Recombinant clostridium tyrobutyricum for producing butyl acetate as well as construction method and application of recombinant clostridium tyrobutyricum

By introducing genes such as aldol dehydrogenase, coenzyme A transferase, and acetoacetic acid decarboxylase into Clostridium butyricum, a synthetic pathway from glucose to butyl acetate was constructed, solving the problems of high production cost and low yield in existing technologies, and realizing efficient and low-cost production of butyl acetate.

CN121344031APending Publication Date: 2026-01-16SOUTH CHINA UNIV OF TECH
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511593809.4
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-11-03
Publication Date
2026-01-16

AI Technical Summary

Technical Problem

Existing methods for biosynthesizing butyl acetate suffer from high production costs, low yields, and complex downstream processes. Wild-type Clostridium butyricum does not possess the ability to synthesize butyl acetate.

Method used

In Clostridium butyricum, the genes for aldol dehydrogenase (AdhE1), coenzyme A transferase (CtfAB), acetoacetate decarboxylase (Adc), and alcohol acyl transferase (ATF1) were introduced and overexpressed to construct a complete synthetic pathway from glucose to butyl acetate.

Benefits of technology

The efficient biosynthesis of butyl acetate was achieved, with a yield of 43.27 g/L. This simplified the downstream separation and purification steps, reduced raw material costs, and improved production efficiency.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121344031A_ABST
    Figure CN121344031A_ABST
Patent Text Reader

Abstract

The invention relates to genetic engineering and microbial fermentation in the technical field of biology, and particularly discloses recombinant clostridium tyrobutyricum for producing butyl acetate as well as a construction method and application of the recombinant clostridium tyrobutyricum. The preparation method of the recombinant bacterial strain comprises the following steps: introducing and overexpressing the following exogenous genes into clostridium tyrobutyricum: an aldol dehydrogenase gene adhE1, a coenzyme A transferase gene ctfAB, an acetoacetate decarboxylase gene adc and an alcohol acyltransferase gene ATF1, so as to obtain the recombinant clostridium tyrobutyricum. The clostridium tyrobutyricum reconstructs a complete synthesis route from glucose to butyl acetate in clostridium tyrobutyricum, overcomes the limitation that expensive precursors (butanol, acetic acid or acetyl coenzyme A) and a lipase catalyst need to be exogenously added in the prior art, remarkably reduces the production cost, has higher butyl acetate synthesis capability, and has a wide application prospect. The yield of the butyl acetate is up to 43.27 g / L.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to a method for constructing a recombinant Clostridium butyricum strain for producing butyl acetate and its application. Background Technology

[0002] Butyl acetate is an important industrial solvent and fragrance component, widely used in coatings, inks, cosmetics, food, and pharmaceuticals. Market research predicts that the global fatty acid ester market will exceed $100 billion by 2035. Currently, the industrial production of butyl acetate mainly relies on chemical methods, specifically the synthesis of butyl acetate from petroleum-based acetic acid and butanol via a Fischer esterification reaction catalyzed by concentrated sulfuric acid. This method suffers from inherent drawbacks such as severe equipment corrosion, high energy consumption, and significant environmental pollution, contradicting the global "dual carbon" strategic goals. Therefore, developing green and sustainable biomanufacturing routes to replace traditional chemical processes has become an inevitable trend.

[0003] Existing biosynthetic strategies can be mainly divided into two categories: 1. Enzymatic Catalysis: In microbial fermentation systems capable of producing butanol or acetic acid, exogenous lipases are added to catalyze the esterification reaction of acids and alcohols. For example, in... C. acetobutylicum Adding acetic acid and lipase to NJ4 can produce 7.30 g / L butyl acetate (Biotechnology for Biofuels, 2021, 14:203). This strategy heavily relies on expensive exogenous enzyme preparations and precursors, resulting in high production costs and poor economic efficiency.

[0004] 2. De novo microbial synthesis: This strategy aims to utilize engineered microorganisms to directly synthesize butyl acetate via endogenous metabolic pathways using fermentable sugars as the sole carbon source, representing a more promising direction. Existing research mainly focuses on modifying... C. beijerinckii (Overexpression of ATF1, yield 5.57 g / L; Journal of Agricultural and Food Chemistry, 2020, 68(35): 9475-9487), Escherichia coli (yield 22.8 g / L after steam stripping and concentration, with a byproduct ethyl acetate yield of approximately 5 g / L; Microbial Cell Factories, 2022, 21(1):28), and other strains. However, the industrial application of these systems still faces challenges due to either low yields or the need for complex downstream concentration processes.

[0005] Clostridium butyricum (Clocas luteolinum) Clostridium tyrobutyricumClostridium butyricum is a recognized, strictly anaerobic bacterium with excellent industrial application potential. It possesses highly efficient organic acid synthesis capabilities, a clear genetic background, a concise central metabolic network, and biocompatibility as a probiotic. More importantly, it naturally accumulates abundant acetyl-CoA and butyryl-CoA within its cells, which are key precursors for the synthesis of short-chain fatty acid esters. However, wild-type Clostridium butyricum lacks the ability to synthesize butyl acetate. Summary of the Invention

[0006] The purpose of this invention is to overcome the above-mentioned shortcomings of the prior art and provide a recombinant Clostridium caseinate capable of efficiently synthesizing butyl acetate de novo, its construction method, and its application.

[0007] This invention utilizes metabolic engineering techniques to introduce and overexpress exogenous genes for aldol dehydrogenase (AdhE1), coenzyme A transferase (CtfAB), acetoacetate decarboxylase (Adc), and alcohol acyl transferase (ATF1) in *Clostridium butyricum* (neutral site), thereby successfully reconstructing a complete and efficient synthetic pathway from glucose to butyl acetate in this strain. This invention represents the first time that highly efficient biosynthesis of butyl acetate has been achieved in *Clostridium butyricum*.

[0008] The objective of this invention is achieved through the following technical solution: A method for constructing recombinant Clostridium butyricum, in Clostridium butyricum (C. butyricum) Clostridium tyrobutyricum The following exogenous gene was introduced and overexpressed in the study: Aldol dehydrogenase gene. adhE1 Coenzyme A transferase gene ctfAB acetoacetic acid decarboxylase gene adc and acyltransferase gene ATF1 Recombinant Clostridium butyricum was obtained.

