, 2.5μm, Temperature: 25℃, Flow rate: 0.5mL / min, Gradient: t 0分 =5%A, t 2.0分 =98%A, t 2.7分 =98%A, Post-time: 0.3 min, Elutate A: Acetonitrile, Elutate B: 10 mM ammonium bicarbonate in water (pH=9.5).

[0337] LC-MS method 3 Instrument: Waters IClass, Binary pump: UPIBSM, SM: UPISMFTN SO attached, UPCMA, PDA: UPPDATC, 210~320nm, SQD: ACQ-SQD2 ESI, Mass range depends on product molecular weight pos / neg 10⁵~800, 500~1200 or 1500~2500, ELSD: Gas pressure 40psi, Drift tube temperature: 50℃, Column: Waters XSelect™ CSH C18, 50×2.1mm, 2.5μm, Temperature: 40℃, Flow rate: 0.5mL / min, Gradient: t 0分 =5%A, t 2.0分 =98%A, t 2.7分 =98%A, post-time: 0.3 min, eluate A: 0.1% formic acid in acetonitrile, eluate B: 0.1% formic acid in water.

[0338] LC-MS method 4 Instrument: Waters IClass, Binary pump: UPIBSM, SM: UPISMFTN SO attached, UPCMA, PDA: UPPDATC, 210~320nm, SQD: ACQ-SQD2 ESI, Mass range depends on product molecular weight: pos / neg 100~800 or neg 2000~3000, ELSD: Gas pressure 40psi, Drift tube temperature: 50℃, Column: Waters Acquity Shield RP18, 50×2.1mm, 1.7μm, Temperature: 25℃, Flow rate: 0.5mL / min, Gradient: t 0分 =5%A, t 2.0分 =98%A, t 2.7分 =98%A, Post-time: 0.3 min, Elutate A: Acetonitrile, Elutate B: 10 mM ammonium bicarbonate in water (pH=9.5).

[0339] LC-MS method 5 Instrument: Waters IClass, Binary pump: UPIBSM, SM: UPISMFTN SO attached, UPCMA, PDA: UPPDATC, 210~320nm, SQD: ACQ-SQD2 ESI, Mass range depends on product molecular weight: within neg / pos 1500~2700, ELSD: Gas pressure 40psi, Drift tube temperature: 50℃, Column: Acquity Premier peptide BEH C18, 50×2.1mm, 1.7μm, Temperature: 25℃, Flow rate: 0.45mL / min, Gradient depends on product polarity: A t0 = 2%B, t 4.0分 = 50%B, t 5.0分 =98%B, t 6.0分 =98%B B t0 = 5%B, t 6.0分 =98%B, t 6.0分 =98%B Post-treatment time: 1.0 minute, Elutate A: 10 mM ammonium bicarbonate in water (pH=9.5), Elutate B: Acetonitrile.

[0340] LC-MS method 6 Equipment: Agilent 1260 Infinity II, 1260 G7112B binary pump, 1260 G7167A multisampler, 1260MCT G7116A column compartment, 1260 G7115A DAD (210, 220 and 210-320nm), PDA (210-320nm), G6130B MSD (ESI pos / neg) mass range 90-1500, Column: XSelect CSH C18 (30×2.1mm 3.5μm), Flow rate: 1mL / min, Column temperature: 25℃, Elutate A: 10mM ammonium bicarbonate in water (pH 9.5), Elutate B: Acetonitrile, Gradient: t0 min = 5%B, t1.6 min = 98%B, t3 min = 98%B, Postrun: 1.2 min.

[0341] LC-MS method 7 Instrument: Waters I-Class UPLC, Binary Solvent Manager (BSM), Sample Manager-FTN (SM-FTN) and Sample Organizer (SO), Column Manager (CM-A), PDA 210-320nm, SQD2 ESI, Mass range depending on product molecular weight: pos / neg 400~1600 or 1500~2500, ELSD: Gas pressure 40 psi, Drift tube temperature: 50°C, Column: Acquity Premier peptide BEH C18, 50 × 2.1 mm, 1.7 μm, Temperature: 25°C, Flow rate: 0.45 mL / min, Gradient: t0 = 2%B, t 4.0分 = 50%B, t 6.0分 =98%B, Post-time: 1.0 min, Elutate A: 10 mM ammonium bicarbonate in water (pH=9.5), Elutate B: Acetonitrile.

[0342] Preparative separation method Preparative MP-LC method 1 Instrument: Revelleris™ Preparative MPLC, Column: Waters XSelect™ CSH C18 (145×25mm, 10μm), Flow rate: 40mL / min, Column temperature: Room temperature, Elutate A: 10mM ammonium bicarbonate in water pH=9.0, Elutate B: 99% acetonitrile + 1% 10mM ammonium bicarbonate in water, Gradient: At 0分 =5%B、t 1分 =5%B、t 2分 =10%B、t 17分 =50%B、t 18分 =100%B、t 23分 =100%B A t 0分 =5%B、t 1分 =5%B、t 2分 =20%B、t 17分 =60%B、t 18分 =100%B、t 23分 =100%B、 Output UV: 210, 235, 254nm and ELSD.

[0343] MP-LC extraction method 2 Model: Reveleris (trademark) fractionation MPLC, Karamu: Phenomenex LUNA C18(3) (150×25mm, 10μm), flow rate: 40mL / min, karara temperature: room temperature, dissolution solution A: 0.1% (v / v) acid in water, dissolution solution B: 0.1% (v / v) acid in アセトニトリル, blending: A t 0分 =5%B、t 1分 =5%B、t 2分 =20%B、t 17分 =60%B、t 18分 =100%B、t 23分 =100%B B t 0分 =2%B、t 1分 =2%B、t 2分 =2%B、t 17分 =30%B、t 18分 =100%B、t 23分 =100%B C t 0分 =5%B、t 1分 =5%B、t 2分 =10%B、t 17分 =50%B、t 18分 =100%B、t 23分 =100%B D t 0分 =5%B、t 1分 =5%B、t2分 =5%B, t 17分 =40%B, t 18分 =100%B, t 23分 =100%B Detected UV: 210, 235, 254 nm and ELSD.

[0344] Preparative LC-MS Method 3 MS model: Agilent Technologies G6130B quadrupole, HPLC model: Agilent Technologies 1290 preparative LC, column: Waters XSelect™ CSH (C18, 150×19 mm, 10 μm), flow rate: 25 ml / min, column temperature: room temperature, eluent A: 100% acetonitrile, eluent B: 10 mM ammonium bicarbonate in water pH = 9.0, gradient: A t0 = 20%A, t 2.5分 = 20%A, t 11分 = 60%A, t 13分 = 100%A, t 17分 = 100%A B t0 = 5%A, t 2.5分 = 5%A, t 11分 = 40%A, t 13分 = 100%A, t 17分 = 100%A Detection: DAD (210 nm), detection: MSD (ESI pos / neg) mass range: 100 - 800, fraction collection based on DAD.

[0345] Preparative LC-MS Method 4 MS model: Agilent Technologies G6130B quadrupole, HPLC model: Agilent Technologies 1290 preparative LC, column: Waters XBridge Protein (C4, 150×19 mm, 10 μm), flow rate: 25 ml / min, column temperature: room temperature, eluent A: 100% acetonitrile, eluent B: 10 mM ammonium bicarbonate in water pH = 9.0, gradient: A t0 = 2%A, t 2.5分 = 2%A, t 11分 = 30%A, t 13分=100%A, t 17分 =100%A B t0 = 10%A, t 2.5分 =10%A, t 11分 =50%A, t 13分 =100%A, t 17分 =100%A C t0 = 5%A, t 2.5分 =5%A, t 11分 =40%A, t 13分 =100%A, t 17分 =100%A, Detection: DAD (at 210 nm), Detection: MSD (ESI pos / neg) Mass range: 100 - 800, Fraction collection based on DAD

[0346] Flash chromatography Grace Reveleris X2 (registered trademark) C - 815 Flash; Solvent delivery system: Self - priming 3 - piston pump, Four independent channels including up to 4 solvents in a single run, Automatic switching line when solvent runs out, Maximum pump flow rate 250 mL / min, Maximum pressure 50 bar (725 psi), Detection: UV 200 - 400 nm, Combinations of up to 4 UV signals and full UV range scan, ELSD, Column size: Luer device type 4 - 330 g, 750 g - 3000 g maximum when optional holder is attached.

[0347] Ultraviolet - visible spectrophotometry Antibody concentration, as well as sulfo - Cy5 concentration and incorporation, were determined using a Thermo Nanodrop 2000 spectrometer. The antibody concentration in the conjugate was determined by a BCA assay. The BCA assay was performed using a Thermo SkanIT plate reader. Ellmans (TNB) ε412 = 14,150 M-1cm-1 Cetuximab ε280 = 1.4 (mg / ml)-1cm-1 Cetuximab - SO1861, mass ε280 = 1.4 (mg / ml)-1cm-1 STAT3-ST2, molar EC260 = 201,445 M-1 cm-1, Rz260:280 = 1.816 STAT3_ST6, Molar EC260 = 183,491 M-1 cm-1, Rz260:280 = 1.653 PDT, molar EC343 = 8,080 M-1 cm-1.

[0348] SEC Undenatured antibodies and conjugates were analyzed by SEC using an Akta purifier 100 system and a Biosep SEC-s3000 column eluted with DPBS:IPA (85:15). Purity % was determined by integrating the antibody peak against the trace aggregate peak.

