SNP (Single Nucleotide Polymorphism) molecular marker remarkably related to crassostrea gigas shell shape and application of SNP molecular marker

Abstract

The invention relates to the technical field of aquaculture molecular breeding, in particular to an SNP (Single Nucleotide Polymorphism) molecular marker remarkably related to a crassostrea gigas shell shape and application thereof. The SNP (Single Nucleotide Polymorphism) molecular marker obtained by screening disclosed by the invention is as follows: (1) Cg05009-24308790Cgt; t is located at the 24308790th site of the reference genome; (2), Cg05270 to 28618069Agt, Cg05270 to T is located at the 28618069th site of the reference genome; (3) Cg < 18426-31151905 > A < gt >; t is located at the 31151905th site of the reference genome. The SNP molecular markers obtained by screening provide a powerful molecular tool for developing a new oyster variety with a nearly circular shell, so that a targeted breeding plan is supported.

Description

Technical Field

[0001] This invention relates to the field of molecular breeding technology in aquaculture, and in particular to a SNP molecular marker that is significantly associated with the shell shape of the long oyster and its application. Background Technology

[0002] The giant oyster (Crassostrea gigas) is an important economic shellfish, playing a vital role in aquaculture. With rising living standards and evolving consumer preferences, the morphological characteristics of the giant oyster have become a significant factor influencing purchasing decisions. The shell is the most visually striking feature of an oyster and often determines its value. The formation mechanism and biomineralization process of oyster shells, their repair and regeneration capabilities, the potential mechanisms of shell color accumulation, and their role as environmental indicators have become extensive research topics. However, research on oyster shell morphology remains relatively limited. In the consumer market, consumers prefer large, nearly round oysters. These typically indicate more space within the shell, resulting in plumper oyster meat.

[0003] To meet the growing market demand for high-quality, nearly round Pacific oysters, selective breeding is essential. However, traditional breeding methods are often labor-intensive, resource-intensive, and time-consuming. Molecular marker-assisted breeding effectively solves these problems and significantly accelerates the breeding process. By utilizing molecular markers, breeders can identify and select desired traits at the DNA level, thereby reducing the time and resources required by traditional breeding methods.

[0004] The development of genetic markers and techniques for studying traits in aquatic animals has gone through several stages. Initially, restriction fragment length polymorphism (RFLP), simple sequence repeat (SSR), amplified fragment length polymorphism (AFLP), and sequence-associated amplification polymorphism (SRAP) methods were widely used. SSR was used to identify loci associated with cold tolerance in the red-finned pufferfish (Takifugu rubripes). AFLP was used to identify candidate genes associated with shell color regulation in the Pacific oyster. With the rapid development of next-generation sequencing technology, gene mining techniques have advanced to the whole-genome level. This advancement has enabled researchers to explore and analyze vast amounts of genetic variation data with unprecedented precision and efficiency. Through genome-wide association studies (GWAS), quantitative trait locus (QTL) mapping, and omics analysis, many genes and single nucleotide polymorphisms (SNPs) associated with shell traits have been identified. GWAS showed that growth-related traits in the European oyster (Ostrea edulis) are regulated by multiple genes, with two distinct QTL regions on chromosome 4. Transcriptome analysis of the American oyster (Crassostrea virginica) identified 17 significantly upregulated genes associated with biomarkers.

[0005] Whole-genome resequencing (WGRS) has become a powerful tool for identifying genetic variation at the whole-genome level and has been widely applied in aquaculture research. WGRS has been used to screen candidate genes associated with crayfish growth and to identify genes regulating thermoadaptation in red-banded trout (Oncorhynchus mykiss gairdneri). Furthermore, resequencing of adult and juvenile oysters has revealed genes associated with resistance to oyster herpesvirus 1 (OsHV1). The complexity of oyster farming environments, extreme summer temperatures, and human disturbance affect shell formation processes and pose significant challenges to investigating the mechanisms of oyster shell formation and growth. Currently identified genes and loci associated with oyster shell morphology are still insufficient to fully elucidate the underlying genetic mechanisms. Summary of the Invention

[0006] The purpose of this invention is to provide an SNP molecular marker that is significantly associated with the shell shape of the long oyster and its application.