[0009] Preferably, the aldol dehydrogenase gene adhE1 (CA_P0162), coenzyme A transferase gene ctfAB ((ctfA:CA_P0163, ctfB:CA_P0164)), acetoacetate decarboxylase gene adc (CA_RS20035) is derived from Clostridium acetonebutanol (Clostridium perfringens) Clostridium acetobutylicum The alcohol acyltransferase gene ATF1 Derived from brewer's yeast ( Saccharomyces cerevisiae ).

[0010] Preferably, the aldol dehydrogenase gene adhE1 The nucleotide sequence is shown in SEQ ID NO: 1; the coenzyme A transferase gene ctfAB The nucleotide sequence is shown in SEQ ID NO: 2; the acetoacetic acid decarboxylase gene adcThe nucleotide sequence is shown in SEQ ID NO: 3; the alcohol acyltransferase gene ATF1 The nucleotide sequence is shown in SEQ ID NO: 4; the Clostridium butyricum is... C. tyrobutyricum ATCC 25755.

[0011] Preferably, the exogenous gene is introduced into Clostridium butyricum via at least one recombinant plasmid; the backbone of the recombinant plasmid is selected from pMTL83153 and / or pMTL82151.

[0012] Preferably, the exogenous gene further includes an erythromycin resistance gene. Em .

[0013] Preferably, the erythromycin resistance gene Em The nucleic acid sequence is shown in SEQ ID NO:8.

[0014] Preferably, the method for constructing recombinant Clostridium butyricum includes the following steps: (1) PCR amplification of the target gene, including the exogenous gene and promoter; (2) The target gene is ligated to a reverse PCR vector or a double-digested vector; (3) The ligation product was transformed into Escherichia coli CA434, and positive clones were screened on chloramphenicol or erythromycin-resistant LB plates to obtain recombinant plasmids; (4) The above recombinant plasmid was transferred into Clostridium butyricum by bacterial conjugation to obtain recombinant Clostridium butyricum.

[0015] Preferably, the promoter comprises: Clostridium butyricum. cat1 (CTK_RS03145) gene promoter P cat1 Its nucleic acid sequence is shown in SEQ ID NO:5, Clostridium butyricum. thl (CTK_RS00800) gene promoter P thl Its nucleic acid sequence is shown in SEQ ID NO:6, and the promoter P of the Clostridium acetone-butanol flavin gene (CA_C1027) is present. fla Its nucleic acid sequence is shown in SEQ ID NO:7.

[0016] Preferably, step (3) yields the recombinant plasmid pMTL83153-Δ cat1 ::P thl - adhE1 pMTL83153-Δ ldh1 ::P thl - ctfAB -P cat1 - adc pMTL82151-P fla -ATF1 - Em ; Step (4) First, the above recombinant plasmid pMTL83153-Δ cat1 ::P thl - adhE1 pMTL83153-Δ ldh1 ::P thl - ctfAB -P cat1 - adc Genome editing was performed on Clostridium butyricum via bacterial conjugation to obtain an engineered strain of Clostridium butyricum; then the recombinant plasmid pMTL82151-P was... fla - ATF1 - Em Recombinant Clostridium butyricum was obtained by transferring the above-mentioned Clostridium butyricum engineered strain into it through bacterial conjugation.

[0017] The application of the recombinant Clostridium butyricum in the fermentation production of butyl acetate. Preferably, the fermentation is carried out under anaerobic conditions, with fermentation conditions of 20~37℃, 150±100 rpm, and an inoculum size of 1~10%.

[0018] Preferably, the fermentation medium consists of 0-4 g / L peptone, 0-2 g / L yeast extract, 1 g / L K2HPO4·3H2O, 0.5 g / L KH2PO4, 2 g / L (NH4)2SO4, 0-40 g / L CaCO3, and 30-120 g / L carbon source; trace elements at a ratio of 1:1000 (v / v); and a trace element stock solution consisting of 15 g / L FeSO4·7H2O, 15 g / L ZnSO4·7H2O, 10 g / L MnSO4·H2O, 100 g / L MgSO4·7H2O, 20 g / L CoCl2·6H2O, and 15 g / L CaCl2·2H2O.

[0019] Preferably, fed-batch fermentation is used during the fermentation process to maintain the carbon source concentration; and / or, during or in the later stages of fermentation, an organic solvent is added to the fermentation system for extraction to separate the butyl acetate produced in situ.

[0020] Preferably, after culturing for 24 hours, an organic solvent, n-hexadecane, is added for extraction. Preferably, the carbon source is glucose.

[0021] Alcohol acyltransferases can directly condense acyl-CoA and fatty alcohols as substrates to form fatty acid esters, while simultaneously regenerating CoA, thus achieving CoA recycling. Therefore, this invention selects *Clostridium butyricum* as the starting strain, whose products include butyryl-CoA, acetyl-CoA, and acetic acid, etc., through overexpression of the aldol dehydrogenase gene (…).adhE1 This increases butanol and ethanol in the product through overexpression of the coenzyme A transferase gene. ctfAB ) and acetoacetate decarboxylase gene ( adc To promote acetic acid reabsorption, the acyltransferase gene was overexpressed on this recombinant strain. ATF1 This allows for the direct metabolism of glucose into butyl acetate.

[0022] The method for producing butyl acetate by fermentation with engineered bacteria provided by this invention is as follows: Glycerin bacteria stored at -80℃ were inoculated into CGM seed culture medium and activated overnight at 37℃. The activated seed culture was then inoculated into CGM seed culture medium again and cultured at 37℃ for 12 h. The seed culture was then inoculated into fermentation medium at 5% and cultured at 37℃ and 150 rpm for 24 h. After that, the extraction solvent was added (culture medium: extraction solvent ratio of 2:1). Seed culture medium: CGM medium, 20 g / L glucose, filled with high-purity nitrogen.

[0023] Fermentation medium: CGM medium, 60 g / L glucose, 40 g / L CaCO3, purged with high-purity nitrogen.

[0024] Extractant used: n-hexadecane.

