Recombinant expression vector, genetically engineered bacterium and application of genetically engineered bacterium in synthesis of 3 '-phosphoadenosine-5'-phosphate sulfate

Abstract

The invention discloses a recombinant expression vector, a genetically engineered bacterium and application of the genetically engineered bacterium in synthesis of 3 '-adenosine-5'-phosphate sulfate, and belongs to the field of bioengineering and enzyme engineering. According to the method, a multi-enzyme system containing adenosine kinase (atADK) and polyphosphate kinase (chPPK2) is constructed, adenosine and polyphosphate (PolyP) which are low in price are used as starting raw materials, efficient regeneration of ATP is achieved, and PAPS is catalytically synthesized by coupling pyrophosphatase (PPA), adenosine 5 '-phosphosulfate kinase (APSK) and ATP sulfating enzyme (KAST). The constructed genetically engineered bacterium can be carried out in an in-vitro one-pot method or a whole-cell system, a good conversion rate is achieved, the conversion rate is larger than 50%, and the yield can reach 5.12 mM PAPS. The biological production cost can be reduced, and meanwhile, the method has industrial application prospects.

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of bioengineering and enzyme engineering, and particularly relates to a recombinant expression vector, a genetically engineered bacterium and application of the recombinant expression vector and the genetically engineered bacterium in synthesis of 3'-phosphoadenosine-5'-phosphosulfate, and especially application of adenosine in synthesis of 3'-phosphoadenosine-5'-phosphosulfate. BACKGROUND

[0002] 3'-phosphoadenosine-5'-phosphosulfate (PAPS) is a key active sulfate donor in the sulfation reaction in vivo, and plays an irreplaceable important role in the fields of drug synthesis, health product development (such as chondroitin sulfate), hormone metabolism and exogenous substance detoxification. However, the chemical instability of PAPS itself makes it difficult to be synthesized by traditional chemical methods, and the cost is high, which seriously restricts its large-scale application.

[0003] At present, the enzyme method or microbial synthesis of PAPS mainly depends on a synthesis path taking adenosine triphosphate (ATP) as the core. The path usually involves ATP sulfurylase (ATPS) catalyzing ATP and sulfate to generate adenosine-5'-phosphosulfate (APS), and then APS kinase (APSK) catalyzing the 3'-hydroxyl of ATP to APS for phosphorylation, and finally generating PAPS. This path is highly dependent on the continuous supply of ATP.

[0004] ATP, as a high-energy phosphate compound, has extremely high industrial production and purification cost, and its market price is much higher than that of its precursor adenosine. Using ATP as a direct substrate for PAPS synthesis results in raw material cost accounting for the main part of the total production cost, which is poor in economy and difficult to realize large-scale industrialization. Researchers have attempted to use adenosine and polyphosphate (PolyP) as key substrates, combine adenosine kinase (ADK) and polyphosphate kinase (PPK) in a one-pot reaction, and realize chain ATP regeneration and production. Adenosine, as a nucleoside, is low in price and widely available, and is a very potential biological manufacturing starting material. By using an engineered microbial cell, efficient and multi-step conversion from adenosine to high-value compounds can be realized. The whole cell system can synthesize and maintain the balance of coenzymes, and has strong scalability and industrialization prospect.

[0005] In summary, the demand for PAPS in the field of sulfation biological manufacturing is continuously increasing, but its existing synthesis technology seriously depends on expensive ATP, resulting in high production cost, which has become a bottleneck restricting the development of related industries. In the face of the contradiction between huge market potential and high production cost, developing a new PAPS synthesis method with low cost and higher efficiency has become an inevitable requirement to promote the development of the field. SUMMARY

[0006] In order to overcome the above-mentioned deficiencies of the prior art, the present application provides a recombinant expression vector, a genetically engineered bacterium and an application of the recombinant expression vector in synthesis of 3'-phosphoadenosine-5'-phosphosulfate (PAPS), and proposes a novel, low-cost and high-efficiency PAPS synthesis method, which realizes efficient regeneration of ATP and directional synthesis of PAPS through ingenious design of a multi-enzyme system, so as to overcome the defects of the prior art.

[0007] In order to solve the above-mentioned problems, the technical scheme adopted by the present application is as follows:

[0008] In a first aspect, the present application provides a recombinant expression vector comprising an adenosine kinase encoding gene and / or a polyphosphate kinase encoding gene.

