Rice lodging-resistant and yield-related protein STRONG2 as well as coding gene and application thereof

By regulating the expression of the gene encoding the STRONG2 protein in rice, enhancing its activity and content, the problem of yield reduction caused by lodging in rice was solved, and the lodging resistance and yield of rice were improved.

CN121362780APending Publication Date: 2026-01-20CHINA AGRI UNIV +1
View PDF 4 Cites 0 Cited by

Patent Information

Application Number
CN202410977189.3
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2024-07-19
Publication Date
2026-01-20

AI Technical Summary

Technical Problem

The yield reduction caused by lodging in rice limits the improvement of rice yield, and existing breeding methods are unable to effectively solve this problem.

Method used

By regulating the expression of the gene encoding the STRONG2 protein in rice, its activity and content can be enhanced, thereby improving the lodging resistance and yield of rice.

Benefits of technology

It significantly improved the lodging resistance and yield of rice, reduced yield reduction caused by lodging, and enhanced the production stability and economic benefits of rice.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure SMS_1
    Figure SMS_1
  • Figure HDA0004955671650000011
    Figure HDA0004955671650000011
  • Figure HDA0004955671650000021
    Figure HDA0004955671650000021
Patent Text Reader

Abstract

The invention discloses rice lodging resistance and yield related protein STRONG2 as well as a coding gene and application thereof, belongs to the technical field of biology, and particularly discloses application of any one of protein, a substance for regulating and controlling expression of the coding gene of the protein or a substance for regulating and controlling activity or content of the protein. A1) application in improving the lodging resistance of the gramineous plants and / or application in preparing products for improving the lodging resistance of the gramineous plants; a2) application to increase the yield of the gramineous plants and / or application to increase the yield of the gramineous plants.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to a rice anti-lodging and yield-related protein STRONG2, a coding gene thereof and an application thereof. BACKGROUND

[0002] Rice is an important food crop in the world, which provides nutrition and heat demand for half of the world's population. Rice is the main food crop in China, and its yield has exceeded 40% of the total grain production in China.

[0003] In recent years, rice dwarf breeding has reached a bottleneck, and it is difficult to significantly improve rice yield. Some scholars have proposed that appropriate increase of plant height can effectively improve rice yield, but lodging will also increase. It is reported that the annual yield reduction caused by lodging of rice is as high as 10%-30%. The lodging problem has become a key factor limiting the high yield of rice, which not only causes the reduction of grain number and grain weight, but also affects the quality of rice. Therefore, it is of great practical significance to study the lodging problem of rice for improving the high yield and stable yield of rice. SUMMARY

[0004] The technical problem solved by the present application is to improve the anti-lodging and yield of plants, especially rice.

[0005] In order to solve the above problems, the present application provides a method for improving the anti-lodging and yield of plants.

[0006] The method comprises improving the anti-lodging and yield of plants by up-regulating or enhancing or increasing the expression of a coding gene of a protein in plants, and / or the activity and / or content of the protein.

[0007] The protein is any one of the following proteins:

[0008] B1) the amino acid sequence is the protein shown in sequence 2;

[0009] B2) the protein obtained by substitution, deletion and / or addition of amino acid residues of the protein in B1) has more than 80% identity with the protein shown in B1) and has the same function;

[0010] B3) the fusion protein obtained by connecting the N-terminal or / and C-terminal of B1) or B2) with a protein tag.

[0011] In the present application, the plant can be rice.

[0012] In the above, the biological yield can be the total amount of organic matter produced and accumulated in the life of a plant, excluding the root system. The biological yield can be the dry weight of a single plant above ground.

[0013] The economic yield is the product harvest amount required for cultivation purposes. The economic yield can be the main stem ear weight of the gramineae plant.

[0014] To solve the above problems, the present application also provides a method for cultivating high lodging resistance and yield.

[0015] The method comprises up-regulating or enhancing or increasing the expression amount of the coding gene of the above protein in the plant of interest, and / or the activity and / or content of the protein to obtain a high lodging resistance and yield plant, wherein the lodging resistance and / or yield of the high lodging resistance and yield plant is higher than that of the plant of interest.

[0016] In the above method, the up-regulation or enhancement or increase of the expression of the coding gene of the above protein in the plant comprises introducing the nucleic acid molecule of B1), the expression cassette of B2) or the recombinant vector of B3) into the plant of interest.

[0017] In the above, the nucleic acid molecule can be the nucleic acid molecule of SEQ ID NO. 1.

[0018] To solve the above problems, the present application also provides the following applications.