[0025] The present invention also provides a fermentation method for increasing the yield of butyl acetate from Clostridium butyricum, the method being as follows: (1) Increase the acetic acid reabsorption pathway and improve the precursor supply, thereby increasing the yield of butyl acetate; (2) Replace the antibiotic resistance gene and eliminate the metabolic interference of the chloramphenicol resistance gene (which belongs to the acyltransferase family, the same as ATF1) on the ester synthesis pathway; (3) Optimizing fermentation conditions to increase butyl acetate yield; (4) Two-stage temperature-controlled fermentation increases the yield of butyl acetate.

[0026] Compared with the prior art, the present invention has the following beneficial effects: (1) The present invention reconstructs the complete synthetic pathway from glucose to butyl acetate in Clostridium butyricum, which overcomes the defects of the prior art that requires the addition of expensive precursors (butanol, acetic acid or acetyl-CoA) and lipase catalysts. It can directly convert organic carbon sources into butyl acetate, which greatly saves raw material costs.

[0027] (2) The recombinant strain provided by the present invention has a high ability to synthesize butyl acetate and a high yield of butyl acetate. In the optimized two-stage temperature-controlled fed fermentation process, the yield of butyl acetate is as high as 43.27 g / L, which is the highest value reported so far for direct microbial fermentation.

[0028] (3) This invention simplifies the downstream separation and purification steps and saves separation costs. Since organic acids and organic alcohols have extremely low partition coefficients in the hexadecane / aqueous phase system and butyl acetate has an extremely high partition coefficient, the hexadecane phase contains almost only butyl acetate (with a selectivity of up to 99%), making it very easy to separate and purify. Attached Figure Description

[0029] Figure 1 This is the biosynthetic pathway of butyl acetate synthesized by Clostridium butyricum.

[0030] Figure 2 This describes the fermentation process of Clostridium butyricum, an engineered bacterium that produces butyl acetate. A: Liquid phase product; B: Gas phase product.

[0031] Figure 3 It is about replacing the promoter and overexpression. ctfAB - adc Fermentation of genetically engineered bacteria: A: liquid phase products; B: gas phase products.

[0032] Figure 4 These are the fermentation results of engineered strains with different antibiotic resistance. A and B: fermentation results of C3A (thiamphenicol resistance); C and D: fermentation results of C3AE (erythromycin resistance). Figure 5 This shows the fermentation of engineered strain C3AE under different organic nitrogen source concentrations. A: Liquid phase product; B: Gas phase product.

[0033] Figure 6 The results show the fermentation of engineered strain C3AE under two-stage temperature conditions: shake flask fermentation results (A and B); and fermenter fermentation results (C and D).

[0034] Figure 7 The results are the fermentation results of engineered strain C3AE under conditions of 37℃ (A and B), 30℃ (C and D), and 25℃ (E and F). Detailed Implementation

[0035] To enable those skilled in the art to more clearly understand the core technology of this invention, the invention will be further described in detail below with reference to the accompanying drawings and specific embodiments. It should be understood that, unless otherwise specified, the experimental methods used in the following embodiments are conventional methods. The primer sequences used in this invention are shown in Table 1, and all were synthesized by Youkang Biotechnology Co., Ltd.

[0036] Table 1 Primer sequences used in this invention

[0037]

[0038] Description of biological materials: Clostridium butyricum (Clocas luteolinum) C. tyrobutyricum ATCC 25755 is available from the American Type Culture Collection (ATCC).

[0039] pMTL82151 plasmid and E. coli CA434 were available from Baosai Biotechnology.

[0040] pMTL-Em plasmid (see literature: Elimination of carbon catabolite repressionin) Clostridium tyrobutyricum for enhanced butyric acid production from lignocellulosic hydrolysates. Bioresource Technology, 2022, 357: 127320).

[0041] pMTL83153 plasmid (see literature: De novo biosynthesis of butyl butyrate in engineered) Clostridium tyrobutyricum Metabolic Engineering, 2023, 77: 64-75).

[0042] Example 1: Construction of engineered strains C1A, C2A, C3A, C4A, and C3AE (1) Recombinant plasmid pMTL83153-Δ cat1 ::P thl - adhE1 Construction Recombinant plasmid pMTL83153-Δ cat1 ::P thl - adhE1 The specific process of its construction is as follows: Selecting the target gene spacer sequence: The spacer sequence of the target gene was selected 23 bp downstream of the PAM site.

[0043] Gene fragment amplification: using pCloneEZ-P5830-repeat ( FnCpf1 (The plasmid sequence is shown in SEQ ID NO:9) and pCloneEZ-repeat ( FnCpf1 Using the )-terminator plasmid (plasmid sequence shown in SEQ ID NO:10) as a template, primer P5830-sp( xylT-II )-F(FX1)-(1-2) and P5830-repeat(FnCpf1 )-sp( cat1 )-R、Ter-sp( cat1 )-repeat( Cpf1 )-F and Ter-H1( cat1 The P5830-repeat and repeat-terminator fragments were amplified separately using primer P-R. The 3′ end of the P5830-repeat and the 5′ end of the repeat-terminator contained the spacer sequence of the target gene. Using the Clostridium butyricum ATCC 25755 genome as a template, primer P was used to amplify the P5830-repeat and repeat-terminator fragments respectively. thl -F( adhE1 ) and P thl -R( adhE1 Amplify promoter P thl Using primer H1 ( cat1 )- Sac IF and Nru IP cat1 -R(FX), H2( cat1 )- Kpn IF(FX) and H2( cat1 )- Xho IR amplification knockout of target gene cat1 The upstream and downstream homologous arms H1 and H2; using the large plasmid pSOL1 (NC_001988.2) of Clostridium acetone-butanol ATCC 824 as a template, primers were used... adhE1 -P thl -F and adhE1 - Kpn I-H2( cat1 )-R amplification adhE1 Gene; using pMTL83153 plasmid as template, primer P cat1 - Xho IF and M13R-P5830- Sac II-R(BFX1)-(1-3) reverse PCR amplification of linearized vector.