[0009] As a preferred embodiment of the present application, the nucleotide sequence of the adenosine kinase encoding gene is shown in SEQ ID NO: 1.

[0010] As a preferred embodiment of the present application, the nucleotide sequence of the polyphosphate kinase encoding gene is shown in SEQ ID NO: 2.

[0011] In a second aspect, the present application provides a construction method of the recombinant expression vector, comprising:

[0012] (1) inserting an adenosine kinase encoding gene with a nucleotide sequence shown in SEQ ID NO: 1 into a multiple cloning site of a vector pET-28a(+) through a restriction enzyme site to obtain an atADK-pET-28a(+) plasmid;

[0013] (2) inserting a polyphosphate kinase encoding gene with a nucleotide sequence shown in SEQ ID NO: 2 into a multiple cloning site of a vector pET-28a(+) through a restriction enzyme site to obtain a chPPK2-pET-28a(+) plasmid;

[0014] (3) inserting an adenosine kinase encoding gene with a nucleotide sequence shown in SEQ ID NO: 1 into a multiple cloning site of a chPPK2-pET-28a(+) plasmid through linear cloning to obtain an atADK-chPPK2_pET-28a(+) plasmid;

[0015] (4) transforming the plasmids obtained in steps (1)-(3) into E. coli DH5α competent cells for verification, and the verified correct recombinant plasmid is the recombinant expression vector.

[0016] In a third aspect, the present application provides a genetically engineered bacterium, which is constructed by transforming the recombinant expression vector into a host strain.

[0017] As a preferred embodiment of the present application, the host strain is E. coli BL21 (DE3), and the recombinant expression vector carried by the host strain is any one of atADK-pET-28a(+), chPPK2-pET-28a(+) or atADK-chPPK2_pET-28a(+).

[0018] In a fourth aspect, the present application provides an application of the recombinant expression vector or the genetically engineered bacterium in synthesis of 3'-phosphoadenosine-5'-phosphosulfate.

[0019] In a fifth aspect, the present application provides a method for synthesizing 3'-phosphoadenosine-5'-phosphosulfate, comprising using adenosine and polyphosphate as substrates, and preparing by any one of the following ways:

[0020] performing one-pot enzymatic reaction by using a multi-enzyme system; or

[0021] performing whole-cell catalytic reaction by using the genetically engineered bacterium and a strain expressing pyrophosphatase, adenosine 5'-phosphosulfate kinase and ATP sulfurylase.

[0022] As a preferred embodiment of the present application, the multi-enzyme system comprises adenosine kinase (atADK), polyphosphate kinase (chPPK2), pyrophosphatase (PPA), adenosine 5'-phosphosulfate kinase (APSK) and ATP sulfurylase (KAST).

[0023] As a preferred embodiment of the present application, the adenosine kinase (atADK) is derived from Arabidopsis thaliana, and its amino acid sequence is shown in GenBank: NP_195950.1; the polyphosphate kinase (chPPK2) is derived from Cytophaga hutchinsonii, and its amino acid sequence is shown in GenBank: WP_011583516; the pyrophosphatase (PPA) is derived from Escherichia coli (E. coli for short), and its amino acid sequence is shown in GenBank: WP_088172275.1; the adenosine 5'-phosphosulfate kinase (APSK) is derived from Penicillium chrysogenum, and its amino acid sequence is shown in GenBank: KZN93037.1; and the ATP sulfurylase (KAST) is derived from Kluyveromyces lactis, and its amino acid sequence is shown in GenBank: QEU62688.1.

[0024] As a preferred embodiment of the present application, the multi-enzyme system is prepared by the following steps:

[0025] (a) cultivating the strains expressing ATP sulfurylase, adenosine 5'-phosphosulfate kinase, pyrophosphatase, and the genetically engineered bacteria of claim 4 or 5, respectively;

[0026] (b) subjecting each of the bacterial bodies to ultrasonic disruption to obtain corresponding crude enzyme solutions;

[0027] (c) mixing the crude enzyme solutions in a proportion to form a multi-enzyme system.

[0028] As preferred in the present application, the mass ratio of each of the crude enzyme solutions in step (c) is: crude enzyme solution containing ATP sulfurylase: crude enzyme solution containing adenosine 5'-phosphosulfate kinase: crude enzyme solution containing pyrophosphatase: crude enzyme solution containing adenosine kinase: crude enzyme solution containing polyphosphate kinase = 2:2:1:1:0.5, or crude enzyme solution containing ATP sulfurylase: crude enzyme solution containing adenosine 5'-phosphosulfate kinase: crude enzyme solution containing pyrophosphatase: crude enzyme solution containing both adenosine kinase and polyphosphate kinase = 2:2:1:1.