[0007] To achieve the above-mentioned objectives, the present invention provides the following technical solution:

[0008] This invention provides a SNP molecular marker that is significantly associated with the shell shape of the oyster, including any one of the following:

[0009] (1)Cg05009-24308790C>T, located at position 24308790 of the reference genome;

[0010] (2)Cg05270-28618069A>T, located at position 28618069 of the reference genome;

[0011] (3)Cg18426-31151905A>T, located at position 31151905 of the reference genome;

[0012] The reference genome is located in GenBank with the sequence number GCA_963853765.1.

[0013] Preferably, when the SNP molecular marker is located at position 24308790 of the reference genome, the genotype of the Pacific oyster is CC, CT, or TT;

[0014] The frequency of the CC genotype in the nearly round-shelled oyster is higher than that in the conical-shelled oyster.

[0015] Preferably, when the SNP molecular marker is located at position 28,618,069 of the reference genome, the genotype of the Pacific oyster is AA, AT, or TT;

[0016] The frequency of the AA genotype in the nearly round-shelled long oyster is higher than that in the conical-shelled long oyster.

[0017] Preferably, when the SNP molecular marker is located at position 31151905 of the reference genome, the genotype of the Pacific oyster is AA, AT, or TT;

[0018] The frequency of the AT genotype in the nearly round-shelled oyster is higher than that in the conical-shelled oyster.

[0019] This invention also provides the application of the aforementioned SNP molecular marker in the preparation of reagents for identifying the shell shape of long oysters.

[0020] The present invention also provides primer pairs for identifying the SNP molecular marker genotypes, as shown in SEQ ID NO.31-33, SEQ ID NO.40-42 or SEQ ID NO.52-54;

[0021] The primer pairs described in SEQ ID NO.40-42 are used to amplify the gene fragment of the SNP molecular marker located at position 24308790 of the reference genome;

[0022] The primer pairs described in SEQ ID NO. 52-54 are used to amplify the gene fragment of the SNP molecular marker located at position 28618069 of the reference genome;

[0023] The primer pairs described in SEQ ID NO. 31-33 are used to amplify the gene fragment of the SNP molecular marker located at position 31151905 of the reference genome.

[0024] The present invention also provides the application of the primer pair in identifying the shell shape of the long oyster.

[0025] This invention also provides a method for screening SNP molecular markers that are significantly associated with the shell shape of the oyster, comprising the following steps:

[0026] 1) Measure the shell length and shell height of the oyster samples, and calculate the K value according to the formula K = shell length / shell height. Select samples with K value > 0.55 as a nearly circular population and samples with K value < 0.50 as a conical population.

[0027] 2) Extract DNA from the adductor muscle tissue of nearly circular and conical oyster colonies to obtain genomic DNA; after fragmenting the genomic DNA, construct a gene library;

[0028] 3) Illumina sequences the gene library, filters the sequencing data, and obtains clean reads;

[0029] 4) Align the clean reads with the reference genome, sort and remove duplicates from the alignment results to obtain the population SNPs;

[0030] 5) Screen the population SNPs to obtain high-quality SNPs, annotate the high-quality SNPs, and use Fst and π joint analysis to screen gene regions with extremely significant differences and significant changes in allele frequency between the near-circular and conical populations to obtain candidate genes.

[0031] 6) GO and KEGG enrichment analyses were performed on candidate genes;

[0032] 7) Sanger sequencing was used to verify non-synonymous SNPs with high Fst values; based on the sequencing results and GO and KEGG enrichment analysis results, SNPs related to shell shape and growth of oysters were screened out, and genotyping and Fisher two-tailed tests were performed in other nearly circular and conical populations to obtain SNP molecular markers that are significantly related to shell shape of oysters.

[0033] Preferably, the comparison method in step 4) is to use BWA 0.7.8 software for comparison;

[0034] The reference genome mentioned in step 4) is located in GenBank with the sequence number GCA_963853765.1;

[0035] Step 4) The sorting is performed using SAMTOOLS-0.1.19;

[0036] Step 5) Annotations are made using ANNOVAR software.