[0044] The DNA polymerase used for PCR amplification was purchased from Novizan Biosciences Co., Ltd. The PCR amplification system was as follows:

[0045] PCR reaction program: 98℃, 30 sec; 98℃, 10 sec, 55℃, 5 sec, 72℃, 15 sec, 30 cycles; 72℃, 5 min.

[0046] The P5830-repeat-sp( cat1 )-repeat-terminator-H1-Pthl - adhE1 -H2 is linked together. The overlapped extended PCR fragment and the linearized vector fragment are purified and recovered using a PCR product purification kit.

[0047] The purified and recovered fragments were ligated to the vector using the Gibson method (seamless cloning kit purchased from Sangon Biotech Co., Ltd.). The ligation system was as follows:

[0048] Immediately after the reaction, the reaction product was transferred into *E. coli* CA434 competent cells, incubated on ice for 15-25 min, heat-shocked at 42°C for 90 sec, and then immediately transferred to ice and incubated for 1-2 min. 1 mL of antibiotic-free LB liquid medium was added and incubated for at least 45 min. After centrifugation, most of the supernatant was discarded, and the cells were resuspended in the residual liquid by gentle pipetting. The cells were then plated onto LB agar plates and incubated at 37°C for 24 h. Positive clones were picked and verified by PCR using primers Pro-F and Pro-R. The clones were then sent to Yocon Biotech for sequencing verification. The plasmid was extracted (DNA was purified and recovered using a plasmid extraction kit purchased from Novizan Biotechnology Co., Ltd.) and named pMTL83153-Δ. cat1 ::P thl - adhE1 .

[0049] (2) Recombinant plasmid pMTL83153-Δ cat1 ::P cat1 - adhE1 Construction With recombinant plasmid pMTL83153-Δ cat1 ::P thl - adhE1 Using primers as templates adhE1 -P cat1 -F and P cat1 - adhE1 -R was used for reverse PCR amplification, and the linearized fragment was purified and recovered. The vector was self-ligated with a seamless cloning enzyme and then transformed into Escherichia coli CA434. The subsequent steps were the same as the construction method in (1) of Example 1.

[0050] (3) Recombinant plasmid pMTL83153-Δ ldh1 ::P thl - ctfAB -P cat1 - adc Construction The target gene spacer sequence was selected as in Example 1 (1); Gene fragment amplification: using pCloneEZ-P5830-repeat ( FnCpf1) and pCloneEZ-repeat FnCpf1 The )-terminator plasmid was used as a template with primer P5830-sp( xylT-II )-F(FX1)-(1-2) and P5830-repeat( FnCpf1 )-sp( ldh1 )-R、Ter-sp( ldh1 )-repeat( Cpf1 )-F and Ter-H1( ldh1 The P5830-repeat and repeat-terminator fragments were amplified separately using primer P-R. The 3′ end of the P5830-repeat and the 5′ end of the repeat-terminator contained the spacer sequence of the target gene. Using the Clostridium butyricum ATCC 25755 genome as a template, primer P was used to amplify the P5830-repeat and repeat-terminator fragments respectively. thl -F( ldh1 ) and P thl -R( ctfAB Amplify promoter P thl , using P cat1 -F and P cat1 - Adc -R amplification P cat1 Promoter, using H1 ( ​ )-Ter-F and H1( ​ ) / ​ IR(P ​ H2 ​ )-F(FX) and H2 ( ​ )- ​ IR amplification knockout of target gene ​ 1. Upstream and downstream homologous arms H1 and H2; using the natural large plasmid pSOL1 of Clostridium acetonebutanol ATCC 824 as a template, primers were used... ​ -F(P ​ ) and Ter / ​ IP ​ -R amplification ​ Genes, used ​ -P ​ -F and ​ / ​ I-H2( ​ )-R amplification ​ Genes, and subsequent steps are the same as the construction method in part (1) of Example 1.

[0051] (4) Recombinant plasmid pMTL82151-P ​ - ​ Construction Target gene amplification, ​ Gene primers​ (1)-F1(P ​ )and ​ (3)-R3( ​ I) Amplification ​ Genes; using Clostridium acetone-butanol ATCC 824 genomic DNA as a template, primer P ​ - ​ II-F and 82151-P ​ -R( ​ I) Amplification of P ​ Promoter.

[0052] P was generated by overlap extension PCR. ​ The promoter is linked to the ATF1 gene to obtain P ​ - ​ Gene fragment, pMTL82151 plasmid, was used with restriction endonucleases ​ II and ​ Linearization was performed by double enzyme digestion (restriction endonucleases were purchased from Thermo Fisher Scientific). The reaction system was as follows:

[0053] The obtained overlapping extended PCR fragment and double enzyme digestion product were purified and recovered using a purification and recovery kit. The purified fragment and vector were ligated using the Gibson method. The subsequent steps were the same as the construction method in part (1) of Example 1.

[0054] (5) Recombinant plasmid pMTL82151-P ​ - ​ - ​ Construction With plasmid pMTL82151-P ​ - ​ Using pMTL-Em plasmid as a template, the vector fragment was amplified by reverse PCR with primers 82151-F1(FX) and 82151-R1(FX). ​ -F and ​ -R amplifies the erythromycin gene.

[0055] The linearized vector was linked to the erythromycin gene fragment (as shown in SEQ ID NO:8) using the Gibson method, and the subsequent steps were the same as the construction method in part (1) of Example 1 (LB resistance is erythromycin resistance).