[0029] As preferred in the present application, the genetically engineered bacteria are strains containing atADK-pET-28a(+) plasmid or strains containing chPPK2-pET-28a(+) plasmid, and the mass ratio of each of the crude enzyme solutions is: crude enzyme solution containing ATP sulfurylase: crude enzyme solution containing adenosine 5'-phosphosulfate kinase: crude enzyme solution containing pyrophosphatase: crude enzyme solution containing adenosine kinase: crude enzyme solution containing polyphosphate kinase = 2:2:1:1:0.5, which is abbreviated as KAST, APSK, PPA, atADK, chPPK2 = 2:2:1:1:0.5.

[0030] As preferred in the present application, the genetically engineered bacteria are strains containing atADK-chPPK2_pET-28a(+) plasmid, and the mass ratio of each of the crude enzyme solutions or each of the bacterial bodies is: crude enzyme solution containing ATP sulfurylase: crude enzyme solution containing adenosine 5'-phosphosulfate kinase: crude enzyme solution containing pyrophosphatase: crude enzyme solution containing both adenosine kinase and polyphosphate kinase = 2:2:1:1, which is abbreviated as KAST, APSK, PPA, (atADK+chPPK2) = 2:2:1:1.

[0031] As preferred in the present application, the multi-enzyme system is used to prepare 3'-phosphoadenosine-5'-phosphosulfate by one-pot enzymatic reaction, which comprises:

[0032] (a) cultivating the strains expressing ATP sulfurylase, adenosine 5'-phosphosulfate kinase, pyrophosphatase, and the genetically engineered bacteria, respectively, and then subjecting each of the bacterial bodies to ultrasonic disruption to obtain corresponding crude enzyme solutions, and mixing the crude enzyme solutions in a proportion to form a multi-enzyme system;

[0033] (b) configuring a reaction system one, stopping the reaction by adding acetonitrile after reacting for 1-5 h at 37°C to obtain a reaction liquid; components of the reaction system one: 5-10 mM adenosine, 1-2 mM ATP, 10-15 mM PolyP, 20 mM NaSO4, 20 mM MgCl2 and a multi-enzyme system;

[0034] (c) centrifuging the reaction liquid, taking the supernatant, filtering through a membrane, and obtaining the concentration of 3'-phosphoadenosine-5'-phosphosulfate by high performance liquid chromatography.

[0035] As a preferred embodiment of the present application, the whole cell catalytic reaction is used to prepare 3'-phosphoadenosine-5'-phosphosulfate, which comprises:

[0036] (a) respectively culturing strains expressing ATP sulfurylase, adenosine 5'-phosphosulfate kinase and pyrophosphatase, and the gene engineering bacteria, and resuspending the bacteria to 100-200 g / L with 50 mM Tris-HCl (pH 7.4) buffer to obtain a bacterial suspension;

[0037] (b) configuring a reaction system two, stopping the reaction by adding acetonitrile after reacting for 1-5 h at 37°C to obtain a reaction liquid; components of the reaction system two: 5-10 mM adenosine, 10-15 mM PolyP, 20 mM NaSO4, 20 mM MgCl2 and a whole cell system; wherein the whole cell system is a mixture of bacterial suspensions with a mass ratio of 2:2:1:1 (KAST, APSK, PPA, atADK+chPPK2);

[0038] (c) centrifuging the reaction liquid, taking the supernatant, filtering through a membrane, and obtaining the concentration of 3'-phosphoadenosine-5'-phosphosulfate by high performance liquid chromatography.

[0039] As a preferred embodiment of the present application, the chromatographic conditions of high performance liquid chromatography (HPLC) are as follows: chromatograph Agilent high performance liquid chromatograph 1260; chromatographic column HILIC Silica 250*4.6 mm; column temperature 30°C; flow rate 1 mL / min; detection wavelength 260 nm; mobile phase: A phase 10 mM ammonium formate, B phase 10 mM ammonium formate acetonitrile, gradient elution, elution program: 0-10 min, 60% B phase; 10-10.1 min, 90% B phase; 10.1-20 min 90% B phase.