[0349] SDS-PAGE and Western Blotting Undenatured antibodies and conjugates were analyzed by SDS-PAGE on a protein ladder using 4-12% bis-tris gel and MOPS as the running buffer under both non-denaturing and reducing conditions (200V, approximately 40 minutes). Samples containing LDS sample buffer and MOPS running buffer as diluents were prepared to 0.5 mg / mL. For the reduced samples, DTT was added to achieve a final concentration of 50 mM. The samples were heat-treated at 90-95°C for 2 minutes, and 5 μg (10 μl) was added to each well. Protein ladders (10 μl) were loaded without pretreatment. Empty rows were filled with 1× LDS sample buffer (10 μl). After flowing onto the gel, it was washed three times with DI water (100 ml) while shaking (15 minutes, 200 rpm). Coomassie staining was performed by incubating the gel with PAGEBlue protein stain (30 ml) while shaking (60 minutes, 200 rpm). Excess staining solution was removed, the gel was rinsed twice with DI water (100 ml), and destained with DI water (100 ml) (60 minutes, 200 rpm). The resulting gel was imaged and processed using ImageJ.

[0350] For Western blotting, the X-Cell blot module was used with the following setup (BP-BP-FP-gel-NC-FP-BP-FP-gel-NC-FP-BP-BP) and conditions (30V, 0.17 Amps, 60 min). A gel (not Coomassie stained) washed with freshly prepared transfer buffer was transferred to a nitrocellulose membrane. BP - blotting pad, FP - filter pad, NC - nitrocellulose membrane. Subsequently, the NC was washed three times with PBS-T (100 ml), nonspecific sites were blocked with blocking buffer (30 ml) while shaking (10 min, 200 rpm), and then the active sites were labeled with a combination of goat anti-human kappa-HRP (1:2000) and goat anti-human IgG-HRP (1:2000) (30 ml) diluted with blocking buffer while shaking (60 min, 200 rpm). Subsequently, the NC was washed with PBS-T (100 ml), and the combined antibody was detected using a newly prepared CN / DAB substrate (25 ml) prepared with a stable peroxide substrate buffer. The color development was observed visually, and the obtained NC was photographed.

[0351] SO1861-AH-maleimide SO1861-AH-maleimide (also referred to as SO1861-AH-Mal or SO1861-EMCH) was prepared as already described in International Publication No. 2021 / 259507A1 (page 72, Example 3, referred to as "SO1861-EMCH Synthesis"). SO1861 (121 mg, 0.065 mmol) and EMCH.TFA (110 mg, 0.325 mmol) were mixed with methanol (over-dried, 3.00 mL) and TFA (0.020 mL, 0.260 mmol). The reaction mixture was stirred at room temperature. After 1.5 hours, the reaction mixture was subjected to preparative MP-LC. The fractions corresponding to one product were immediately pooled together, frozen, and freeze-dried overnight to obtain the title compound (120 mg, 90%) as a white, cottony solid. Purity was 96% based on LC-MS. LRMS(m / z):2069[M-1]1- LC-MS rt(min): 1.084

[0352] SO1861-AH-maleimide-block (saponin molecule according to formula (V), also called SO1861-AH-block) SO1861-AH-maleimide (0.1 mg, 48 nmol) was mixed with 200 μL of mercaptoethanol (18 mg, 230 μmol), and the solution was shaken at 800 rpm for 1 hour at room temperature on a ThermoMixer C (Eppendorf). After shaking for 1 hour, the solution was diluted with methanol and dialyzed broadly against methanol for 4 hours using a regenerated cellulose membrane tube (Spectra / Por7) containing 1 kDa MWCO. After dialyzing, SO1861-Ald-EMCH-mercaptoethanol was obtained (saponin molecule according to formula (V)), and aliquots were taken and analyzed by MALDI-TOF-MS. (RP mode): m / z 2193Da ([M+K]+, SO1861-AH-block), m / z 2185Da ([M+K]+, SO1861-AH-block), m / z 2170Da ([M+Na]+, SO1861-AH-block).

[0353] Synthesis of SO1861-SC-maleimide SO1861-SC-maleimide (also referred to as SO1861-SC-Mal) was prepared as already described in International Publication No. 2023 / 038517A1 (page 168, lines 1-13, Example 1, referred to as "SO1861-SC-Mal"). Tert-butyl 2-(4-(6-(2,5-dioxo-2,5-dihydro-1H-pyrrole-1-yl)hexanoyl)piperazine-1-carbonyl)hydrazine-1-carboxylate (25.0 mg, 57.1 μmol) was dissolved in a mixture of dichloromethane (500 μL) and TFA (500 μL), and the reaction mixture was stirred at room temperature. After 30 minutes, the reaction mixture 35 was evaporated under vacuum and co-evaporated with dichloromethane (3 × 5 mL) and methanol (5 mL). The residue and SO1861 (21.3 mg, 11.4 μmol) were dissolved in methanol (over-dried, 1.00 mL), and the resulting mixture was shaken for 1 minute and allowed to stand at room temperature. After 4 hours, the reaction mixture was subjected to preparative MP-LC. The two fractions corresponding to the product were immediately pooled together, frozen, and freeze-dried overnight to obtain the title compound (13.7 mg, 55%) as a white, cottony solid. Purity was 97% based on LC-MS. LRMS(m / z):2181[M-1]1- LC-MS rt(min): 2.133

[0354] Cetuximab-SC-SO1861 Aliquots of cetuximab (305 mg, 5.0 mg / ml, 61 ml) were modified with Tris / Tris-HCl / EDTA concentrate (30 μl / ml, 1830 μl). To cetuximab (305 mg, 2.03 × 10⁻³ mmol, 4.871 mg / ml), a freshly prepared aliquot of TCEP (2.77 equivalents, 5.63 × 10⁻³ mmol, 1.61 mg, 1.61 ml) was gently added with stirring to TBS pH 7.5 (1 mg / ml). This mixture was incubated at 20°C for 210 minutes with rotational mixing. After incubation, an aliquot of the reaction mixture (0.211 ml) was removed and purified by Zeba 7K spin desalting column eluting TBS pH 7.5. Ab-SH was analyzed by ultraviolet-visible spectrophotometry and Elman assay (3.321 mg / ml, thiol to cetuximab ratio = 4.2). To this bulk reaction product, a freshly prepared aliquot of SO1861-SC-Mal (8 molar equivalents, 16.2 × 10⁻³ mmol, 35.4 mg, 17.70 ml) was gently added to TBS pH 7.5 (2 mg / ml) with gentle stirring. The mixture was vortexed briefly and then incubated at 20°C for 120 minutes. In addition to the conjugation reaction, two aliquots of desalted Ab-SH (0.25 mg, 0.075 ml, 1.67 × 10⁻⁶ mmol) were reacted with NEM (8.00 equivalents, 1.34 × 10⁻⁵ mmol, 6.7 μl of 0.25 mg / ml solution) or TBS pH 7.5 buffer (6.7 μl) at 20°C for 120 minutes (as positive and negative controls, respectively). After incubation, approximately 1.0 mg aliquot (0.270 ml) of the Ab-SO1861 mixture was taken out and purified by gel filtration to TBS pH 7.5 using a Zeba 7K spin desalting column, and SO1861 incorporation was obtained by characterizing it in parallel with the positive and negative controls using the Elman assay. After the reaction, the reaction was quenched by adding a freshly prepared aliquot of NEM solution (5 molar equivalents, 10.1 × 10⁻³ mmol, 507 μl of 2.5 mg / ml solution) to the bulk Ab-SO1861 mixture. The quenched reaction mixture was stored overnight at 2–8°C.The conjugate was purified by splitting the bulk into multiple aliquots and performing multiple runs (a total of 4) using a disinfected 2.6 × 40 cm Superdex 200 column eluted with DPBS pH 7.5. The purified Ab-SO1861 aliquots were combined, filtered at 0.2 μm under laminar flow, and analyzed by UV-Vis spectrophotometric analysis. The aliquots were concentrated to >2.5 mg / ml using a Vivacell 100 centrifugal filter, then normalized to 2.5 mg / ml, and dispensed into aliquots for product testing, characterization, and further conjugation work. The result was cetuximab-SC-SO1861 conjugate. Total yield = 289 mg, 95%, purity: 99%, SO1861 to Ab ratio = 4.1.

[0355] Cetuximab-SS-STAT3-ST2_PMO (also known as "Cet-STAT3_ST2 PMO") To an aliquot of cetuximab (127.5 mg, 8.50 × 10⁻⁴ mmol, 2.5 mg / ml) pre-buffered in DPBS pH 7.5, an aliquot of freshly prepared PEG4-SPDP solution (10 mg / ml, 10.1 molar equivalents, 8.59 × 10⁻³ mmol, 0.480 ml) was added. The mixture was briefly vortexed and then incubated at 20°C for 60 minutes by roller mixing. After incubation, the reaction was quenched by adding an aliquot of freshly prepared glycine solution (50 mg / ml, 50 molar equivalents, 4.29 × 10⁻² mmol, 64 μl). The mixture was briefly vortexed and then incubated at 20°C for >15 minutes with rotational mixing. The conjugate was purified using a disinfected 5 × 50 cm Superdex 200PG column eluted with TBS pH 7.5, and analyzed by UV-Vis to obtain purified Cet-SPDP (133.9 mg, 105%, 1.34 mg / ml, SPDP to Ab ratio = 3.6). Ab-SPDP was used immediately.