[0056] (6) Construction of engineered strains Bacterial conjugation culture: The above recombinant plasmid pMTL83153-Δ ​ ::P ​ - ​pMTL83153-Δ ​ ::P ​ - ​ pMTL83153-Δ ​ ::P ​ - ​ -P ​ - ​ Transformed into Clostridium butyricum RMN / Cas12a via bacterial conjugation ( ​ ATCC 25755 / Δ ​ Δ ​ , ΔpCTK01,Δ ​ ::P ​ - ​ Knockout of wild-type Clostridium butyricum ATCC 25755 ​ Gene (CTK_RS00780), type I restriction modification system ​ The (CTK_C27620) gene and the natural large plasmid pCTK01 (NZ_CP014171.1) were used in... ​ (CTK_RS02165) Neutral site integration of FnCas12a (nucleic acid sequence shown in SEQ ID NO:11) gene expression cassette, the specific steps are as follows: E. coli CA434 containing the recombinant plasmid was cultured in double-antibiotic LB medium (25 μg / mL chloramphenicol + 50 μg / mL kanamycin) at 37°C with shaking at 150 rpm until OD reached. 600 1.5-2.0, collect 3 mL of E. coli into a 2 mL sterile centrifuge tube, wash once with 1× sterile PBS, centrifuge at 4000 rpm for 2 min, and then incubate with 300-500 μL until OD. 600 Mix Clostridium butyricum (C. 2.0-3.0) thoroughly and spread it onto antibiotic-free RCM plates. Incubate anaerobicly at 37°C for 24 h. Gently wash the bacterial plaques with 1 mL of sterile 1×PBS and collect the eluent suspension. Spread 200 μL of the suspension evenly onto RCM plates containing 25 μg / mL thiamphenicol and 250 μg / mL D-cyclic serine. Place the plates in an anaerobic bag and incubate anaerobicly at 37°C for 36-48 h, until single colonies appear. Pick single colonies and culture them in RCM medium (25 μg / mL thiamphenicol and 250 μg / mL D-cyclic serine). Perform PCR verification using primers Pro-F and Pro-R to obtain the engineered strain.

[0057] Gene knockout: After transforming the obtained engineered strain into *Clostridium butyricum*, 30-50 μL of activated bacterial solution was spread onto an induction RCM plate (containing 25 μg / mL thiamphenicol, 250 μg / mL D-cyclic serine, and 40 mM α-lactose monohydrate) and anaerobically cultured at 37°C for 36-48 h. Single colonies were picked with a sterile toothpick and placed into a 2 mL sterile centrifuge tube containing 0.5 mL of RCM resistance medium (25 μg / mL thiamphenicol and 250 μg / mL D-cyclic serine) and anaerobically cultured at 37°C for 12 h. Knockout was verified by PCR or sequencing.

[0058] Plasmid elimination: After successful plasmid knockout, the bacterial culture was transferred to antibiotic-free RCM medium and passaged once. 30-50 μL of the bacterial culture was then spread onto RCM plates (containing 10 μg / mL 5-fluorouracil). After incubation at 37°C for 36-48 h in an anaerobic bag, single colonies were picked up with a sterile toothpick and transferred to a 2 mL sterile centrifuge tube containing 0.5 mL of RCM medium (10 μg / mL 5-fluorouracil). Once the bacterial culture had grown, a portion of the culture was tested in RCM liquid medium containing thiamphenicol and D-cycloserine resistance to verify its growth. If the culture did not grow in the antibiotic-containing medium but did grow in the 5-fluorouracil-containing medium, plasmid elimination was successful. After confirming plasmid elimination, the plasmid-free bacterial culture was inoculated into RCM (containing 10 μg / mL 5-fluorouracil). Once the culture reached the logarithmic growth phase, the glycerol culture was stored at -80℃ to obtain the engineered strain C1 (RNM / Cas12a / Δ). ​ ::P ​ - ​ C2 (RNM / Cas12a / Δ) ​ ::P ​ - ​ C3 (RNM / Cas12a / Δ) ​ ::P ​ - adhE1 Δ ldh1 ::P thl - ctfAB -P cat1 - adc C4 (RNM / Cas12a / Δ) cat1 ::P cat1 - adhE1 Δ ldh1 ::P thl - ctfAB -P cat1 - adc ) The recombinant plasmid pMTL82151-P fla - ATF1The recombinant plasmid pMTL82151-P was transferred into C1, C2, C3, and C4 engineered strains via bacterial conjugation to obtain C1A, C2A, C3A, and C4A engineered strains. fla - ATF1 - Em C3AE (erythromycin resistance) was obtained by transferring the bacteria into the C3 engineered strain via bacterial conjugation. Example 2: Control strains RNM / Cas12a-p82151, C1-p82151 and C1A were fermented using glucose as a carbon source.

[0059] (1) Culture medium: Preparation of CGM (Clostridium Growth Medium): 4 g / L peptone, 2 g / L yeast extract, 1 g / L K2HPO4·3H2O, 0.5 g / L KH2PO4, 2 g / L (NH4)2SO4, 0~40 g / L CaCO3 and 30~120 g / L carbon source; trace elements 1:1000 (v / v); trace element stock solution: 15 g / L FeSO4·7H2O, 15 g / L ZnSO4·7H2O, 10 g / L MnSO4·H2O, 100 g / L MgSO4·7H2O, 20 g / L CoCl2·6H2O, 15 g / L CaCl2·2H2O. Dispense 50 mL of culture medium into a 125 mL serum bottle, purge with 0.05 MPa of high-purity nitrogen, and autoclave at 115 °C for 20 min (carbon source and culture medium are sterilized separately).

[0060] Seed culture medium: CGM medium, 20 g / L glucose; Fermentation medium: CGM medium, 60 g / L glucose, 40 g / L CaCO3.

[0061] (2) Shake-flask fermentation experiment The control strains of Clostridium butyricum, RNM / Cas12a-p82151, C1-p82151, and C1A, were removed from the -80℃ freezer and inoculated into CGM seed medium. They were activated by incubation at 37℃ overnight. The activated seed liquid was then inoculated into CGM seed medium for activation again. Then, the seed liquid was inoculated into the fermentation medium at a rate of 5% (v / v) and incubated at 37℃ and 150 rpm. After 24 h, hexadecane was added at a ratio of medium to extractant of 2:1. After 96 h, samples were taken for HPLC and GC analysis to detect the product formation.

[0062] The results are as follows Figure 2As shown in Figure A, compared with the control strain RNM / Cas12a-p82151, the engineered strain C1-p82151 exhibited butanol synthesis ability, indicating that the butanol pathway was successfully constructed. Simultaneously, both strains overexpressed pMTL82151, and no ester compounds were detected in the gas phase products. However, 0.27 g / L of butyl acetate was detected in the hexadecane phase of the engineered strain C1A. Figure 2 (B) indicates that the acyltransferase ATF1 was successfully expressed in Clostridium butyricum and possesses acyltransferase function, capable of condensing acyl-CoA and butanol to generate fatty acid esters, thus constructing a de novo synthesis pathway for butyl acetate.