[0040] Compared with the prior art, the present application has the following beneficial effects:

[0041] (1) The present application constructs a double-enzyme co-expression strain co-expressing adenosine kinase and polyphosphate kinase, realizes that adenosine kinase and polyphosphate kinase with basically consistent expression amounts can be obtained at the same time through once strain fermentation, effectively reduces the use amount of enzymes, and reduces the process flow and production cost in industrial large-scale production.

[0042] (2) The present application uses low-cost adenosine and polyphosphate to replace expensive ATP as a starting material, greatly reduces the production cost of PAPS from the source;

[0043] (3) The present application constructs a regeneration path from adenosine to ATP by coupling adenosine kinase and polyphosphate kinase, and the energy utilization efficiency is effectively improved;

[0044] (4) The pyrophosphatase (PPA) introduced in the present application hydrolyzes the by-product pyrophosphate (PPi), completely solves the inhibition of pyrophosphate accumulation on APSK and other enzymes, and drives the ATP sulfation step to proceed irreversibly, greatly improving the reaction yield.

[0045] (5) The present application adopts in-vitro one-pot method (adopts multi-enzyme system to carry out one-pot enzyme reaction) and whole cell one-pot method to synthesize PAPS, and the novel synthesis method has low cost and high efficiency, and through ingenious multi-enzyme system and whole cell system design, high-efficiency regeneration of ATP and directional synthesis of PAPS are realized, so as to overcome the defects of the prior art. BRIEF DESCRIPTION OF DRAWINGS

[0046] Figure 1 : Biosynthesis system of adenosine to 3'-phosphoadenosine-5'-phosphosulfate.

[0047] Figure 2 : SDS-PAGE verification diagram of atADK and chPPK2 proteins in example 1 of the present application.

[0048] Figure 3 : Double-expression plasmid map of atADK and chPPK2 proteins in example 2 of the present application.

[0049] Figure 4 : Amplification nucleic acid electrophoresis diagram of atADK fragment and chPPK2 vector in example 2 of the present application.

[0050] Figure 5 : SDS-PAGE verification diagram of atADK and chPPK2 double-expression proteins in example 3 of the present application.

[0051] Figure 6 : Liquid chromatogram analysis diagram before and after reaction of in-vitro one-pot synthesis method of PAPS in example 4 of the present application.

[0052] Figure 7 Figure 2 shows the liquid chromatography analysis of the reaction before and after the in vitro one-pot synthesis of PAPS according to Example 5 of the present application.

[0053] Figure 8 Figure 3 shows the liquid chromatography analysis of the reaction before and after the whole-cell one-pot synthesis of PAPS according to Example 6 of the present application. DETAILED DESCRIPTION

[0054] The present application can also be carried out in different embodiments and applied to various applications. All such modifications or variations that come within the scope of the application are intended to be within the scope of the claims.

[0055] It should be noted that the process equipment or devices not specifically mentioned in the following examples are conventional equipment or devices in the art.

[0056] It should be understood that the combination of one or more method steps mentioned in the present application does not exclude the presence of other method steps before and after the combination steps or the insertion of other method steps between the explicitly mentioned steps, unless otherwise specified. It should also be understood that the combination connection relationship between one or more devices mentioned in the present application does not exclude the presence of other devices before and after the combination devices or the insertion of other devices between the explicitly mentioned two devices, unless otherwise specified. Furthermore, unless otherwise specified, the numbering of each method step is only a convenient tool to identify each method step, and is not intended to limit the arrangement order of each method step or to limit the scope of the present application. Changes or adjustments of the relative relationship, without substantial changes in technical content, are also considered within the scope of the present application.

[0057] The host bacteria used in the following examples: E. coli BL21 (DE3), E. coli DH5α, purchased from Beijing Genki Biological Technology Co., Ltd.

[0058] LB liquid medium: 10.0 g / L of proteose peptone, 5.0 g / L of yeast extract, 10.0 g / L of sodium chloride.

[0059] LB liquid medium: 10.0 g / L of proteose peptone, 5.0 g / L of yeast extract, 10.0 g / L of sodium chloride.

[0060] TB liquid medium: glycerol 5.0 mL / L, yeast extract 24.0 g / L, peptone 12.0 g / L, potassium dihydrogen phosphate (KH2PO4) 2.2 g / L, sodium hydrogen phosphate (Na2HPO4) 14.4 g / L.