[0356] Separately, STAT3-ST2_PMO-SS-amide (104.9 mg, 1.30 × 10⁻² mmol, 10.00 mg / ml) was reconstituted using TBS pH 7.5 and pooled into a single aliquot. To this, a freshly prepared aliquot of THPP solution (50 mg / ml, 10 molar equivalents, 13.0 × 10⁻² mmol, 292 μl) was added, the mixture was briefly vortexed, and then incubated at 37°C for 60 minutes with rotational mixing. After incubation, PMO was purified using multiple PD10 Sephadex G25M columns eluted with TBS pH 7.5 to obtain PMO-SH. Total yield = 93.0 mg, 89%, thiol-to-PMO ratio = 0.88.

[0357] Aliquotes of Ab-SPDP (120.5 mg, 8.04 × 10⁻⁴ mmol, 1.34 mg / ml) were mixed with aliquots of PMO-SH (3.63 mg / ml, 7.0 molar equivalents, 5.63 × 10⁻³ mmol, 12.51 ml). The mixture was briefly vortexed and then incubated overnight at 20°C with rotational mixing. After approximately 16 hours, the conjugate mixture was analyzed by UV-Vis to confirm incorporation by PDT migration. The mixture was then purified using a 5 × 50 cm Superdex 200PG column eluting DPBS pH 7.5 to obtain the purified Cet-SS-STAT3-ST2_PMO conjugate. The conjugate was analyzed by BCA colorimetric assay. The result was α-etuximab-SS-STAT3-ST2_PMO conjugate. Total yield = 69.6 mg, 55%, purity: 99%, STAT3-ST2_PMO to Cet ratio = 3.1.

[0358] Cetuximab-(SC-SO1861)-(SS-STAT3-ST2_PMO) and cetuximab-(SC-SO1861)-(SS-STAT3-ST6_PMO) Cetuximab-(SC-SO1861)-(SS-STAT3-ST2_PMO) is also known as "Cet-SO1861-STAT3_ST2 PMO". Cetuximab-(SC-SO1861)-(SS-STAT3-ST6_PMO) is also known as "Cet-SO1861-STAT3_ST6 PMO".

[0359] The following procedure is described exemplarily for cetuximab-(SC-SO1861)-(SS-STAT3-ST2_PMO). Cetuximab-(SC-SO1861)-(SS-STAT3-ST6_PMO) was synthesized using the same procedure.

[0360] To an aliquot of cetuximab-SC-SO1861 (127.5 mg, 8.50 × 10⁻⁴ mmol, 2.5 mg / ml) that had been pre-buffered in DPBS pH 7.5, an aliquot of freshly prepared PEG4-SPDP solution (10 mg / ml, 10.1 molar equivalents, 8.59 × 10⁻³ mmol, 0.480 ml) was added, and the mixture was briefly vortexed and then incubated at 20°C for 60 minutes while rotating. After incubation, the reaction was quenched by adding an aliquot of freshly prepared glycine solution (50 mg / ml, 50 molar equivalents, 4.29 × 10⁻² mmol, 64 μl), and the mixture was briefly vortexed and then incubated at 20°C for >15 minutes while rotating. The conjugate was purified using a disinfected 5 × 50 cm Superdex 200PG column eluted with TBS pH 7.5, and analyzed by UV-Vis to obtain purified Cet-(SC-SO1861)-(SPDP) (133.9 mg, 105%, 1.34 mg / ml, SPDP to Ab ratio = 3.6). Ab-SPDP was used immediately.

[0361] Separately, STAT3-ST2_PMO-SS-amide (104.9 mg, 1.30 × 10⁻² mmol, 10.00 mg / ml) was reconstituted using TBS pH 7.5 and pooled into a single aliquot. To this, a freshly prepared aliquot of THPP solution (50 mg / ml, 10 molar equivalents, 13.0 × 10⁻² mmol, 292 μl) was added, the mixture was briefly vortexed, and then incubated at 37°C for 60 minutes while rotating. After incubation, PMO was purified using multiple PD10 Sephadex G25M columns eluted with TBS pH 7.5 to obtain PMO-SH. STAT3-ST2_PMO-SH: 93.0 mg, 89%, thiol-to-PMO ratio = 0.88. STAT3-ST6_PMO-SH: 47 mg, 56%, thiol-to-PMO ratio = 0.87

[0362] Aliquotes of cetuximab-(SC-SO1861)-SPDP (120.5 mg, 8.04 × 10⁻⁴ mmol, 1.34 mg / ml) were mixed with aliquots of PMO-SH (3.63 mg / ml, 7.0 molar equivalents, 5.63 × 10⁻³ mmol, 12.51 ml). The mixture was briefly vortexed and then incubated overnight at 20°C with rotational mixing. After approximately 16 hours, the conjugate mixture was analyzed by UV-Vis to confirm incorporation by PDT migration. The mixture was then purified using a 5 × 50 cm Superdex 200PG column eluting DPBS pH 7.5 to obtain the purified Cet-(SC-SO1861)-(SS-STAT3-ST2_PMO) conjugate. The conjugate was analyzed by BCA colorimetric assay. Cetuximab-(SC-SO1861)-(SS-STAT3-ST2_PMO) Total yield: 46 mg, 39%, purity: 97% SO1861 to Cet ratio = 4.1 STAT3-ST2_PMO vs. Cet ratio = 5.1 Cetuximab-(SC-SO1861)-(SS-STAT3-ST6_PMO) Total yield: 69 mg, 58%, purity: 96% SO1861 to Cet ratio = 4.1 STAT3-ST6_PMO vs. Cet ratio = 5.2

[0363] Cetuximab-AH-SO1861 (also known as "Cet-AH-SO1861") To a cetuximab solution (1087 mg in TBS, 2.5 mM EDTA, pH 7.5, 4.800 mg / ml, 7.2 × 10⁻³ mmol), an aliquot of freshly prepared TCEP solution (1 mg / ml, 2.72 molar equivalents, 2.0 × 10⁻² mmol, 5.65 mg) was added. The mixture was mixed by hand stirring and then incubated at 20°C for 210 minutes with rotational mixing. After incubation (before the addition of SO1861-AH-maleimide), a 2 mg (0.417 ml) aliquot of cetuximab-SH (Ab-SH) was taken out and purified by gel filtration to TBS pH 7.5 using a Zeba spin desalting column. This aliquot was characterized by UV-Vis analysis and Elman assay (3.693 mg / ml, thiol-to-Ab ratio = 4.0). To bulk Ab-SH, an aliquot of freshly prepared SO1861-AH-maleimide solution (2 mg / ml, 5.2 molar equivalents, 3.8 × 10⁻² mmol, 38.9 ml) was added, the mixture was vortexed briefly, and then incubated at 20°C for 120 minutes. In addition to the conjugation reaction, two aliquots of desalted Ab-SH (0.5 mg, 0.135 ml, 3.33 × 10⁻⁶ mmol) were reacted with NEM (8.00 equivalents, 2.66 × 10⁻⁵ mmol, 3.3 μg, 13.3 μl of 0.25 mg / ml solution) or TBS pH 7.5 buffer (13.3 μl) at 20°C for 120 minutes (as positive and negative controls, respectively). After incubation (before NEM addition), approximately 2 mg (0.450 ml) of the Ab-SO1861 mixture was taken out as an aliquot and purified by gel filtration to TBS pH 7.5 using a Zeba spin desalting column. This aliquot was characterized by UV-Vis (3.271 mg / ml), and in parallel, positive and negative controls were characterized by Elman assay to obtain SO1861 incorporation. To the bulk Ab-SO1861 mixture, a freshly prepared aliquot of NEM solution (2.5 mg / ml, 5 molar equivalents, 3.6 × 10⁻² mmol, 4.54 mg) was added, and the mixture was stored overnight at 2-8°C. The conjugate was purified by a 10 × 40 cm Sephadex G50M column eluting with DPBS pH 7.5 to obtain purified cetuximab-SO1861 conjugate.Aliquots were filtered to 0.2 μm and dispensed. The result was cetuximab-SO1861 conjugate. Yield = 1056 mg, 97%, SO1861 to Ab ratio = 3.9.

[0364] Malat1 ASO An antisense oligonucleotide targeting mouse (Mm)Malat1 mRNA, having the sequence and modification (5'-C6-disulfide)-[4*33 24G*9*T*G*G*T*T*A*T*G*231*3*2] (where [1=2'-MOE-5Me-rU, 2=2'MOE-rA, 3=2'MOE-5Me-rC, 4=2'MOE-rG, 9=5-methyl-dC, *=phosphorothioate]), was custom-fabricated by BioSpring Gesellschaft fuer Biotechnologie mbH, Germany, according to methods known in the art. As described, this ASO was further modified to obtain Malat1-SS-PEG3-OH.