[0019] Protein, substance for regulating the expression of the coding gene of the protein or substance for regulating the activity or content of the protein in any of the following applications;

[0020] A1) application for increasing the lodging resistance of gramineae plants and / or application for preparing products for increasing the lodging resistance of gramineae plants;

[0021] A2) application for increasing the yield of gramineae plants and / or application for preparing products for increasing the yield of gramineae plants;

[0022] The protein is any of the following proteins:

[0023] F1) protein with an amino acid sequence as shown in SEQ ID NO. 2;

[0024] F2) protein with 80% or more identity to the protein of F1) and having the same function, obtained by substitution and / or deletion and / or addition of amino acid residues of the protein of F1);

[0025] F3) fusion protein obtained by connecting the N-terminal or / and C-terminal of F1) or F2) to a protein tag;

[0026] The substance for regulating the expression of the coding gene of the protein or the substance for regulating the activity or content of the protein is any of the following:

[0027] B1), nucleic acid molecule encoding the protein of claim 1 or 2;

[0028] B2) an expression cassette comprising the nucleic acid molecule of B1);

[0029] B3) a recombinant vector comprising the nucleic acid molecule of B1), or a recombinant vector comprising the expression cassette of B2);

[0030] B4) a recombinant microorganism comprising the nucleic acid molecule of B1), or a recombinant microorganism comprising the expression cassette of B2), or a recombinant microorganism comprising the recombinant vector of B3);

[0031] B5) a transgenic plant cell line comprising the nucleic acid molecule of B1), or a transgenic plant cell line comprising the expression cassette of B2), or a transgenic plant cell line comprising the recombinant vector of B3);

[0032] B6) a transgenic plant tissue comprising the nucleic acid molecule of B1), or a transgenic plant tissue comprising the expression cassette of B2), or a transgenic plant tissue comprising the recombinant vector of B3);

[0033] B7) a transgenic plant organ comprising the nucleic acid molecule of B1), or a transgenic plant organ comprising the expression cassette of B2), or a transgenic plant organ comprising the recombinant vector of B3);

[0034] B8) a nucleic acid molecule which inhibits or reduces or down-regulates the expression of a gene encoding the protein of claim 1 or 2 or which inhibits or reduces or down-regulates the activity or the content of the protein;

[0035] B9) a gene encoding the nucleic acid molecule of B8);

[0036] B10) an expression cassette comprising the gene of B9);

[0037] B11) a recombinant vector comprising the gene of B9), or a recombinant vector comprising the expression cassette of B10);

[0038] B12) a recombinant microorganism comprising the gene of B9), or a recombinant microorganism comprising the expression cassette of B10), or a recombinant microorganism comprising the recombinant vector of B11);

[0039] B13) a transgenic plant cell line comprising the gene of B9), or a transgenic plant cell line comprising the expression cassette of B10), or a transgenic plant cell line comprising the recombinant vector of B11);

[0040] B14) a transgenic plant tissue comprising the gene of B9), or a transgenic plant tissue comprising the expression cassette of B10), or a transgenic plant tissue comprising the recombinant vector of B11);

[0041] B15) a transgenic plant organ comprising the gene of B9), or a transgenic plant organ comprising the expression cassette of B10), or a transgenic plant organ comprising the recombinant vector of B11).

[0042] In the above protein, the protein-tag refers to a polypeptide or protein fused and expressed with the target protein by DNA in vitro recombination technology, so as to facilitate the expression, detection, tracking and / or purification of the target protein. The protein-tag can be a Flag tag, a His tag, an MBP tag, an HA tag, a myc tag, a GST tag and / or a SUMO tag, etc.

[0043] In the above protein, the identity refers to the identity of the amino acid sequence. The identity of the amino acid sequence can be determined using the homology search site on the Internet, such as the BLAST webpage of the NCBI homepage website. For example, the identity of a pair of amino acid sequences can be calculated by using blastp as the program, setting the Expect value to 10, setting all Filters to OFF, using BLOSUM62 as the Matrix, setting Gap existence cost, Per residue gap cost and Lambda ratio to 11, 1 and 0.85 (default value) respectively in Advanced BLAST 2.1, and then the value of the identity (%) can be obtained.

[0044] In the above protein, the identity of more than 80% can be at least 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 95%, 96%, 98%, 99% or 100%.

[0045] In the above protein, sequence 2 (SEQ ID NO: 2) consists of 574 amino acid residues. It is named as STRONG2 protein, and its encoding gene is STRONG2 gene.

[0046] In the present application, the regulation can be up-regulation or enhancement or increase of overexpression, and / or knock-out or decrease or reduction.