[0061] Example 1 Protein expression verification of adenosine kinase (ADK) and polyphosphate kinase 2 (PPK2)

[0062] The Arabidopsis thaliala ADK gene (GenBank: NP_195950.1) was codon-optimized (nucleotide sequence as SEQ ID NO. 1), and the Cytophaga hutchinsonii PPK2 gene (GenBank: WP_011583516) was codon-optimized (nucleotide sequence as SEQ ID NO. 2). Both were inserted into the pET-28a(+) vector through restriction enzyme sites, and were synthesized by GenScript (Nanjing) Co., Ltd. The atADK-pET-28a (+) and chPPK2-pET-28a (+) plasmids were constructed, and the sequences were verified by sequencing. The atADK and chPPK2 expression engineering bacteria were obtained by heat shock transformation into E. coli BL21(DE3) competent cells. The single colonies were inoculated into LB liquid medium containing 50 μg / mL kanamycin, and cultured at 37°C with 200 rpm shaking for 12 h. Then, the culture was transferred to 3 L TB liquid medium for expansion culture, and continued to be cultured at 37°C with 200 rpm shaking for 12 h. When the optical density OD600 of the culture reached 0.6, the temperature was reduced to 16°C, and IPTG solution with a final concentration of 0.2-0.8 mM was added for induction expression for 16-20 h. The culture was centrifuged at 4000 rpm for 25 min, and the bacteria were collected. The crude enzyme solution was obtained by ultrasonic disruption. The protein expression was analyzed by SDS-PAGE, and the related results are shown in 600 . Figure 2 .

[0063] The results are shown in Figure 2 , which show that the atADK and chPPK2 proteins are normally expressed, and the sizes are 38 kDa and 31.2 kDa, respectively.

[0064] Example 2 Construction of atADK-chPPK2_pET-28a(+) double expression plasmid

[0065] The plasmid map was designed, as shown in Figure 3atADK-pET-28a (+), chPPK2-pET-28a (+) plasmid as a template, atADK target gene fragment and linearized vector chPPK2-pET-28a (+) were amplified, and the required primers are shown in Table 1 (atADK-F, atADK-R, ZchPPK2-F, ZchPPK2-R). The PCR parameters were set (98 ℃ 10 s, 55 ℃ 5 s, 72 ℃ 5 s / kb above program for 35 cycles, and then 4 ℃ preservation), and PCR amplification was completed, and the results were as follows Figure 4 The PCR amplification product was purified by DNA Gel Extraction Kit kit (purchased from Dalinbiotech), the target fragment was connected with the vector, the ligation product was transformed into E. coli DH5α competent cells, and was coated on a kanamycin-resistant LB plate and cultured at 37 ℃ for 15-18 h. A single colony was picked and inoculated to extract plasmid, and was sent to Beijing Qikeng Biotechnology Co., Ltd. for sequencing. The correct sequencing result can be used for subsequent experiments.

[0066] Table 1 Primer sequences for constructing atADK and chPPK2 double expression plasmids .

[0067] Example 3 Protein expression verification of atADK and chPPK2 double expression plasmids

[0068] The atADK-chPPK2_pET-28a(+) plasmid constructed in Example 2 was heat-shocked and transformed into E. coli BL21(DE3) competent cells to obtain atADK and chPPK2 double expression engineering bacteria. A single colony was picked and inoculated into LB liquid medium containing 50 μg / mL kanamycin, and cultured at 37 ℃ with 200 rpm shaking for 12 h. Then, the culture was transferred to 3 L TB liquid medium for expansion culture, and was continued to be cultured at 37 ℃ with 200 rpm shaking for 12 h. When the optical density OD 600 of the culture reached 0.6, the temperature was reduced to 16 ℃, and IPTG solution with a final concentration of 0.2-0.8 mM was added for induction expression for 16-20 h. The culture was centrifuged at 4000 rpm for 25 min, and the bacterial cells were collected and ultrasonically broken to obtain crude enzyme solution. The protein expression was analyzed by SDS-PAGE. The results are shown in Figure 5 atADK and chPPK2 protein double expression was normal.