[0037] The present invention has the following advantages over the prior art:

[0038] This invention resequencing the genomes of *Crassostrea gigas* from populations with larger K values ​​(nearly circular) and smaller K values ​​(conical) yielded a dataset of SNPs, thereby identifying K-value-related candidate genes and SNPs. To reduce false positives and improve the accuracy of SNP screening, Sanger sequencing was used for secondary screening, followed by genotyping. This invention is simple to operate, low in cost, and highly efficient. The obtained SNP molecular markers are Cg05009-24308790C>T, Cg05270-28618069A>T, and Cg18426-31151905A>T. When the SNP molecular marker is located at position 24308790 of the reference genome, the genotype of *Crassostrea gigas* is CC, CT, or TT; the frequency of the CC genotype is higher in *Crassostrea gigas* with a nearly circular shell than in those with a conical shell. When the SNP molecular marker is located at position 28,618,069 of the reference genome, the genotype of the Pacific oyster is AA, AT, or TT; the frequency of the AA genotype in the nearly round-shelled Pacific oyster is higher than that in the conical-shelled Pacific oyster. When the SNP molecular marker is located at position 31,151,905 of the reference genome, the genotype of the Pacific oyster is AA, AT, or TT; the frequency of the AT genotype in the nearly round-shelled Pacific oyster is higher than that in the conical-shelled Pacific oyster. This provides a powerful molecular tool for developing new oyster varieties with nearly round shells, thereby supporting targeted breeding programs. Attached Figure Description

[0039] Figure 1 Description of growth and shell morphology of nearly circular and conical oysters (* indicates p<0.05, ** indicates p<0.01, *** indicates p<0.001);

[0040] Figure 2 Fst Manhattan scatter plot for CG and RG groups;

[0041] Figure 3 A π Manhattan scatter plot for the CG group;

[0042] Figure 4 A π Manhattan scatter plot for group RG;

[0043] Figure 5 The ratio of Fst to π (the blue and green areas are the top 5% areas, with blue dots identified as group CG and green dots as group RG);

[0044] Figure 6 The results of GO and KEGG analysis are shown in the figures (figures a and b show the top 30 most abundant pathways in GO analysis, a is the CG group, b is the RG group; c shows the 20 most abundant KEGG pathways in the CG group; d shows the 4 most abundant KEGG pathways in the RG group).

[0045] Figure 7This is a Sanger sequencing peak diagram of some SNPs. Detailed Implementation

[0046] In this invention, the fixed index (Fst) is an indicator for quantifying population differentiation and genetic distance; it is suitable for comparing genetic diversity among subpopulations.

[0047] Nucleotide diversity (π) is a key indicator for measuring genetic variation within a genome or at a specific locus. In molecular biology and genetics, π is frequently used to quantify the degree of variation in DNA sequences.

[0048] Both Fst and π analyses use extreme phenotypes as samples to better focus on differences between the two study populations. The integration of these two methods enables the precise identification of SNP loci with significant intrapopulation variation.

[0049] In this invention, K = shell length (SL) / shell height (SH). A higher K value indicates a more rounded shell shape and a fuller oyster, while a lower K value corresponds to a more conical shell shape and a reduced fullness.

[0050] The technical solutions provided by the present invention will be described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0051] Example 1

[0052] 1. Materials and Methods

[0053] 1.1 Oyster Sample Collection

[0054] Nearly circular and conical colonies of the Pacific oyster were obtained from the Kongtong Island aquaculture base in Yantai City, Shandong Province, China in 2023. They were cultured in spacious cages to provide ample growth space for each individual and a uniform aquatic environment. The cages were cleaned and replaced regularly to maintain optimal rearing conditions. One hundred oysters were randomly selected from each colony for phenotypic analysis.

[0055] 1.2 Phenotypic Data Measurement and Statistics

[0056] Growth and shell shape-related traits were measured, including total weight (TW), meat weight (MW), shell height (SH), shell width (SW), meat yield (MY), and shell length (SL). The K-value for each individual was calculated, defined as the ratio of shell length to shell height (SL / SH). Phenotypic data were analyzed using SPSS Statistics 27, and Pearson correlation coefficients were calculated for each trait group to assess the relationships between variables.

[0057] 1.3 DNA Extraction and Whole Genome Resequencing (WGRS)

[0058] Fifteen individuals with K values ​​ranging from 0.63 to 0.76 and fifteen individuals with K values ​​ranging from 0.40 to 0.47 were selected from the tested individuals. The group with larger K values ​​was designated as the near-circular group (RG), and the group with smaller K values ​​was designated as the conical group (CG). A portion of adductor muscle tissue was taken from each individual, fixed in anhydrous ethanol, and stored at -20°C. Genomic DNA was extracted from 50 mg of tissue from each sample using the phenol-chloroform extraction method. The quality of the extracted DNA was assessed using NanoDrop 2000, and DNA integrity was verified by 1.0% agarose gel electrophoresis. The DNA samples were then randomly fragmented using a Covaris ultrasonic homogenizer. Gene libraries were constructed using the fragmented DNA, including end repair, A-tailing, ligation of sequencing adapters, purification, and PCR amplification. The prepared gene libraries were sequenced using the Illumina platform.