[0365] Malat1-SS-PEG3-OH Intermediate 1: 2-(2-(2-(pyridine-2-yldisulfaneol)ethoxy)ethoxy)ethane-1-ol Under an N2 atmosphere, 2,2'-dithiodipyridine (159 mg, 0.722 mmol) was dissolved in methanol (3.00 mL), and a solution of 2-(2-(2-mercaptoethoxy)ethoxy)ethane-1-ol (100 mg, 0.602 mmol) in methanol (500 μL) was added dropwise. The resulting mixture was stirred at room temperature. After 2 hours, the reaction mixture was evaporated under vacuum and co-evaporated with DCM (2 × 5 mL). The residue was purified by flash chromatography (ethyl acetate-heptane gradient, increasing from 0:100 to 100:0) to obtain the title compound (100 mg, 60%) as a colorless oil. Purity was 98% based on LC-MS. LRMS (m / z): 276 [M+1] 1+ LC-MS rt(min): 1.59 6

[0366] Malat1-SS-PEG3-OH (also known as "Malat1-ASO") Malat1 (10.00 mg, 1.34 μmol) was added to a solution of 20 mM ammonium bicarbonate with 2.5 mM TCEP (2.67 mL, 13.4 μmol). The reaction mixture was shaken for 1 minute and allowed to stand overnight at room temperature. The reaction mixture was diluted with 10 mL of water, and the resulting mixture was filtered using a centrifugal filter with a molecular weight cutoff of 3000 Da (6000 × g for 30 minutes). The residue solution was diluted with 10 mL of water, and the resulting mixture was filtered using the same method as above. The residue solution was diluted with water (1.00 mL) and a solution of 2-(2-(2-(pyridine-2-yldisulfaneol)ethoxy)ethoxy)ethane-1-ol (1.47 mg, 5.35 μmol) in acetonitrile (500 μL). The resulting solutions were shaken for 1 minute and allowed to stand at room temperature. After 5 hours, the reaction mixture was frozen and freeze-dried overnight. The residue was subjected to preparative LC-MS. A The fractions corresponding to the product were immediately pooled together, frozen, and freeze-dried overnight to obtain the title compound (7.43 mg, 74%) as a white, cottony solid. Purity was 91% based on LC-MS. LRMS (m / z): 750 [M-10] 10- , 834[M-9] 9- , 938[M-8] 8- , 1072[M-7] 7- , 1251[M-6] 6- , 1501[M-5] 5- LC-MS rt(min): 1.51 7

[0367] Malat1-SC-SO1861 (also known as "Malat1-ASO-SC-SO1861") Malat1 (5.00 mg, 0.688 μmol) was mixed with a 20 mM ammonium bicarbonate solution containing 2.5 mM TCEP (500 μL, 2.50 μmol). The reaction mixture was shaken for 1 minute and allowed to stand at room temperature. After 6 hours, the reaction mixture was frozen and lyophilized overnight. The residue was dissolved in a 20 mM ammonium bicarbonate solution (500 μL, 2.50 μmol) containing 2.5 mM TCEP. The reaction mixture was shaken for 1 minute and allowed to stand at room temperature. After 1 hour, the reaction mixture was injected into acetonitrile (10 mL). The resulting suspension was shaken and centrifuged (5000 RPM, 15 min). The solution was decanted, and the residue was dissolved in a 20 mM ammonium bicarbonate solution (500 μL). SO1861-SC-Mal was added to this solution in different aliquots until complete conversion was observed by LC-MS. 2 A total of 8.60 mg (3.93 μmol) of SO1861-SC-Mal was added. The reaction mixture was frozen and freeze-dried overnight. The residue was subjected to preparative LS-MS. B The fractions corresponding to the product were immediately pooled together, frozen, and freeze-dried overnight to obtain the title compound (3.50 mg, 55%) as a white, cottony solid. Purity was 96% based on LC-MS. LRMS (m / z): 1587 [M-6] 6- , 1905[M-5] 5- , 2380[M-4] 4- LC-MS rt(min): 2.48 2

[0368] SOD1 PMO and STAT3 PMO The phosphorodiamidate morpholino oligomers targeting mouse (Mm)SOD1 (SOD1 PMO [SEQ ID NO: 20]: GCCAGCCTAGGACCTACCTTGTGTA and SOD1 PMO(2) [SEQ ID NO: 23]: AGCCTATTTACCAGAAACCAGCAGT) are both intended to induce nonsense-mediated disintegration (mRNA reduction) via exon skipping, and were custom-manufactured by Gene Tools, LLC according to methods known in the art. A phosphorodiamidate morpholino oligomer (STAT3_ST6 PMO [SEQ ID NO: 36]:CATTTTCTGTTCTAGATCCTGTT) that targets both mouse and human STAT3 mRNA by inducing exon skipping resulting in nonsense-mediated degeneration (mRNA reduction) via exon skipping, and a phosphorodiamidate morpholino oligomer (STAT3_ST2 PMO [SEQ ID NO: 37]:ATTGCTGCAGGTCGTTCTGTAGG) that targets both mouse and human STAT3α mRNA by inducing isoform splice switching to switch from STAT3α mRNA to STAT3β, thereby effectively reducing STAT3α mRNA levels, were custom-manufactured by Gene Tools, LLC according to methods known in the art.

[0369] STAT3 ASO STAT3 antisense oligonucleotides (STAT ASOs) having the following sequence and modification [SEQ ID NO: 8]: 3*1*2*T*T*T*G*G*A*T*G*T*0*2*4*3 (where 0 = 5-methyl-dC, 1 = 2'MOE-5Me-rU, 2 = 2'MOE-rA, 3 = 2'MOE-5Me-rC, 4 = 2'MOE-rG, * = phosphorothioate) were prepared by BioSpring Gesellschaft fuer Biotechnologie GmbH, Germany according to methods known in the art.

[0370] HTRA LNA An antisense oligonucleotide targeting mouse (Mm)Htra mRNA, having the sequence and modification 5'-[TL]*[AL]*[TL]*T*T*A*C*C*T*G*G*T*[TL]*[GL]*[TL]*[TL] (where [TL]=LNA-T, [AL]=LNA-A, [GL]=LNA-G, *=phosphorothioate), was custom fabricated by Bio-Synthesis, Inc. according to methods known in the art.

[0371] AHA1 siRNA Several siRNAs (siAHA1) that target human AHA1 were custom-manufactured by Thermo Scientific using the same oligonucleotide sequence and different chemical modifications of the backbone and sugars, according to methods known in the art: (1) 2'O-methyl: Modified with 2'O-methyl on both the sense and antisense strands (sense strand: 5'-GGAmUGAAGmUGGAGAmUmUAGmU-dT*dT-3' [SEQ ID NO: 38] and antisense strand: 5'-ACmUAAUCUCmCACUUmCAUCCdT*dT-3' [SEQ ID NO: 40] (where mU = 2'-OMe-rU, mC = 2'-OMe-rC, * = phosphorothioate) (Svenson et al. (2016), Tumor Selective Silencing Using an RNAi-Conjugated Polymeric Nanopharmaceutical, Molecular Pharmaceutics) (As described in 2016;13(3):737-747,.doi:10.1021 / acs.molpharmaceut.5b00608 (Svenson et al., 2016)). (2) siSTABLE: Proprietary commercially available stabilizing chemical structure siSTABLE (Thermo Scientific), or (3) Accell: Proprietary commercially available stabilizing chemical structure Accell (Thermo Scientific).

[0372] MMP14 siRNA siRNA targeting human MMP14 (siMMP14) was custom-manufactured by Eurogentec according to methods known in the art and modified with 2'-fluoro in both the sense and antisense strands (sense strand: 5'-AA66AGAAG65GAAGG5AGAA9*9-3'[SEQ ID NO: 39] and antisense strand: 5'-5565A66556AG65565GG559*9-3'[SEQ ID NO: 41] (where 5=2'-fluoro-rU, 6=2'-fluoro-rC, 9=dT, *=phosphorothioate)).

[0373] RNA analysis of brain tissue Total RNA was isolated from frozen sections of mouse brain regions using TissueLyser II (Qiagen) as a homogenizer and TRIzol® reagent (Thermo Scientific) according to the manufacturer's instructions. Conversion to cDNA was performed using the iScript® cDNA synthesis kit (BioRad) using standard procedures. Mouse (Mm)Malat1 expression levels and housekeeping gene levels were determined using quantitative real-time PCR assays (qRT-PCR) with iTaq® Universal SYBR® Green Supermix (BioRad) and Light Cycler 480 II (Roche Diagnostics), including the specific DNA primers listed in Table A3. Each analytical reaction was performed three times. Malat1 expression was analyzed by the ΔCt method to determine its expression compared to two specific housekeeping control mRNAs. Results are expressed as a percentage of the normalized relative Malat1 expression level relative to the vehicle control.

[0374] [Table 33]

[0375] Cell-based Malat1 silencing in Neuron 2a cells Neuro-2a (mouse neuroblastoma cells) were cultured in DMEM (PAN-Biotech GmbH) supplemented with 10% fetal bovine serum (FBS, PAN-Biotech GmbH) and Pen / Strep (PAN-Biotech GmbH). For the experiment, Neuro-2a cells were harvested, resuspended at 60,000 cells / mL, and seeded at densities of 36,000 cells / well or 6,000 cells / well in 24 or 96-well plates (Greiner BioOne). The cells were incubated overnight at 37°C. Before starting the treatment, 210 μL or 35 μL of culture medium was added to each well, followed by the addition of a conjugate from a 10-fold stock solution of DPBS (PAN-Biotech GmbH). After incubating the plates at 37°C for 72 hours, cells from the 24-well plates were harvested for gene expression analysis, and cell viability was evaluated on the 96-well plates.