[0069] Example 4 One-pot synthesis of PAPS in vitro

[0070] Fermentation of pyrophosphatase (PPA, from Escherichia coli), adenosine 5'-phosphosulfate kinase (APSK, from Penicillium chrysogenum) and ATP sulfurylase (KAST, from Kluyveromyces lactis) expression strains: the glycerol bacteria was activated by a line and placed in a 37°C incubator for overnight culture. A single colony was inoculated into LB liquid medium containing 50 μg / mL kanamycin, and after 12 h of culture at 37°C with 200 rpm shaking, it was transferred to 3 L of TB liquid medium for expansion culture, and continued to be cultured at 37°C with 200 rpm shaking for 12 h. When the optical density OD 600 When the optical density OD

[0071] Enzyme activity determination method: the reaction system (20 mM ATP, 10 mM MgCl2, 5 mM LiCl, 50 mM Na2SO4, 50 mM Tris-HCl (pH 7.4)) was configured, and 300 μL of crude enzyme solution was added to the reaction system to start the reaction. The KAST:APSK:PPA crude enzyme solution ratio was controlled at 1:1:0.5, and the reaction was carried out at 37°C for 30 min. The amount of PAPS generated was determined by HPLC, and the enzyme activity was calculated. The enzyme activity was the amount of PAPS generated per minute (μmol), i.e. 1 U=1 μmol / L·min.

[0072] One-pot reaction synthesis of PAPS: an appropriate amount of atADK, chPPK2, KAST, APSK, and PPA bacterial bodies were taken and ultrasonically broken to obtain a crude enzyme solution. The reaction system was configured: 5-10 mM adenosine, 1-2 mM ATP, 10-15 mM PolyP, 20 mM NaSO4, 20 mM MgCl2, and crude enzyme solution 2:2:1:1:0.5 (KAST, APSK, PPA, atADK, chPPK2), and the system was supplemented with 50 mM Tris-HCl (pH 7.4) buffer, and the reaction was carried out at 37°C for 1-5 h. Finally, acetonitrile was added to stop the reaction.

[0073] Sample processing method: oscillation mixing, 12000 rpm centrifugation for 5 min, sterile syringe to take supernatant, 0.22 μm filter membrane filtration, take 200 μL into liquid phase bottle inner sleeve for detection.

[0074] High performance liquid chromatography (HPLC): chromatograph Agilent high performance liquid chromatography 1260; chromatographic column HILIC Silica 250*4.6 mm; column temperature 30°C; flow rate 1 mL / min; detection wavelength 260 nm; mobile phase: A phase 10 mM ammonium formate, B phase 10 mM ammonium formate acetonitrile, gradient elution, elution program: 0-10 min, 60% B phase; 10-10.1 min, 90% B phase; 10.1-20 min 90% B phase.

[0075] The results are shown in Figure 6 The conversion rate of PAPS was determined by liquid chromatography before and after reaction, the conversion rate was >40%, and the yield was 4.53 mM PAPS. Figure 6 -A is the liquid chromatogram before reaction, Figure 6 -B is the liquid chromatogram after reaction.

[0076] Example 5: In vitro one-pot synthesis of PAPS method two

[0077] Take an appropriate amount of double expression bacteria of atADK and chPPK2, and an appropriate amount of KAST, APSK and PPA bacteria, and ultrasonic crushing to obtain crude enzyme solution. Configure the reaction system: 5-10 mM adenosine, 1-2 mM ATP, 10-15 mM PolyP, 20 mM NaSO4, 20 mM MgCl2 and crude enzyme solution 2:2:1:1 (KAST, APSK, PPA, atADK+chPPK2), and 50 mM Tris-HCl (pH 7.4) buffer solution to make up the system, and react at 37°C for 1-5 h, and finally add acetonitrile to stop the reaction. The sample processing method and high performance liquid chromatography (HPLC) are the same as in Example 4.

[0078] The results are shown in Figure 7 The conversion rate of PAPS was determined by liquid chromatography before and after reaction, the conversion rate was >40%, and the yield was 4.17 mM PAPS. Figure 7 -A is the liquid chromatogram before reaction, Figure 7 -B is the liquid chromatogram after reaction.

[0079] Example 6: Whole cell one-pot synthesis of PAPS

[0080] The double expression bacteria of atADK and chPPK2, and the KAST, APSK, and PPA bacteria are weighed, and the bacteria are resuspended in 50 mM Tris-HCl (pH 7.4) buffer to 100-200 g / L. The reaction system is configured: 5-10 mM adenosine, 10-15 mM PolyP, 20 mM NaSO4, 20 mM MgCl2, and whole cells 2:2:1:1 (KAST, APSK, PPA, atADK+chPPK2), and the system is supplemented with 50 mM Tris-HCl (pH 7.4) buffer, and is reacted at 37°C for 1-5 h, and finally acetonitrile is added to stop the reaction. The sample treatment method and high performance liquid chromatography (HPLC) are the same as in Example 4.