[0059] 1.4 Data Processing and SNP Calling

[0060] After rigorous screening of the sequencing data (removing low-quality bases, adapter sequences, and contaminating fragments), high-quality clean reads were obtained. The clean reads were compared with the NCBI accession number GCA_963853765.1 of the *Crassostrea gigas* reference genome using BWA 0.7.8 software (parameter: rmdup). The comparison results were sorted (parameter: sort) and deduplicated (parameter: rmdup) using SAMTOOLS-0.1.19 to obtain population SNPs. SNPs were detected using SAMTOOLS (parameter: samtools mpileup-q 1-C 50-t SP-t DP-m 2-F 0.002), and high-quality SNPs were obtained through rigorous screening (removing low-quality SNPs). The high-quality SNPs were annotated using ANNOVAR software. Using vcftools-0.1 (https: / / vcftools.github.io / man_latest.html), with the analysis window set to 100kb and the sliding step size set to 50k, Fst and π values ​​were calculated based on high-quality SNPs. To uncover representative, extremely differentially expressed genes, the top 5% of Fst and π ratio thresholds were selected as candidate differentially expressed regions (CDRs). To avoid CDR fragmentation, windows with fewer than 10 SNPs were filtered out, and CDRs with windows <1000kb were merged to obtain the final candidate differentially expressed regions (CDRs). Manhattan plots were generated using the "qqman" package in R, where the value of each SNP is plotted as a function of its position along each autosome.

[0061] 1.5 Gene enrichment analysis

[0062] Candidate genes were identified by annotating genes containing SNPs within their CDRs. These candidate genes were further analyzed using Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analyses. GO terms and KEGG pathways were considered significant at p-values ​​< 0.05.

[0063] 1.6 Sanger sequencing

[0064] The remaining genomic DNA from 15 individuals used in WGRS was merged for PCR amplification and Sanger sequencing. Among various SNP mutation types, nonsynonymous mutations serve as crucial molecular markers due to their potential functional impact. This invention focuses on 320 nonsynonymous SNPs with the highest Fst values ​​obtained from the above screening; these SNPs are distributed across 53 candidate genes. Sanger sequencing was performed by Shanghai Sangon Biotech Co., Ltd.

[0065] 1.7 SNP Genotyping Detection in Crassula longicornis Based on Mutant Amplification Repression System (ARMS)

[0066] Based on the Sanger sequencing validation results and GO and KEGG analysis results, SNP sites in genes with accurate Sanger sequencing validation and related to shell shape and growth were selected for genotyping. Thirty individuals with high K values ​​(0.76–1.02) and thirty oyster individuals with low K values ​​(0.31–0.49) were used as templates. The DNA extraction procedure used was the same as described in Section 1.3. For genotyping, the amplification arrest system (ARMS) was used. ARMS-PCR was performed using a SYBR qPCR kit premixed with GenDiffSNP reagent (AG, Hunan, China). Primers were designed with two forward primers (F1 and F2) with different bases at the 3' end and a universal reverse primer (R).

[0067] 2. Results

[0068] 2.1 Phenotypic Analysis

[0069] The correlation between growth and shell shape in the CG and RG groups is shown in Tables 1 and 2. Except for SH, the SL, SW, TW, MW, MY, and K values ​​of the RG group were significantly higher than those of the CG group. p <0.05). The nearly round oyster shell provides more internal space and a higher meat content.

[0070] Table 1. Descriptive statistics of growth and shell shape related traits in the CG group.

[0071] SH-CG / mm SL-CG / mm SW-CG / mm TW-CG / g MW-CG / g MY-CG K-CG Num 100 100 100 100 100 100 100 Mean 138.90 66.17 38.98 207.74 27.02 13.25％ 0.48 SD 12.81 8.67 5.48 51.96 6.05 2.21％ 0.05 SE 2.34 1.58 1.00 949 1.10 0.40％ 0.01

[0072] Table 2. Descriptive statistics of growth and shell shape related traits in group RG.