[0376] Cell-processing Sod1 exon skipping in Neuro-2a cells Neuro-2a (mouse neuroblastoma cells) were cultured in DMEM (PAN-Biotech GmbH) supplemented with 10% fetal bovine serum (FBS, PAN-Biotech GmbH) and Pen / Strep (PAN-Biotech GmbH). For the experiment, Neuro-2a cells were harvested, resuspended at 70,000 cells / mL, and seeded at a density of 42,000 cells / well or 7,000 cells / well in 24 or 96-well plates (Greiner BioOne). The cells were incubated overnight at 37°C. Before starting the treatment, 120 μL or 20 μL of medium was added to each well, followed by the addition of both saponin and / or PMO from a 10-fold stock solution in DPBS (PAN-Biotech GmbH). In control wells or when only one compound was applied to the treatment, an additional 150 μL of DPBS was added to the 24 or 96-well plate so that the final volume per well was 900 μL. After incubating the plates at 37°C for 72 hours, 24 wp of cells were harvested for gene expression analysis, and cell viability was evaluated at 96 wp.

[0377] Cell-treated A431 cells Squamous cell carcinoma cells, specifically A431 cells, were cultured at 37°C and 5% CO2 in DMEM (PAN-Biotech GmbH) supplemented with 10% fetal bovine serum (FBS) (PAN-Biotech GmbH) and Pen / Strep (PAN-Biotech GmbH). Cells were seeded at 600 μL / well or 100 μL / well, respectively, in 24-well and 96-well plates (Greiner BioOne) at concentrations of 30,000 cells / well or 6,000 cells / well, and incubated o...

Claims

1. A saponin component for use in a therapeutic method for treating a subject suffering from a disorder of a neuron-rich organ, which includes a vascular structure having blood-tissue barrier properties, wherein the method is: The saponin component includes a pentacyclic triterpene saponin containing a 12,13-dehydrooleanane type aglycone core, An effector component comprising a nucleic acid therapeutic agent intended to be delivered to one or more cells of the aforementioned organ, The saponin component comprises administering to the subject, wherein the administration is carried out directly to the organ or into a body cavity or body fluid space communicating with the cells of the organ, and preferably the organ is an organ derived from the neural tube.

2. The effector component further comprises a first ligand recognized by a first endocytosis receptor, and / or the effector component further comprises a second ligand recognized by a second endocytosis receptor. In some cases, the second endocytosis receptor is the same as the first endocytosis receptor, and further in some cases, the second ligand is the same as the first ligand, or instead, the second endocytosis receptor is different from the first endocytosis receptor, provided that both of the two different endocytosis receptors are present on the same cell. Preferably, the first ligand and / or the second ligand is a proteinogenic ligand, such as a naturally occurring peptide or protein ligand or its receptor interaction portion, or an antibody or its binding fragment, the saponin component for use according to claim 1.

3. The aforementioned pentacyclic triterpene saponin is - The aldehyde functional group at the C-23 position of the aglycone core, or - An acid-sensitive covalent bond configured to cleave under acidic conditions to generate the aldehyde functional group at the C-23 position of the aglycone core, preferably selected from one or more of the following: a semicarbazone bond, a hydrazone bond, an imine bond, an acetal bond including a 1,3-dioxolane bond, a ketal bond, an ester bond, and / or an oxime bond, preferably selected from a semicarbazone bond and a hydrazone bond. A saponin component for use according to claim 1 or 2, further comprising:

4. The pentacyclic triterpene saponin is a monodesmoside or a videsmoside, preferably comprising a first sugar chain bonded at the C-3 position of the aglycone core, more preferably the first sugar chain is selected from group A listed in Table 1A, even more preferably the first sugar chain comprises a glucuronic acid group, preferably a terminal glucuronic acid group, and most preferably the first sugar chain comprises Gal-(1→2)-[Xyl-(1→3)]-GlcA, the saponin component for use according to any one of claims 1 to 3.

5. The pentacyclic triterpene saponin comprises an aglycone core selected from chiric acid, gypsogenin, and an aldehyde-substituted derivative of either chiric acid or gypsogenin, each defined as a chiric acid-based or gypsogenin-based aglycone core, wherein the aldehyde functional group at the C-23 position is substituted by an acid-sensitive covalent bond configured to cleave under acidic conditions to generate the aldehyde functional group at the C-23 position of the aglycone core, and preferably the pentacyclic triterpene saponin comprises AG185 6, AG1, AG2, Agrostemoside E, GE1741, Gypsophila saponin 1 (Gyp1), NP-017674, NP-017810, NP-003881, NP-017676, NP-017677, NP-017705, NP-017706, NP-017773, NP-017775, SA1657, Saponarioside B, SO1542, SO1584, SO1674, SO1700, SO1730, SO1772, SO1832, SO1861, SO1862, SO1904, QS-7, QS-7 Selected from api, QS-17, QS-18, QS-21 A-apio, QS-21 A-xylo, QS-21 B-apio and QS-21 B-xylo or any one of these aldehyde-substituted derivatives, The saponin component for use according to any one of claims 1 to 4, wherein the pentacyclic triterpene saponin is selected from SA1641, gypsoside A, NP-017772, NP-017774, NP-017777, NP-017778, NP-018109, NP-017888, NP-017889, NP-018108, SO1658, and phytolaccagenin or any one of the aldehyde-substituted derivatives thereof.

6. The pentacyclic triterpene saponin is isolated from Saponaria officinalis and preferably one or more of saponarioside B, SO1542, SO1584, SO1658, SO1674, SO1700, SO1730, SO1772, SO1832, SO1861, SO1862 and SO1904, more preferably one or more of SO1832, SO1861 and SO1862, even more preferably SO1832 or SO1861, most preferably SO1861, the saponin component for use according to any one of claims 1 to 5.

7. A saponin component for use according to any one of claims 1 to 6, comprising a non-conjugate saponin molecule.

8. The saponin moiety is covalently conjugated to at least one non-saponin moiety via an acid-sensitive covalent bond, preferably an acid-sensitive covalent bond at the C-23 position of the aglycon core, and more preferably the acid-sensitive covalent bond at the C-23 position of the aglycon core is configured to cleave under acidic conditions to generate the aldehyde functional group at the C-23 position of the aglycon core, and thus result in the release of the pentacyclic triterpene saponin containing the aldehyde functional group at the C-23 position of the aglycon core from the non-saponin moiety, and more preferably the acid-sensitive covalent bond is selected from one or more of the following: a semicarbazone bond, a hydrazone bond, an imine bond, an acetal bond including a 1,3-dioxolane bond, a ketal bond, an ester bond and / or an oxime bond, most preferably selected from a semicarbazone bond and a hydrazone bond and / or The saponin component for use according to any one of claims 1 to 7, wherein the saponin portion is covalently conjugated with the at least one non-saponin portion by an acid-stable bond, preferably via a glucuronic acid group if one is present.

9. The aforementioned non-saponin portion is Linker, The first ligand according to claim 2, The aforementioned effector components, and / or Scaffold Molecules Includes one or more of the following: Preferably, the saponin portion is directly covalently conjugated with the linker. More preferably, the linker includes or is covalently conjugated to the saponin moiety via the acid-sensitive covalent bond, more preferably at the C-23 position of the aglycone core, or via the acid-stable bond, preferably at the glucuronic acid group if one is present. More preferably, the linker is further covalently conjugated to the first ligand and / or the effector component, possibly via the scaffold molecule. For example, the saponin component for use according to claim 8, wherein the scaffold molecule is a polyfunctional linker scaffold molecule or optionally a polymer scaffold molecule containing a dendron, such as a polyamidoamine (PAMAM) dendrimer or polyethylene glycol, such as PEG3 to PEG30.

10. The saponin portion is covalently conjugated with the non-saponin portion containing the effector component, and the conjugation brings together the saponin component and the effector component to produce a conjugate further referred to as the saponin-effector component. Preferably, the saponin-effector component further comprises the linker, and more preferably, the linker is directly covalently conjugated to the saponin portion. The saponin component for use according to claim 8 or 9, wherein the saponin-effector component further comprises the first ligand, in some cases.

11. The administration includes providing at least two pharmaceutical formulations, one of which may be formulated as a single pharmaceutical formulation or administered simultaneously or sequentially, wherein the first pharmaceutical formulation comprises the saponin component and the second pharmaceutical formulation comprises the effector component, and the effector component and the saponin component are formulated as at least two pharmaceutical formulations. In some cases, following the above administration, a boost application of the saponin component further referred to as the boost saponin component is performed at an interval of at least one day, preferably at least one week, wherein the boost saponin component is provided without the effector component and preferably comprises the non-conjugate saponin molecule described in claim 7 or the saponin moiety described in claim 8 or 9, wherein the saponin moiety is covalently conjugated with at least the linker or at least the first ligand or at least the linker and the first ligand of the non-saponin moiety. Preferably, the boost application is performed directly on the organ or in a body cavity or fluid space communicating with the cells of the organ, and most preferably, the boost application is performed at the site of administration, the saponin component for use according to any one of claims 1 to 10.

12. The aforementioned administration - A two-component free saponin formulation defined as comprising the saponin component comprising the non-conjugate saponin molecule described in claim 7, wherein the pentacyclic triterpene saponin is preferably as described in claim 3, and the two-component free saponin formulation optionally further comprises the effector component comprising a second ligand recognized by a second endocytosis receptor. - A two-component linker-saponin formulation defined as comprising the saponin component comprising the saponin moiety described in claim 8 or 9, wherein the saponin moiety is covalently conjugated with the linker, and the two-component linker-saponin formulation optionally further comprises the effector component comprising a second ligand recognized by a second endocytosis receptor, - A two-component targeted saponin formulation defined as comprising the saponin component comprising the saponin portion described in claim 8 or 9, wherein the saponin portion is covalently conjugated with the first ligand, preferably the non-saponin portion comprises the linker, and the two-component targeted saponin formulation optionally further comprises the effector component comprising the second ligand described in claim 2. - A one-component formulation defined as comprising the saponin-effector component described in claim 10, wherein the saponin-effector component optionally further comprises the first ligand. The saponin component for use according to claim 11, comprising providing the single pharmaceutical formulation selected from one or more of the following.