[0081] The results are shown in Figure 8 The conversion rate of PAPS before and after the reaction is determined by liquid chromatography, the conversion rate is >50%, and the yield is 5.12 mM PAPS. Figure 8 -A is a liquid chromatogram before reaction, Figure 8 -B is a liquid chromatogram after reaction.

[0082] The present application realizes efficient regeneration of ATP by constructing a multi-enzyme system containing adenosine kinase (atADK) and polyphosphate kinase (chPPK2), using low-cost adenosine and polyphosphate (PolyP) as starting materials, and coupling pyrophosphatase (PPA), adenosine 5'-phosphosulfate kinase (APSK), and ATP sulfurylase (KAST) to catalyze the synthesis of PAPS. The method can be carried out in a one-pot method or a whole cell system, and has achieved a good conversion rate, the conversion rate is >50%, and the yield can reach 5.12 mM PAPS. The present application can reduce the cost of biological production, and has industrial application prospect.

[0083] The raw materials and equipment used in the present application are conventional raw materials and equipment in the art unless otherwise specified; the methods used in the present application are conventional methods in the art unless otherwise specified.

[0084] The above-described examples are only preferred examples for fully illustrating the present application, and the protection scope of the present application is not limited thereto. Any simple modification, change, and equivalent transformation of the above examples according to the technical essence of the present application still belong to the protection scope of the technical solution of the present application.

[0085] SEQ ID NO.1

[0086] SEQ ID NO. 2 atggcaaccgactttagcaaactgagcaaatacgtggaaactctgcgtgttaaaccgaaacagtccattgacctgaagaaagacttcgatactgactacgaccacaagatgctgaccaaagaagaaggtgaagaactgctgaacctgggtatctccaaactgtccgaaatccaagagaaactgtacgcatccggtactaaatctgtactgatcgtctttcaggctatggatgctgcaggtaaagacggtactgtgaaacacatcatgaccggtctgaatccgcagggtgttaaagttacttctttcaaagttccgtctaagatcgaactgtctcacgactacctgtggcgtcactacgttgctttgccggcaaccggcgaaatcggtatcttcaaccgttctcactacgagaacgtgctggtaactcgtgttcatccggaatacctgctgtccgaacagacctctggcgttaccgcaatcgaacaggttaaccagaaattctgggacaaacgtttccagcagatcaacaacttcgaacagcacatctccgagaacggcaccatcgtgctgaaattctttctgcacgttagcaagaaagaacagaagaaacgtttcatcgaacgtatcgaactggacaccaagaactggaaattcagcaccggtgatctgaaagaacgtgcacactggaaagactaccgtaacgcttacgaggacatgctggcgaacacctccaccaaacaggcgccgtggttcgttatcccggcagatgacaaatggttcactcgtttgctgatcgcggaaatcatctgcaccgaactggagaaactgaacctgacctttccaactgtttaa

Claims

1. A recombinant expression vector, characterized in that, It contains genes encoding adenosine kinase and / or polyphosphate kinase.

2. The recombinant expression vector according to claim 1, characterized in that, The nucleotide sequence of the gene encoding adenosine kinase is shown in SEQ ID NO:1, and the nucleotide sequence of the gene encoding polyphosphate kinase is shown in SEQ ID NO:

2.

3. A method for constructing the recombinant expression vector according to claim 1 or 2, characterized in that, include: (1) The adenosine kinase encoding gene with the nucleotide sequence shown in SEQ ID NO:1 was inserted into the multiple cloning site of the vector pET-28a(+) through the restriction endonuclease site to obtain the atADK-pET-28a(+) plasmid; (2) The polyphosphate kinase encoding gene with the nucleotide sequence shown in SEQ ID NO:2 was inserted into the multiple cloning site of the vector pET-28a(+) through the restriction endonuclease site to obtain the chPPK2-pET-28a (+) plasmid; (3) The adenosine kinase encoding gene with the nucleotide sequence shown in SEQ ID NO:1 was inserted into the multiple cloning site of the chPPK2-pET-28a (+) plasmid by linear cloning to obtain the atADK-chPPK2_pET-28a(+) plasmid; (4) Transform the plasmids obtained in steps (1)-(3) into E. coli The recombinant plasmid was validated in DH5α competent cells, and the recombinant plasmid that was validated correctly became the recombinant expression vector.