[0073] SH-RG / mm SL-RG / mm SW-RG / mm TW-RG / g MW-RG / g MY-RG K-RG Num 100 100 100 100 100 100 100 Mean 133.95 83.99 44.53 261.68 37.66 14.58％ 0.63 SD 11.49 7.99 4.97 54.31 6.68 2.07％ 0.06 SE 2.10 1.46 0.91 9.92 1.22 0.40％ 0.01

[0074] Num represents the number of samples; SD represents the standard deviation; SE represents the standard error.

[0075] 2.2 Whole genome resequencing

[0076] 145.99 Gb of clean data was generated, with a Q30 value (percentage of bases with a quality ≥30) of 91.6%. 89.88% of reads were successfully mapped to the reference genome, achieving an average sequencing depth of 15×. SNP distribution showed that intron regions had the most mutations (39.99%), followed by intergenic regions (30.96%) and exon regions (19.09%). Among differentiated candidate SNPs, transitions (56.46%) were more likely to occur than transversions (43.54%). These metrics confirm the high quality and reliability of the resequencing data.

[0077] 2.3 SNP Identification

[0078] The Fst and π methods were used to identify genomic regions with extreme genetic differences and significant variations in allele frequencies between the two groups. The first 5% of Fst were primarily located on chromosomes 1, 2, 6, and 10. Figure 2 This distribution indicates that these four chromosomes exhibit the most pronounced genetic differentiation between the RG and CG groups. π analysis revealed high nucleotide polymorphisms on chromosomes 2, 4, 5, 6, 7, and 9. Figure 3 , 4 In the joint analysis of Fst and π ( Figure 5 A total of 10,767 SNPs were identified, distributed across 112 genes. In the CG group, the distribution of SNPs on chromosomes was as follows: 112 SNPs on chromosome 1; 6,191 SNPs on chromosome 2; 838 SNPs on chromosome 5; and 3,145 SNPs on chromosome 6. In the RG group, there were 55 SNPs on chromosome 1; 51 SNPs on chromosome 2; and 375 SNPs on chromosome 6.

[0079] 2.4 Analysis of GO and KEGG pathways

[0080] GO and KEGG enrichment analyses were performed on 112 candidate genes. For the CG group, GO analysis revealed significant enrichment of 113 terms, including cellular component biogenesis, DNA-dependent transcription, initiation, response to chemical stimuli, secondary active transmembrane transporter activity, and active transmembrane transporter activity, with cellular component biogenesis being the most highly enriched category. Figure 6a, p<0.05). The RG group was significantly enriched with 30 terms, including transferase activity, transfer of single carbon groups, organic acid metabolism, carboxylic acid metabolism, small molecule metabolism, and nucleotide metabolism. Figure 6 b, p<0.05). KEGG pathway analysis showed that the CG group was significantly enriched in four pathways: ether lipid metabolism, glycosphingolipid biosynthesis-ganglionic series, glycosphingolipid biosynthesis-globo series, and glycosaminoglycan degradation. Figure 6 c, p<0.05). However, the RG group had only one significantly enriched pathway associated with the metabolism of alanine, aspartate, and glutamate (c, p<0.05). Figure 6 d, p<0.05).

[0081] 2.5 Sanger sequencing and SNP genotyping

[0082] Sanger sequencing confirmed that 50 SNPs out of 28 genes were consistent with the results obtained by WGRS. Figure 7 Based on Sanger sequencing and GO and KEGG enrichment analyses, 37 SNP loci from 17 genes were selected for genotyping (Table 3). Fisher's two-tailed test showed that three loci were significantly different between the two groups (Table 4, p<0.05). For the single nucleotide polymorphism (SNP) Cg05009-24308790C>T in Activated T cell nuclear factor 5 (NFAT5), the frequency of CC homozygotes was higher in the RG group than in the CG group; for the single nucleotide polymorphism Cg05270-28618069A>T in angiotensin-converting enzyme (ACE), the frequency of AA homozygotes was higher in the RG group than in the CG group; for the single nucleotide polymorphism Cg18426-31151905A>T in mitogen-activated protein kinase 1 (MAPK1), the frequency of AT heterozygotes was higher in the RG group than in the CG group.