[0063] Example 3: Promoter Optimization and Overexpression ctfAB - adc Increase precursor supply The engineered strains C1A, C2A, C3A, and C4A were taken out from -80℃, inoculated into CGM seed medium, and fermented in shake flasks (the fermentation process is the same as in Case 2).

[0064] The results are as follows Figure 3 As shown, compared with the control group C1A, the C2A strain with only the promoter replaced showed a decrease in the production of both acetic acid and butanol. However, gas chromatography results showed that C2A produced 0.06 g / L of butyl acetate and 0.06 g / L of butyl butyrate. The engineered strains C3A and C4A, after further enhancing the acetic acid reuptake pathway, also showed a decreasing trend in the production of acetic acid and butanol, indicating that overexpression... ctfAB - adc The gene promotes the conversion of acetic acid to acetyl-CoA, thereby reducing the accumulation of acetic acid, while overexpression... adc A small amount of acetone was detected after gene sequencing. The butyl acetate production of C3A reached 1.84 g / L, which was 6 times that of the control strain C1A (0.29 g / L), while the butyl acetate production of C4A was only 0.30 g / L, indicating that the substitution... adhE1 The promoter has little effect on the synthesis of butyl acetate. These results confirm that overexpression... ctfAB - adc The gene effectively increased the yield of butyl acetate, and further verified the effectiveness of optimizing precursor supply and metabolic flux allocation through metabolic engineering strategies for improving the yield of the target product.

[0065] Example 4: Replace the antibiotic resistance gene to eliminate the metabolic interference of the chloramphenicol resistance gene (which belongs to the acyltransferase family, the same as ATF1) on the ester synthesis pathway. The engineered strains C3A and C3AE were taken out from -80℃ and inoculated into CGM seed medium for shake-flask fermentation (the fermentation process is the same as in Case 2).

[0066] The results are as follows Figure 4As shown, after replacing the antibiotic resistance marker, the butyl acetate yield of strain C3A was 1.83 g / L, and that of strain C3AE was 4.94 g / L, representing a 1.7-fold increase compared to C3A. Furthermore, ATF1 showed a selectivity of 99.45% for butyl acetate. These results indicate that replacing the plasmid resistance marker with erythromycin can effectively eliminate... catp Background interference with gene homologous enzyme activity significantly increased the yield of butyl acetate catalyzed by ATF1 in engineered strain C3AE.

[0067] Example 5: Optimizing fermentation conditions to increase butyl acetate yield (1) Optimization of organic nitrogen source: The engineered strain C3AE was taken out from -80℃ and inoculated into CGM seed medium. It was activated by culturing at 37℃ overnight. The activated seed liquid was then inoculated into CGM seed medium for activation again. Then, the seed liquid was inoculated into fermentation CGM medium with different concentrations of organic nitrogen source at an inoculation rate of 5% (v / v). It was cultured at 37℃ and 150 rpm for 24 h. After 24 h, the extractant (n-hexadecane) was added at a ratio of medium to extractant of 2:1. During the fermentation process, samples were taken every 12 h or 24 h for HPLC and GC to detect the substrate and product concentrations. The effect of organic nitrogen source concentration on product synthesis was investigated using CGM medium (containing 4 g / L tryptone and 2 g / L yeast extract) as the control group (4T+2Y). Results are as follows: Figure 5 As shown, under conditions containing only yeast extract (0T+2Y), the yield of butyl acetate was 18.91 g / L, which was 3.8 times that of the control group (4T+2Y) (18.91 g / L vs 4.96 g / L). Considering all experimental conditions, the 0T+2Y combination was the optimal organic nitrogen source concentration. Unless otherwise specified, all subsequent fermentation media were the optimized CGM (organic nitrogen source concentration: 0T+2Y).

[0068] (2) Temperature optimization: The engineered strain C3AE was removed from -80℃ and inoculated into CGM seed medium. It was activated by culturing at 37℃ overnight. The activated seed solution was then inoculated into CGM seed medium for activation again. Then, the seed solution was inoculated into the fermentation medium at an inoculation rate of 5% (v / v) and cultured at 37℃, 30℃, and 25℃ at 150 rpm. After 24 h, hexadecane was added at a ratio of 2:1 between the medium and the extractant. During the fermentation process, samples were taken every 12 h or 24 h for HPLC and GC to detect the concentration of substrate and product.

[0069] The results are as follows Figure 7 As shown, at 37°C, the final yield of butyl acetate was 17.41 g / L (selectivity 99.43%). Figure 7A and 7B); when the fermentation temperature was reduced to 30℃, the yield of butyl acetate significantly increased to 24.05 g / L (selectivity 99.13%), approximately 1.4 times the yield at 37℃. Figure 7 C and 7D); further reducing the fermentation temperature to 25℃, the yield of butyl acetate reached 27.97 g / L (selectivity 99.18%), which was 1.6 times and 1.2 times the yield at 37℃ and 30℃, respectively. Figure 7 At 37°C, 30°C, and 25°C, the residual amounts of butanol (E and 7F) were 4.93 g / L, 2.18 g / L, and 1.45 g / L, respectively, and the residual amounts of acetic acid (E and 7F) were 6.65 g / L, 5.57 g / L, and 5.06 g / L, respectively. The increase in butyl acetate yield was accompanied by a simultaneous decrease in the residual amounts of precursors (butanol and acetic acid generated from acetyl-CoA). This suggests that low-temperature conditions may promote the flow of more butanol and acetyl-CoA to the esterification reaction catalyzed by acyltransferase (ATF1), thereby driving the increase in butyl acetate synthesis flux.

[0070] Example 6: Two-stage temperature-controlled fermentation to increase the yield of butyl acetate.

[0071] Shake-flask fermentation: The engineered strain C3AE was removed from -80℃ and inoculated into CGM seed medium. It was activated by overnight incubation at 37℃. The activated seed culture was then re-inoculated into CGM seed medium for activation. Finally, the seed culture was inoculated into the fermentation medium at a 5% (v / v) inoculation rate and incubated at 37℃ and 150 rpm for 24 h. After 24 h, hexadecane was added at a medium-to-extractant ratio of 2:1, and the fermentation temperature was adjusted to 25℃. Samples were taken every 12 h or 24 h during fermentation for HPLC and GC analysis to determine substrate and product concentrations.