4. A genetically engineered bacterium, characterized in that, It is obtained by introducing the recombinant expression vector as described in claim 1 or 2 into a host strain.

5. The genetically engineered bacterium according to claim 4, characterized in that, The host strain is E. coli BL21(DE3) carries any one of the following recombinant expression vectors: atADK-pET-28a(+), chPPK2-pET-28a(+), or atADK-chPPK2_pET-28a(+).

6. The recombinant expression vector according to claim 1 or 2, or the genetically engineered bacteria according to claim 4 or 5, in the synthesis of 3'-adenosine monophosphate-5'-phosphate sulfate.

7. A method for synthesizing 3'-adenosine-5'-phosphate sulfate, characterized in that, This includes the preparation of 3'-adenosine-5'-phosphate sulfate using adenosine and polyphosphate as substrates via any of the following methods: One-pot enzymatic reaction using a multi-enzyme system; or The genetically engineered bacteria described in claim 4 or 5 are used in conjunction with strains expressing pyrophosphatase, adenosine 5'-phosphate sulfate kinase, and ATP sulfate catalysis to perform a whole-cell one-pot catalytic reaction.

8. The method according to claim 7, characterized in that, The multi-enzyme system is prepared through the following steps: (a) Culture strains expressing ATP sulfate, adenosine 5'-phosphate sulfate kinase, pyrophosphatase, and the genetically engineered bacteria as described in claim 4 or 5, respectively; (b) The bacterial cells were subjected to ultrasonic disruption to obtain the corresponding crude enzyme solution; (c) Mix the above crude enzyme solutions in proportion to form a multi-enzyme system; the mass ratio of each crude enzyme solution is: crude enzyme solution containing ATP sulfate : crude enzyme solution containing adenosine 5'-phosphate sulfate kinase : crude enzyme solution containing pyrophosphatase : crude enzyme solution containing adenosine kinase : crude enzyme solution containing polyphosphate kinase = 2 : 2 : 1 : 1 : 0.5, or crude enzyme solution containing ATP sulfate : crude enzyme solution containing adenosine 5'-phosphate sulfate kinase : crude enzyme solution containing pyrophosphatase : crude enzyme solution containing both adenosine kinase and polyphosphate kinase = 2 : 2 : 1 :

1.

9. The method according to claim 7 or 8, characterized in that, The preparation of 3'-adenosine-5'-phosphate sulfate by a one-pot enzymatic reaction using a multi-enzyme system includes: (a) Strains expressing ATP sulfate kinase, adenosine 5'-phosphate sulfate kinase, pyrophosphatase, and the genetically engineered bacteria were cultured separately, and then each bacterial cell was ultrasonically disrupted. The crude enzyme solutions obtained were mixed in proportion to form a multi-enzyme system. (b) Prepare reaction system one, react at 37°C for 1-5 h, then add acetonitrile to stop the reaction, and obtain the reaction solution; the components of reaction system one are: 5-10 mM adenosine, 1-2 mM ATP, 10-15 mM PolyP, 20 mM NaSO4, 20 mM MgCl2 and multi-enzyme system; (c) After centrifuging the reaction solution, the supernatant was collected, filtered through a membrane, and the concentration of 3'-adenosine-5'-phosphate sulfate was determined by high performance liquid chromatography.

10. The method according to claim 7 or 8, characterized in that, The preparation of 3'-adenosine-5'-phosphate sulfate by whole-cell catalytic reaction includes: (a) Culture strains expressing ATP sulfate, adenosine 5'-phosphate sulfate kinase, pyrophosphatase, and the genetically engineered bacteria described above, respectively, and resuspend the bacterial cells in 50 mM Tris-HCl (pH 7.4) buffer to 100-200 g / L to obtain bacterial suspensions; (b) Prepare reaction system two, react at 37°C for 1-5 h, then add acetonitrile to stop the reaction, and obtain the reaction solution; the components of reaction system two are: 5-10 mM adenosine, 10-15 mM PolyP, 20 mM NaSO4, 20 mM MgCl2 and whole cell system; wherein, the whole cell system is a mixture of bacterial suspensions with a mass ratio of 2∶2∶1∶1 (KAST, APSK, PPA, atADK+chPPK2); (c) After centrifuging the reaction solution, the supernatant was collected, filtered through a membrane, and the concentration of 3'-adenosine-5'-phosphate sulfate was determined by high performance liquid chromatography.

Images