[0083] Table 3 ARMS genotyping primer pairs

[0084]

[0085]

[0086]

[0087]

[0088]

[0089]

[0090]

[0091] Table 4. SNP information showing significant differences

[0092]

[0093] Cg05009-24308790C>T is located at position 24308790 of the reference genome and position 486 of the NFAT5 gene fragment, as shown in SEQ ID NO.149; Cg05270-28618069A>T is located at position 28618069 of the reference genome and position 47 of the ACE gene fragment, as shown in SEQ ID NO.150; Cg18426-31151905A>T is located at position 31151905 of the reference genome and position 721 of the MAPK1 gene fragment, as shown in SEQ ID NO.151.

[0094] SEQ ID NO.149:GTCTTGTGAGACGTCCAGAATATTGTTTTGTGCACTGTATCCATGCACATTGTATGAATTTGAGCTATTGGATGTTAAAGAATTACTGCTGTTCTGTCTACTTAGTTGAGTTAATGGTTGAGTGCTTGTTACCATGGTACCACTTAAGTGACTAGAGATCATCTCAGAAGCAGTCGAAGTCGCACTCCCTACACCTACATTAGCATTTCCATGTAAACTGCCAGATAGTATTTTTTCCATGTCAATGTGATGATGGTTTCCTTGGCCGACAAGGCTTTCTATATTCAGTCCAAAACTTTGTTGATGATTTCCAGTGCTCTCATTTACATGATTGGAAATACCTAGAGTTCCCTGCTGTTGCATCATGGGATTGGTCCCTTGTAACATGGGACTAGATGGCTGTTGGTGGACTGCAGGGCTTCCTTGTTGCAGAATACTGTCGATTGTCTCCTGTTTCGTGACCACTCCTTGCTGGAACATTGAATCTCCTATGGATACTGGGGTATTCATTAAAGTCTCTGCTGGGCTTAAGACCTGCTGATTTAGGTCTCCCAATGACATTGATGGAGAGCCCATGTTGCTCGTATGCTCTATCACCTGTGACTGAATCATGTTTTCCTTGGTATCCATGTTTTGTGGAGAATCTATCTGCATTTTCATGTCTATGTTGA。

[0095] SEQ ID NO.150:TCGATTAGCGGCTGAAAGTACTTCTTGAAGGGTTCGGTCCTGATATAAGTGTCCCCTGTCATCTGTTTCAGGGCCTCTTTCCAGTGTTTACTCCCACCTAGTTTCAACATATTCCTGAAATCACAAAATTAAATTTTTTTTTGTTTTTTAAAGATTAGAAAAGCTAGAAATACAAAATGTCACAGGTTCATAGGTTTAATTTCAGCGGATATAGTAGCAGATACAGAAAATTGTCAAGTTCATTTCGTCGCTATGAAAAAGATTAAAATTACACTTACAACAGTTTTTCCCCCGCTTCTTTTGACCTGTAGAAATCACAAGTATACAAAGGCCCTGTATGGCCACTGGCCTGACACATTGACTCATAAAACTGAAACTGTAGCAGGAAGCTGGCAAAATATCTGAAAATTATATATCATTAATTAAAATCCTTTTATAAGGGAAAAA。

[0096] SEQ ID NO.151:

[0097] .

[0098] Example 2

[0099] 1. Materials and Methods

[0100] 1.1 Sample Collection

[0101] Thirty nearly circular (K value range 0.67–0.93) and thirty conical (K value range 0.35–0.46) long oysters were collected from a different aquaculture area than in Example 1. The DNA extraction method was the same as in 1.3 of Example 1.

[0102] 1.2 Genotyping

[0103] Using the three SNP loci Cg05009-24308790C>T, Cg05270-28618069A>T, and Cg18426-31151905A>T selected in Example 1, the samples were genotyped using the corresponding primer pairs (SEQ ID NO. 40-42, SEQ ID NO. 52-54, SEQ ID NO. 31-33) in Table 3. The genotyping method was the same as in section 1.7 of Example 1.

[0104] 2. Results

[0105] Significant differences were found between the two groups at three loci (Table 5, p < 0.05). At locus Cg05009-24308790C>T, the frequency of CC homozygotes was higher in group RG than in group CG; at locus Cg05270-28618069A>T, the frequency of AA homozygotes was higher in group RG than in group CG; and at locus Cg18426-31151905A>T, the frequency of AT heterozygotes was higher in group RG than in group CG. These results are consistent with those of Example 1.