13. The aforementioned administration is a combination of the first pharmaceutical preparation and the second pharmaceutical preparation, - A non-targeting combination, The first pharmaceutical formulation, wherein the saponin component does not contain a ligand and preferably includes or comprises a non-conjugate saponin molecule as described in claim 7 and / or a saponin moiety as described in claim 8 or 9, wherein the saponin moiety is covalently conjugated with the linker, and the pentacyclic triterpene saponin is preferably as described in claim 3, The second pharmaceutical formulation, wherein the effector component does not contain a ligand, and Detargeting combinations defined as including - A combination of targeted effectors, The first pharmaceutical formulation, wherein the saponin component does not contain a ligand and preferably includes or comprises a non-conjugate saponin molecule as described in claim 7 and / or a saponin moiety as described in claim 8 or 9, wherein the saponin moiety is covalently conjugated with the linker, and the pentacyclic triterpene saponin is preferably as described in claim 3, The second pharmaceutical formulation, wherein the effector component comprises the second ligand described in claim 2, and A targeted effector combination defined as including - A targeted saponin combination, The first pharmaceutical formulation, wherein the saponin component comprises the saponin portion described in claim 8 or 9, the saponin portion is covalently conjugated with the first ligand, and preferably the non-saponin portion comprises the linker, The second pharmaceutical formulation, wherein the effector component optionally includes the second ligand described in claim 2. Targeted saponin combinations are defined as those that include The saponin component for use according to claim 10, comprising providing at least two pharmaceutical formulations comprising a combination selected from one or more of the following.

14. The nucleic acid therapeutic agent is - A gene therapy drug that can treat or improve the said disorder by replacing the abnormal or non-functional gene related to the said disorder with a functional variant, or by restoring the function of the abnormal or non-functional gene by introducing repair into the said gene, - An oligonucleotide therapeutic agent defined as a nucleic acid therapeutic agent having a length of 200 nt or less, preferably 5 to 150 nt, more preferably 8 to 100 nt, and most preferably 10 to 50 nt, wherein the oligonucleotide therapeutic agent can treat or improve the disorder by preferably regulating the expression of genes related to the disorder. A saponin component for use according to any one of claims 1 to 13, selected from the above.

15. The nucleic acid therapeutic agent comprises DNA and / or RNA and / or synthetic nucleic acids, which are defined as modified equivalents of DNA and / or RNA and include one or more nucleotide analogs and / or skeletal modifications, and preferably the nucleic acid therapeutic agent is - A DNA therapeutic agent preferably selected from plasmids, minicircle DNA, CRISPR gene editing-related constructs, DNA aptamers and / or DNA antisense oligonucleotides (ASOs, AONs), most preferably DNA ASOs. - Preferably selected from RNA ASO, siRNA, miRNA, RNA miRNA inhibitors (anti-microRNA, anti-miRNA, anti-miR) and / or RNA miRNA inhibitor ASO, RNA aptamers, ribozymes, RNA decoys, short hairpin RNA (shRNA), and anti-hairpin microRNA, and most preferably selected from RNA ASO, siRNA, miRNA and / or RNA aptamers, RNA therapeutic agents. - Preferably the following DNA-based or RNA-based modifications: phosphoramide morpholino oligomers (PMO, morpholino), peptide nucleic acids (PNA), phosphorothioate-modified antisense oligonucleotides (PS-ASO), 2'-O-methyl (2'-OMe) phosphorothioate RNA, 2'-O-methoxyethyl (2'-O-MOE) RNA (2'-O-methoxyethyl-RNA (2'-MOE, MOE)), locked nucleic acids (LNA, cross-linked nucleic acids, BNA, e.g., 2'-O,4'-aminoethylene cross-linked nucleic acids (BNA-NC), BNA-based siRNA) A mixed DNA / RNA and / or synthetic nucleic acid therapeutic agent comprising or consisting of one of the following: BNA-based antisense oligonucleotides (BNA-ASO), BNA-based antimicroRNA, 2'-deoxy-2'-fluoroarabino nucleic acid (FANA), 3'-fluorohexitol nucleic acid (FHNA), glycol nucleic acid (GNA), or threose nucleic acid (TNA), more preferably a gapmer (mixmer), synthetic gapmer, synthetic CpG oligonucleotide, synthetic RNA decoy, synthetic ASO, and / or synthetic antimicroRNA. A saponin component for use according to any one of claims 1 to 14, wherein the nucleic acid therapeutic agent is a mixed DNA / RNA and / or synthetic nucleic acid therapeutic agent selected from, and more preferably from, synthetic ASO, substantially DNA-based synthetic ASO, substantially RNA-based synthetic ASO containing a 2'-MOE modification, substantially DNA-based synthetic aptamer, substantially RNA-based synthetic aptamer, synthetic gapmer, synthetic siRNA, synthetic miRNA, synthetic anti-miRNA and / or synthetic anti-miRNA ASO.

16. The nucleic acid therapeutic agent is an oligonucleotide therapeutic agent, preferably an siRNA therapeutic agent or an antisense oligonucleotide (ASO) therapeutic agent, preferably comprising one or more nucleotide analogs and / or skeletal modifications, more preferably a mutation-specific therapeutic agent, for example, an oligonucleotide therapeutic agent, preferably an siRNA therapeutic agent or an antisense oligonucleotide (ASO) therapeutic agent, comprising one or more nucleotide analogs and / or skeletal modifications designed to optionally silence and / or induce exon skipping of genes related to the impairment, the saponin component for use according to any one of claims 1 to 15.

17. The nucleic acid therapeutic agents include HTT, LRRK2, SNCA, Parkin gene, PINK1, DJ-1, DRP-1, SCN1A, SOD1, TDP-43, FUS, C9orf72, NEK1, UBQLN2, ATXN2, SMN2, SMN1, MAPT (tau gene), APP (amyloid precursor protein gene), BACE1, IL-4, IL-6, IL-7, IL-12RB2, IL-1R1, MBP, MIR29B, AR, FAS, and C2orf72. UBE3A, UBE2A, GFAP, DMD, DYN2, DGAT2, MFSD8 (CLN7), TTR, VEGF, e.g., VEGF-A, VEGFR1, VEGFR2, RHO, NF2, CMV virus IE2, CEP290, USH2A, CASP2, TRPV1, RPGR, ITGA4, PCED, USH2A, GJA1, C5, OPA1, TGFB2, RTP801, ADRB2, COCH, VEGF-165, P2RX7, JUN, BAX, APAF1, IK The researchers target genes selected from BKB, RDS, GUCY1A1, GUCY1A2, CNG (e.g., CNGA1, CNGA2, CNGA3, CNGB1, CNGB3), DDIT4, HIF1A, FN1, CTGF, TXNIP, CYP4B1, CNR1 and CNR2, STAT3, KRAS, TGFB2, MIR21, BCL2, TP53, FOXP3, GRB2, ADRB2, PTGS2 / TGFB1, CEBPA, Malat1, AHA1, and MMP14. Preferably, the gene is one of the following genes: HTT, SOD1, MFSD8 (CLN7), SMN1, SMN2, TTR, Malat1, AHA1, or MMP14, the saponin component for use according to any one of claims 1 to 16.

18. The nucleic acid therapeutic agent is preferably an oligonucleotide therapeutic agent capable of silencing genes or inactivating gene products, and more preferably the oligonucleotide therapeutic agent is nusinersen (ASO for SMN2 splicing in SMA), inotercene (ASO for TTR in hATTR), aprontersen (ASO for TTR in hATTR), butricilane (siRNA for TTR in hATTR), patisirane (siRNA for TTR in hATTR), tofersen ( ASO for SOD1 in ALS), QRX-704 (ASO for HTT), Jasifsen (ION-363, ASO for FUS), Tominersen (IONIS-HTTRx or RG6042, ASO for HTT), WVE-003 (ASO for HTT), Zilganersen (ASO for GFAP in Alexander disease), Atesidorsen, Simderilsen (ASO for GHR in acromegaly), ATL-1102 (ASO for CD49d in relapsing MS), BIIB-080 (Alzheimer's disease, pre- ASOs for tau / MAPT in cranial temporal degeneration and AD dementia), GTX-102 (ASO for UBE2A), ION-464 (ASO for SNCA), ION-541 (ASO for ATXN2), ION-859 (ASO for LRRK2), IONIS-PKKRx (ASO for KLKB1), STK-001 (ASO for splicing SCN1A), WVE-004 (ASO for C9orf72), Travedelsen (ASO for TGFB2), ISTH-0036 (ASO for TGFB2), STP-705 (siRNA against PTGS2 / TGFB1), dambatilsen (ASO against STAT3), AZD-8701 (ASO against FOXP3), siG-12D-LODER (siRNA against KRAS), IONISAR-2.5Rx (ASO against AR), SR-063 (siRNA against AR), plexijebersen (ASO against GRB2), MTL-CEBPA (saRNA for activated CEBPA), oblimersen (ASO against Bcl-2 in melanoma), rademircene (anti-miR-21),Homivirsen (ASO against CMV virus IE2), pegatinib (aptamer that binds to and blocks VEGF), bevacilanib (siRNA against VEGF-A), siRNA-027 (siRNA against VEGF-1), aganilsen (ASO against IRS1), sepofalsen (ASO for CEP290 splicing), lufepilsen (against CODA-001 and connexin 43 (GJA1)) A saponin component for use according to any one of claims 1 to 17, selected from the group consisting of ASO, IONIS-FB-LRx (ASO for CFB), QR-1123 (ASO for RHO), urtebrusen (ASO for QR-421a, USH2A), QPI-1007 (siRNA for NAION), cibanishiran (siRNA for TRPV1), and bamosiran (siRNA for ADRB2).