[0072] Fermentation in a fermenter: The 5L fermenter was first sterilized by emptying, then the culture medium was added for actual sterilization. N2 was introduced for at least half an hour to achieve anaerobic conditions. Inoculation was performed at a rate of 5%, and after approximately 24 hours, hexadecane (hexadecane volume: culture medium volume = 1:2) was added for in-situ extraction. Growth was carried out at 37℃. Once the bacterial culture reached the logarithmic growth phase, the condenser was turned on, and the fermentation temperature was reduced to 25℃. When the glucose concentration reached approximately 10 g / L, 600 g / L of glucose stock solution was added. Samples were taken every 12 or 24 hours to analyze the concentrations of substrate and product.

[0073] The results are as follows Figure 6As shown in A and 6B, two-stage temperature fermentation was carried out in a shake flask. At the end of fermentation, the remaining butanol was 1.15 g / L, acetic acid was 4.58 g / L, butyric acid was 0.86 g / L, and ethanol was 1.38 g / L. The final yield of butyl acetate was 28.68 g / L, with a selectivity of 99%. The results indicate that two-stage temperature fermentation can increase the yield of butyl acetate.

[0074] To further evaluate the potential of strain C3AE in producing butyl acetate, fermentation was conducted in a 5L fermenter using a two-stage temperature-feedback method. The results are as follows: Figure 6 As shown in C and 6D, the yield of butyl acetate reached its peak at 96 h, with a yield of 43.27 g / L and a selectivity of 98%. The concentrations of acetic acid, butyric acid, butanol, and ethanol in the fermentation broth reached 15.12 g / L, 2.91 g / L, 10.63 g / L, and 2.98 g / L, respectively.

[0075] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall be included within the protection scope of the present invention.

[0076] sequence list SEQ ID NO: 1 ( adhE1 (nucleotide sequence) SEQ ID NO: 2 ( ctfAB (nucleotide sequence) SEQ ID NO: 3 ( adc nucleotide sequence of) atgttaaaggatgaagtaattaaacaaattagcacgccattaacttcgcctgcatttcctagaggaccctataaatttcataatcgtgagtattttaacattgtatatcgtacagatatggatgcacttcgtaaagttgtgccagagcctttagaaattgatgagcccttagtcaggtttgaaattatggcaatgcatgatacgagtggacttggttgttatacagaaagcggacaggctattcccgtaagctttaatggagttaagggagattatcttcatatgatgtatttagataatgagcctgcaattgcagtaggaagggaattaagtgcatatcctaaaaagctcgggtatccaaagctttttgtggattcagatactttagtaggaactttagactatggaaaacttagagttgcgacagctacaatggggtacaaacataaagccttagatgctaatgaagcaaaggatcaaatttgtcgccctaattatatgttgaaaataatacccaattatgatggaagccctagaatatgtgagcttataaatgcgaaaatcacagatgttaccgtacatgaagcttggacaggaccaactcgactgcagttatttgatcacgctatggcgccacttaatgatttgccagtaaaagagattgtttctagctctcacattcttgcagatataatattgcctagagctgaagttatatatgattatcttaagtaa SEQ ID NO: 4 ( ATF1 nucleotide sequence of) SEQ ID NO: 5 (Nucleic acid sequence of promoter P cat1 ) gtagactttaaggatggaacctttgaaattaagtagagagcccaaatctttgaaaataatgttctttctttgtatagaaaggacattatttttttatagttgttttgtaaaccatagcattgttaagttattttcagctacagctattattttaataataacattgatgtaattatgttattttaaccaaaagaaaatcatattaattttgaataaatggatatattataatataatattaaaaggaagttcaggttgtatattatacaacatctattttttactcataattgtagtttttttaacaatcataatggaagttaattattaaattttatataatttatgaaagggtggttttt SEQ ID NO: 6 (Nucleic acid sequence of promoter P thl ) atattcagcgaaaatagtatattatataattataaattgatgaatagctagagtggtcagacctcctagctattgttttagaaaactttgtgttttttttaacaaaaatattgataaatttttaattatctagtataatgaagttgttggtaaaaaggtttgtaatcaatttaaatttggatccataaatatttaggaggaatagtc SEQ ID NO: 7 (Nucleic acid sequence of promoter P fla ) tatttaataattattattgaataattttatttttgtgttataatatatatataataatacgaaagaaaaaaaccaaagcagctataaatttacgtatgttacaaaatgtaatcaattgttaataaattatattttaattgaggttaactttggtgtaattaatgaaaataattatttagtgttgaggaggagttaaa SEQ ID NO: 8 ( Em ) Atgaacgagaaaaatataaaacacagtcaaaactttattacttcaaaacataatatagataaaataatgacaaatataagattaaatgaacatgataatatctttgaaatcggctcaggaaaagggcattttacccttgaattagtacagaggtgtaatttcgtaactgccattgaaatagaccataaattatgcaaaactacagaaaataaacttgttgatcacgataatttccaagttttaaacaaggatatattgcagtttaaatttcctaaaaaccaatcctataaaatatttggtaatataccttataacataagtacggatataatacgcaaaattgtttttgatagtatagctgatgagatttatttaatcgtggaatacgggtttgctaaaagattattaaatacaaaacgctcattggcattatttttaatggcagaagttgatatttctatattaagtatggttccaagagaatattttcatcctaaacctaaagtgaatagctcacttatcagattaaatagaaaaaaatcaagaatatcacacaaagataaacagaagtataattatttcgttatgaaatgggttaacaaagaatacaagaaaatatttacaaaaaatcaatttaacaattccttaaaacatgcaggaattgacgatttaaacaatattagctttgaacaattcttatctcttttcaatagctataaattatttaataagtaa SEQ ID NO: 9 (nucleic acid sequence of pCloneEZ-P5830-repeat( FnCpf1 ) SEQ ID NO: 10 (pCloneEZ-repeat( FnCpf1 (nucleic acid sequence of the )-terminator) SEQ ID NO: 11 (Nucleic acid sequence of FnCas12a)

Claims

1. A method of constructing a recombinant Clostridium tyrobutyricum for producing butyl acetate, characterized by, In Clostridium tyrobutyricum (C. tyrobutyricum) Clostridium tyrobutyricum , the following exogenous genes are introduced and overexpressed: an aldehyde-alcohol dehydrogenase gene adhE1 , a coenzyme A transferase gene ctfAB , an acetoacetic acid decarboxylase gene adc , and an alcohol acyltransferase gene ATF1 , to obtain a recombinant C. tyrobutyricum.