[0106] Table 5. Genotyping Results

[0107]

[0108] This invention uses WGRS technology to study two extreme populations of oyster shell shape. The results identified three loci significantly associated with shell shape: Cg05009-24308790C>T, Cg05270-28618069A>T, and Cg18426-31151905A>T. These three loci can be used to screen candidate parents during the breeding process, and by using the selected individuals for multiple generations of breeding, a new nearly circular oyster variety can be bred.

[0109] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A SNP molecular marker significantly associated with the shell shape of the long oyster, characterized in that, Includes any one of the following: (1)Cg05009-24308790C>T, located at position 24308790 of the reference genome; (2)Cg05270-28618069A>T, located at position 28618069 of the reference genome; (3)Cg18426-31151905A>T, located at position 31151905 of the reference genome; The reference genome is located in GenBank with the sequence number GCA_963853765.

1.

2. The SNP molecular marker according to claim 1, characterized in that, When the SNP molecular marker is located at position 24308790 of the reference genome, the genotype of the Pacific oyster is CC, CT, or TT; The frequency of the CC genotype in the nearly round-shelled oyster is higher than that in the conical-shelled oyster.

3. The SNP molecular marker according to claim 2, characterized in that, When the SNP molecular marker is located at position 28,618,069 of the reference genome, the genotype of the Pacific oyster is AA, AT, or TT; The frequency of the AA genotype in the nearly round-shelled long oyster is higher than that in the conical-shelled long oyster.

4. The SNP molecular marker according to claim 3, characterized in that, When the SNP molecular marker is located at position 31151905 of the reference genome, the genotype of the Pacific oyster is AA, AT, or TT; The frequency of the AT genotype in the nearly round-shelled oyster is higher than that in the conical-shelled oyster.

5. The application of the SNP molecular marker according to any one of claims 1 to 4 in the preparation of reagents for identifying the shell shape of long oysters.

6. The application of the SNP molecular marker according to any one of claims 1 to 4 in the assisted breeding of Pacific oyster.

7. The primer pair for identifying SNP molecular marker genotyping according to any one of claims 1 to 4, characterized in that, The primer pairs are shown in SEQ ID NO.31-33, SEQ ID NO.40-42 or SEQ ID NO.52-54; The primer pairs described in SEQ ID NO.40-42 are used to amplify the gene fragment of the SNP molecular marker located at position 24308790 of the reference genome; The primer pairs described in SEQ ID NO. 52-54 are used to amplify the gene fragment of the SNP molecular marker located at position 28618069 of the reference genome; The primer pairs described in SEQ ID NO. 31-33 are used to amplify the gene fragment of the SNP molecular marker located at position 31151905 of the reference genome.

8. The application of the primer pair according to claim 7 in the identification of the shell shape of the long oyster.

9. A method for screening SNP molecular markers significantly associated with the shell shape of the Pacific oyster, characterized in that, Includes the following steps: 1) Measure the shell length and shell height of the oyster samples, calculate the K value according to the formula K = shell length / shell height, and screen samples with K value > 0.55 as a nearly circular population and samples with K value < 0.50 as a conical population; 2) Extract DNA from the adductor muscle tissue of nearly circular and conical oyster colonies to obtain genomic DNA; After fragmenting the genomic DNA, a gene library is constructed; 3) Illumina sequences the gene library, filters the sequencing data, and obtains clean reads; 4) Align the clean reads with the reference genome, sort and remove duplicates from the alignment results to obtain the population SNPs; 5) Screen the population SNPs to obtain high-quality SNPs, annotate the high-quality SNPs, and use Fst and π joint analysis to screen gene regions with extremely significant differences and significant changes in allele frequency between the near-circular and conical populations to obtain candidate genes. 6) GO and KEGG enrichment analyses were performed on candidate genes; 7) Sanger sequencing was used to verify non-synonymous SNPs with high Fst values; based on the sequencing results and GO and KEGG enrichment analysis results, SNPs related to shell shape and growth of oysters were screened out, and genotyping and Fisher's two-tailed test were performed in another nearly circular and conical population to obtain SNP markers that were significantly associated with shell shape of oysters.

10. The method according to claim 9, characterized in that, Step 4) The comparison method is to use BWA 0.7.8 software for comparison; The reference genome mentioned in step 4) is located in GenBank with the sequence number GCA_963853765.1; Step 4) The sorting is performed using SAMTOOLS-0.1.19; Step 5) Annotations are made using ANNOVAR software.

Images