19. The first endocytosis receptor and / or the second endocytosis receptor are - CD71 (transferrin receptor), - CD63 (tetraspanin), - IGF1R (Insulin-like growth factor 1 (IGF-I) receptor), - InsR (insulin receptor), - GLUT4 (glucose transporter), - CI-MPR (cation-independent mannose-6-phosphate receptor), - LDL receptor, - TGFβ receptor, - EGFR, - Tropomyosin receptor kinase A (TrkA) receptor (NGF receptor), - IL13-R (interleukin-13 receptor), - AMPAR / NMDAR (AMPA-type and NMDA-type glutamate receptors), - Vascular endothelial growth factor receptor 1 or 2 (VEGFR1 or VEGFR2), - STR6 (Retinol-binding protein (RBP) receptor) A saponin component for use according to any one of claims 2 to 18, selected from the above.

20. The first ligand and / or the second ligand are - An antibody or a conjugated fragment thereof that binds to any one of the receptors described in claim 19, - A native ligand or fragment thereof recognized by any one of the receptors described in claim 19. Selected from, preferably, the first ligand and / or the second ligand are - Transferrin (Tf) or fragments thereof recognized by CD71, - Insulin or fragments thereof, - Insulin-like growth factor 1 (IGF-I) or a fragment thereof, - Insulin-like growth factor 2 (IGF-II) or a fragment thereof, - Mannose hexaphosphate, preferably multiple units thereof, - Glucose, preferably multiple units thereof, for example, zymosan A, - TGFβ or its fragments, - EGF or its fragments, - Neurotrophins (nerve growth factor, NGF) or fragments thereof - Interleukin 13 (IL-13) or a fragment thereof, - Glutamic acid or its multiple units, - Vascular endothelial growth factor A (VEGF-A) or its fragments, - Retinol (vitamin A) or other forms of vitamin A, - Retinol-binding protein (RBP) or fragment thereof, - An antibody or its conjugate fragment that binds to an endocytosis receptor selected from CD71, CD63, IGF1R, GLUT4, CI-MPR, or LDL receptor. A saponin component for use according to any one of claims 2 to 19, wherein the first ligand and / or the second ligand is selected from, and more preferably, an antibody or binding fragment thereof that binds to CD71, and even more preferably a monoclonal or single-domain antibody that binds to CD71, and most preferably a monoclonal antibody that binds to CD71.

21. The saponin component for use according to any one of claims 1 to 20, wherein the organ is part of the central nervous system (CNS), preferably the brain.

22. The administration is selected from the epidural, intrathecal, intraventricular, intracisional, intraparenchymal, and / or intranasal, and / or includes postoperative injection into the tumor lumen formed after surgery within the CNS. Preferably, the administration is selected from the intrathecal cavity, ventricle, cisterna magna and / or nasal cavity. More preferably, the administration is intrathecal, the saponin component for use according to claim 21.

23. The saponin component for use according to claim 21, wherein the administration is performed to the dura mater, or arachnoid mater, or subarachnoid space, or pia mater and / or brain tissue, preferably the administration is performed to the arachnoid mater and / or subarachnoid space, and more preferably the administration is performed to the subarachnoid space.

24. The aforementioned CNS failure is, - Preferably, a neurodegenerative disorder selected from one or more of the following: Huntington's disease (HD), Alzheimer's disease (AD), Parkinson's disease (PD), amyotrophic lateral sclerosis (ALS), spinal muscular atrophy (SMA), multiple system atrophy (MSA), multiple sclerosis (MS), and / or Lewy body dementia (DLB). - Preferably, a neurological disorder selected from stroke, epilepsy such as Dravet syndrome (DS), and / or spinal cord disorders. - Preferably, one or more selected from glioblastoma, meningioma, (oligodentic)glioma, astrocytoma, ependymoma, medulloblastoma, CNS lymphoma, and metastasis to the CNS, and more preferably selected from glioblastoma, meningioma, (oligodentic)glioma and / or metastasis to the CNS, - Preferably selected from autoimmune diseases of the CNS, immune-related diseases caused by gene deficiencies, diseases caused by infection or inflammation, and more preferably selected from meningitis, encephalitis, prion diseases and / or COVID-19. - A mental disorder preferably selected from one or more of the following: Tourette syndrome (TS), mood disorders, personality disorders, anxiety disorders, substance use or addiction disorders, obsessive-compulsive disorder, neurodevelopmental disorders, and eating disorders, and more preferably selected from mood disorders which are anxiety disorders, obsessive-compulsive disorder, eating disorders, and / or preferably treatment-resistant mood disorders. A saponin component for use according to any one of claims 21 to 23, selected from the above.

25. The CNS disorder is selected from neurological disorders associated with spinal muscular atrophy, hereditary transthyretin amyloidosis (hATTR), preferably SOD1-related amyotrophic lateral sclerosis (ALS), Huntington's disease, Alzheimer's disease, Parkinson's disease, Batten's disease, frontotemporal dementia, spinocerebellar degeneration type 3, multiple system atrophy, Rett syndrome, Alexander disease, Angelman syndrome, Lafora disease, GFAP astrocytopathy, prion diseases, and acromegaly, as described in any one of claims 21 to 24.

26. The nucleic acid therapeutic agents include nusinersen (ASO for SMN2 splicing in SMA), inotercene (ASO for TTR in hATTR), aprontersen (ASO for TTR in hATTR), butricirane (siRNA for TTR in hATTR), patisirane (siRNA for TTR in hATTR), tofersen (ASO for SOD1 in ALS), jasifsen (ASO for ION-363, FUS), tominersen (IONIS-HTTRx or RG6042, ASO for HTT), QRX-704 (ASO for HTT), WVE-003 (ASO for HTT), Zilganersen (ASO for GFAP in Alexander disease), Athesidorsen, Simderilsen (ASO for GHR in acromegaly), ATL-1102 (ASO for CD49d in relapsing MS), BIIB-080 (ASO for tau / MAPT in Alzheimer's disease, frontotemporal degeneration, and AD dementia), GTX-102 (ASO for UBE2A), ION-464 (ASO for SNCA) ASO for (ASO for), ION-541 (ASO for ATXN2), ION-859 (ASO for LRRK2), IONIS-PKKRx (ASO for KLKB1), STK-001 (ASO for splicing SCN1A), WVE-004 (ASO for C9orf72), Travedersen (ASO for TGFB2), ISTH-0036 (ASO for TGFB2), STP-705 (siRNA for PTGS2 / TGFB1), Dambatilsen (ASO for STAT3), AZD-8701 (FOX A saponin component for use according to any one of claims 21 to 25, which is an oligonucleotide therapeutic agent selected from the group consisting of P3 (ASO), siG-12D-LODER (siRNA for KRAS), IONISAR-2.5Rx (ASO for AR), SR-063 (siRNA for AR), plexijebersen (ASO for GRB2), MTL-CEBPA (saRNA for activated CEBPA), oblimersen (ASO for Bcl-2 in melanoma), and rademircene (anti-miR-21).

27. A first ligand and / or a second ligand as described in claim 2, The first endocytosis receptor and / or the second endocytosis receptor are present on the cells and / or tissues within the CNS, preferably the cells are selected from one or more of neurons, astrocytes, oligodendrocytes, microglia, endothelial cells, blood cells and / or tumor cells, more preferably the cells are selected from one or more of neurons, astrocytes, oligodendrocytes, microglia, endothelial cells and / or tumor cells. Most preferably, the first endocytosis receptor and / or the second endocytosis receptor are - CD71 (transferrin receptor), - CD63 (tetraspanin), - IGF1R (Insulin-like growth factor 1 (IGF-I) receptor), - InsR (insulin receptor), - GLUT4 (glucose transporter), - CI-MPR (cation-independent mannose-6-phosphate receptor), - LDL receptor, - TGFβ receptor, - EGFR, - Tropomyosin receptor kinase A (TrkA) receptor (NGF receptor), - IL13-R (interleukin-13 receptor), - AMPAR / NMDAR (AMPA-type and NMDA-type glutamate receptors) A saponin component for use according to any one of claims 21 to 26, selected from the above.

28. A first ligand and / or a second ligand as described in claim 2, The first ligand and / or the second ligand are - An antibody or a conjugated fragment thereof that binds to any one of the receptors described in claim 27, - A native ligand or fragment thereof recognized by any one of the receptors described in claim 27. Selected from, preferably, the first ligand and / or the second ligand are - Transferrin (Tf) or fragments thereof recognized by CD71, - Insulin or fragments thereof, - Insulin-like growth factor 1 (IGF-I) or a fragment thereof, - Insulin-like growth factor 2 (IGF-II) or a fragment thereof, - Mannose hexaphosphate, preferably multiple units thereof, - Glucose, preferably multiple units thereof, for example, zymosan A, - TGFβ or its fragments, - EGF or its fragments, - Neurotrophins (nerve growth factor, NGF) or fragments thereof - Interleukin 13 (IL-13) or a fragment thereof, - Glutamic acid or its multiple units, - An antibody or its conjugate fragment that binds to an endocytosis receptor selected from CD71, CD63, IGF1R, GLUT4, CI-MPR, or LDL receptor. A saponin component for use according to any one of claims 21 to 27, wherein the first ligand and / or the second ligand is selected from, more preferably, an antibody or binding fragment thereof that binds to CD71, even more preferably a monoclonal or single-domain antibody that binds to CD71, and most preferably a monoclonal antibody that binds to CD71.