2. The construction method of claim 1, wherein, the aldehyde-alcohol dehydrogenase gene adhE1 , the coenzyme A transferase gene ctfAB , the acetoacetate decarboxylase gene adc derived from Clostridium acetobutylicum (ATCC 10145) Clostridium acetobutylicum the alcohol acyltransferase gene ATF1 derived from Saccharomyces cerevisiae (ATCC 9080) Saccharomyces cerevisiae ​ 3. The construction method of claim 2, wherein, The nucleotide sequence of the aldehyde-alcohol dehydrogenase gene adhE1 is shown as SEQ ID NO: 1; the nucleotide sequence of the coenzyme A transferase gene ctfAB is shown as SEQ ID NO: 2; the nucleotide sequence of the acetoacetate decarboxylase gene adc is shown as SEQ ID NO: 3; the nucleotide sequence of the alcohol acyltransferase gene ATF1 is shown as SEQ ID NO: 4; and the Clostridium tyrobutyricum is C. tyrobutyricum ATCC 25755.

4. The construction method according to claim 3, characterized in that, The exogenous gene is introduced into Clostridium tyrobutyricum by at least one recombinant plasmid; the backbone of the recombinant plasmid is selected from pMTL83153 and / or pMTL82151; the exogenous gene further comprises an erythromycin resistance gene Em .

5. The construction method according to claim 1 or 2 or 3 or 4, characterized in that, comprising the following steps: (1) PCR amplification of the target gene, including the exogenous gene and the promoter; (2) the target gene is ligated with the reverse PCR vector or the double enzyme digestion vector; (3) the ligation product is transformed into E. coli CA434, and positive clones are screened on chloramphenicol or erythromycin resistant LB plates to obtain a recombinant plasmid; (4) the above recombinant plasmid is transferred into C. tyrobutyricum by bacterial conjugation to obtain a recombinant C. tyrobutyricum.

6. The construction method of claim 5, wherein, The promoter comprises: a Clostridium tyrobutyricum cat1 gene promoter P cat1 The nucleic acid sequence of which is shown as SEQ ID NO: 5, a Clostridium tyrobutyricum thl gene promoter P thl The nucleic acid sequence of which is shown as SEQ ID NO: 6, a Clostridium acetobutylicum flavoprotein gene promoter P fla The nucleic acid sequence of which is shown as SEQ ID NO: 7; the erythromycin resistance gene Em The nucleic acid sequence of which is shown as SEQ ID NO:

8.

7. The construction method of claim 6, wherein, Step (3) Recombinant plasmid pMTL83153-Δ cat1 ::P thl - adhE1 , pMTL83153-Δ ldh1 ::P thl - ctfAB -P cat1 - adc , pMTL82151-P fla - ATF1 - Em ; Step (4) first recombined plasmid pMTL83153-Δ cat1 ::P thl - adhE1 , pMTL83153-Δ ldh1 ::P thl - ctfAB -P cat1 - adc Through the way of bacterial conjugation into Clostridium tyrobutyricum to carry out genome editing, obtain Clostridium tyrobutyricum engineering strain; then recombined plasmid pMTL82151-P fla - ATF1 - Em Through the way of bacterial conjugation into the above Clostridium tyrobutyricum engineering strain, obtain recombinant Clostridium tyrobutyricum.

8. A recombinant C. tyrobutyricum constructed by the method of any one of claims 1-7.

9. Use of the recombinant C. tyrobutyricum of claim 8 in the fermentation production of butyl acetate.

10. Use according to claim 9, characterized in that, The fermentation is carried out under anaerobic conditions, and the fermentation conditions are 20-37°C, 150±100 rpm, and inoculation amount 1-10%; preferably, the components of the fermentation medium are 0-4 g / L peptone, 0-2 g / L yeast extract, 1 g / L K2HPO4·3H2O, 0.5 g / L KH2PO4, 2 g / L (NH4)2SO4, 0-40 g / L CaCO3, and 30-120 g / L carbon source; trace elements 1:1000 (v / v); trace element mother liquor: 15 g / L FeSO4·7H2O, 15 g / L ZnSO4·7H2O, 10 g / L MnSO4·H2O, 100 g / L MgSO4·7H2O, 20 g / L CoCl2·6H2O, 15 g / L CaCl2·2H2O; preferably, fed-batch fermentation is used to maintain the carbon source concentration during the fermentation process; and / or, an organic solvent is added to the fermentation system during the fermentation process or in the later stage of the fermentation to extract in situ the produced butyl acetate; preferably, the organic solvent is n-hexadecane; preferably, the carbon source is glucose. The fermentation is carried out under anaerobic conditions, and the fermentation conditions are 20-37°C, 150±100 rpm, and inoculation amount 1-10%; preferably, the components of the fermentation medium are 0-4 g / L peptone, 0-2 g / L yeast extract, 1 g / L K2HPO4·3H2O, 0.5 g / L KH2PO4, 2 g / L (NH4)2SO4, 0-40 g / L CaCO3, and 30-120 g / L carbon source; trace elements 1:1000 (v / v); trace element mother liquor: 15 g / L FeSO4·7H2O, 15 g / L ZnSO4·7H2O, 10 g / L MnSO4·H2O, 100 g / L MgSO4·7H2O, 20 g / L CoCl2·6H2O, 15 g / L CaCl2·2H2O; preferably, fed-batch fermentation is used to maintain the carbon source concentration during the fermentation process; and / or, an organic solvent is added to the fermentation system during the fermentation process or in the later stage of the fermentation to extract in situ the produced butyl acetate; preferably, the organic solvent is n-hexadecane; preferably, the carbon source is glucose.