29. The effector component includes an oligonucleotide therapeutic agent that targets one of STAT3, SOD1, Malat1, AHA1, MMP14, TTR, and HTT, or an oligonucleotide therapeutic agent selected from nusinersen, tominersen, tofersen, inotercene, eprontersen, butricirane, patisirane, and travedersen. The saponin component for use according to any one of claims 21 to 28, comprising the pentacyclic triterpene saponin SO1861, wherein the aldehyde functional group at the C-23 position is substituted by the acid-sensitive covalent bond configured to cleave under acidic conditions to produce the aldehyde functional group at the C-23 position of the aglycone core.

30. The administration is intrathecal and preferably comprises the two-component free saponin preparation, the two-component linker-saponin preparation, or the one-component preparation according to claim 29.

31. The saponin component for use according to any one of claims 1 to 20, wherein the organ is the eye, and the disorder is further referred to as an eye disorder.

32. The administration is intraocular, preferably selected from intrascleral, choroidal, subretinal, anterior chamber, intravitreous, and vitreoretinal, more preferably the administration includes one selected from anterior chamber injection, anterior chamber implant, intravitreous injection, subretinal injection, intravitreous implant, and scleral plug, even more preferably the administration is intravitreous, even more preferably the administration includes intravitreous injection or intravitreous implant, most preferably the administration includes intravitreous injection or The saponin component for use according to claim 31, wherein the local administration is periorbital, preferably subconjunctival, and more preferably subconjunctival injection or subconjunctival implant.

33. The eye disorder is a disorder of the posterior segment of the eye, preferably a disorder of the retina, choroid, optic nerve, or vitreous humor, more preferably a disorder selected from one or more of the following: glaucoma, posterior uveitis, posterior scleritis, retinitis, exudative or atrophic age-related macular degeneration (AMD), geographic atrophy, diabetic retinopathy, diabetic or non-diabetic macular edema, choroidal neovascularization, retinoblastoma, and congenital disorders of the retina, choroid, optic nerve, or vitreous humor, and more preferably a congenital disorder of the retina selected from one of the following: retinitis pigmentosa (RP), Leber congenital amaurosis (LCA), USH2A retinopathy, and neurofibromatosis type 2 (NFT2), or The ocular disorder is a disorder of the anterior segment of the eye, preferably selected from one or more of the following: anterior uveitis, iritis, blepharitis, conjunctivitis, palpebral conjunctivitis, keratitis, anterior scleritis, episcleritis, dry eye disease, cataract, corneal abrasion, corneal neovascularization, and trauma to the anterior segment or a part thereof, the saponin component for use according to claim 31 or 32.

34. The saponin component for use according to any one of claims 31 to 33, wherein the ocular disorder is selected from cytomegalovirus retinitis infection, age-related macular degeneration (AMD), autosomal dominant retinitis pigmentosa, Leber hereditary optic neuropathy, Stargardt disease, Usher syndrome, ocular disorders associated with acromegaly, or ocular disorders associated with myotonic dystrophy.

35. The nucleic acid therapeutic agent is VEGF, for example, VEGF-A, VEGFR1, VEGFR2, RHO, NF2, CMV virus IE2, CEP290, USH2A, CASP2, TRPV1, RPGR, ITGA4, PCED, USH2A, GJA1, C5, OPA1, TGFB2, RTP801, TTR, MAPT (tau gene), APP (amyloid precursor protein gene), BACE1, IL-4, IL-6, IL-7, AR, FAS, ADRB2, COCH, VEGF-165, P2RX7, JUN, BAX, APAF1, IKBKB A saponin component for use according to any one of claims 31 to 34, which targets a gene selected from RDS, GUCY1A1, GUCY1A2, CNG (e.g., CNGA1, CNGA2, CNGA3, CNGB1, CNGB3), DDIT4, HIF1A, FN1, CTGF, TXNIP, CYP4B1, CNR1 and CNR2, STAT3, KRAS, TGFB2, MIR21, BCL2, TP53, FOXP3, GRB2, ADRB2, PTGS2 / TGFB1, CEBPA, Malat1, AHA1, and MMP14.

36. The nucleic acid therapeutic agents include homivirsen (ASO against CMV virus IE2), pegatinib (aptamer that binds to and blocks VEGF), bevacilanib (siRNA against VEGF-A), siRNA-027 (siRNA against VEGF-1), aganilsen (ASO against IRS1), sepofalsen (ASO for CEP290 splicing), and lufepilsen (ASO against CODA-001 and connexin 43 (GJA1)). IONIS-FB-LRx (ASO for CFB), QR-1123 (ASO for RHO), Urtebrusen (ASO for QR-421a, USH2A), QPI-1007 (siRNA for NAION), Chibanisilan (siRNA for TRPV1) and Vamosiran (siRNA for ADRB2), Trabedersen (ASO for TGFB2), ISTH-0036 (ASO for TGFB2), STP-705 (PTGS2 / TG siRNA against FB1), dambatilsen (ASO against STAT3), AZD-8701 (ASO against FOXP3), siG-12D-LODER (siRNA against KRAS), IONISAR-2.5Rx (ASO against AR), SR-063 (siRNA against AR), plexijebersen (ASO against GRB2), MTL-CEBPA (saRNA for activated CEBPA), oblimersen (against Bcl-2 in melanoma) An oligonucleotide therapeutic agent selected from the group consisting of (ASO), rademircene (anti-miR-21), inotercene (ASO for TTR in hATTR), aprontersen (ASO for TTR in hATTR), butrisilane (siRNA for TTR in hATTR), patisirane (siRNA for TTR in hATTR), atesidorsen and simderilsen (ASO for GHR in acromegaly), or An oligonucleotide therapeutic agent designed to reduce or inhibit the expression of VEGF, preferably VEGF-A, or preferably one of its receptors selected from VEGFR1 or VEGFR2, or A saponin component for use according to any one of claims 31 to 35, preferably an oligonucleotide therapeutic agent designed to induce exon skipping of the human RPG gene, or the SH2A gene, or the NF2 gene.

37. A first ligand and / or a second ligand as described in claim 2, The first endocytosis receptor and / or the second endocytosis receptor are present on the cells and / or tissues within the eye, preferably the cells being retinal cells or retinal blood vessel cells. Most preferably, the first endocytosis receptor and / or the second endocytosis receptor are - CD71 (transferrin receptor), - CD63 (tetraspanin), - IGF1R (Insulin-like growth factor 1 (IGF-I) receptor), - InsR (insulin receptor), - GLUT4 (glucose transporter), - CI-MPR (cation-independent mannose-6-phosphate receptor), - LDL receptor, - TGFβ receptor, - EGFR, - Vascular endothelial growth factor receptor 1 or 2 (VEGFR1 or VEGFR2), - STR6 (Retinol-binding protein (RBP) receptor) A saponin component for use according to any one of claims 31 to 36, selected from the above.

38. A first ligand and / or a second ligand as described in claim 2, The first ligand and / or the second ligand are - An antibody or a conjugated fragment thereof that binds to any one of the receptors described in claim 35, - A natural ligand or fragment thereof recognized by any one of the receptors described in claim 35. Selected from, preferably, the first ligand and / or the second ligand are - Transferrin (Tf) or fragments thereof recognized by CD71, - Insulin or fragments thereof, - Insulin-like growth factor 1 (IGF-I) or a fragment thereof, - Insulin-like growth factor 2 (IGF-II) or a fragment thereof, - Mannose hexaphosphate, preferably multiple units thereof, - Glucose, preferably multiple units thereof, for example, zymosan A, - TGFβ or its fragments, - EGF or its fragments, - Vascular endothelial growth factor A (VEGF-A) or its fragments, - Retinol (vitamin A) or other forms of vitamin A, - Retinol-binding protein (RBP) or fragment thereof, - An antibody or its conjugate fragment that binds to an endocytosis receptor selected from CD71, CD63, IGF1R, GLUT4, CI-MPR, LDL receptor, VEGFR1, VEGFR2, and STRA6. A saponin component for use according to any one of claims 31 to 37, wherein the first ligand and / or the second ligand is selected from, more preferably, an antibody or binding fragment thereof that binds to CD71, even more preferably a monoclonal or single-domain antibody that binds to CD71, and most preferably a monoclonal antibody that binds to CD71.

39. The effector component comprises an oligonucleotide therapeutic agent that targets one of STS3, SOD1, Malat1, AHA1, MMP14, TTR, and HTT, or an oligonucleotide therapeutic agent selected from homivirsen, pegatinib, inotercene, eprontersen, butricilane, patisirane, sepofalsen, QR-421a, urtebrusen, cibanishirane, and QPI-1007, and the saponin component comprises the pentacyclic triterpene saponin SO1861, which is SO1861, wherein the aldehyde functional group at the C-23 position is substituted by the acid-sensitive covalent bond configured to cleave under acidic conditions to produce the aldehyde functional group at the C-23 position of the aglycone core.

40. The administration is intravitreous and preferably comprises the two-component free saponin preparation, the two-component linker-saponin preparation, or the one-component preparation according to claim 39.