[0047] In the present application, the substance that up-regulates or enhances or increases the expression of the encoding gene of the protein or the activity or content of the protein can increase the lodging resistance of the plant of the family Poaceae and / or the yield of the tall plant of the family Poaceae. The substance that knocks out or decreases or reduces the expression of the encoding gene of the protein or the activity or content of the protein can decrease the lodging resistance of the plant of the family Poaceae and / or the yield of the tall plant of the family Poaceae.

[0048] In the present application, the yield can be the yield per plant and / or the yield per unit area or the yield per mu.

[0049] In the above-mentioned application, the protein is derived from rice.

[0050] In the above, the substance that regulates the expression of the gene can be a substance that regulates at least one of the following six kinds of regulation: 1) regulation at the transcription level of the gene; 2) regulation after the transcription of the gene (that is, regulation of the splicing or processing of the primary transcript of the gene); 3) regulation of the RNA transport of the gene (that is, regulation of the transport of the mRNA of the gene from the nucleus to the cytoplasm); 4) regulation of the translation of the gene; 5) regulation of the degradation of the mRNA of the gene; and 6) post-translational regulation of the gene (that is, regulation of the activity of the protein translated from the gene).

[0051] B1) or B8), a person with ordinary skill in the art can easily mutate the nucleotide sequence encoding the protein STRONG2 of the present application using known methods, such as methods of directed evolution or point mutation. Those nucleotides that are artificially modified and have 80% or more identity with the nucleotide sequence of the protein STRONG2 isolated in the present application are derived from the nucleotide sequence of the present application and are equivalent to the sequence of the present application, as long as they encode the protein STRONG2 and have the function of the protein STRONG2.

[0052] The 80% or more identity described above can be 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity.

[0053] In the present application, identity refers to the identity of an amino acid sequence or a nucleotide sequence. The identity of an amino acid sequence can be determined using a homology search site on the Internet, such as the BLAST page of the NCBI homepage. For example, the value of identity (%) can be obtained by performing a search using blastp as the program, setting the Expect value to 10, setting all Filters to OFF, using BLOSUM62 as the Matrix, setting Gap existence cost, Per residue gap cost, and Lambda ratio to 11, 1, and 0.85 (default values), respectively, and calculating the identity of the amino acid sequence in Advanced BLAST 2.1.

[0054] In the present application, the vector is well known to those skilled in the art, including but not limited to: plasmid, bacteriophage (such as lambda phage or M13 filamentous phage, etc.), cosmid (i.e. cos plasmid), Ti plasmid or viral vector. Specifically, it can be pROKII vector;

[0055] Among the above-mentioned biomaterials, the expression cassette of B2) or B9) refers to DNA capable of expressing the gene in a host cell, which can include not only a promoter that initiates transcription of the gene, but also a terminator that terminates transcription of the gene. Further, the expression cassette can also include an enhancer sequence. The promoters that can be used in the present application include, but are not limited to, constitutive promoters, tissue-, organ-, and development-specific promoters, and inducible promoters. Examples of the promoters include, but are not limited to, the constitutive promoter 35S of the cauliflower mosaic virus; the wound-inducible promoter from tomato, leucine aminopeptidase ("LAP", Chao et al. (1999) Plant Physiol 120:979-992); the chemically-inducible promoter from tobacco, pathogenesis-related (PR1) (induced by salicylic acid and BTH (benzothiadiazole-7-thiohydroxy acid S-methyl ester)); the tomato protease inhibitor II promoter (PIN2) or the LAP promoter (both of which can be induced by jasmonate acid methyl ester); the heat shock promoter (U.S. Patent 5,187,267); the tetracycline-inducible promoter (U.S. Patent 5,057,422); and seed-specific promoters, such as the millet seed-specific promoter pF128 (CN101063139B (Chinese Patent 200710099169.7)), and seed storage protein-specific promoters (e.g., the promoters of phaseolin, napin, oleosin, and soybean beta conglycin (Beachy et al. (1985) EMBO J. 4:3047-3053)). They can be used alone or in combination with other plant promoters. All references cited herein are incorporated in their entirety. Suitable transcription terminators include, but are not limited to, the Agrobacterium nopaline synthase terminator (NOS terminator), the cauliflower mosaic virus CaMV 35S terminator, the tml terminator, the pea rbcS E9 terminator, and the nopaline and opine synthase terminators (see, e.g., Odell et al. (1985) Nature 313:810; Rosenberg et al. (1987) Gene, 56:125; Guerineau et al. (1991) Mol. Gen. Genet, 262:141; Proudfoot (1991) Cell, 64:671; Sanfacon et al. Genes Dev., 5:141; Mogen et al. (1990) Plant Cell, 2:1261; Munroe et al. (1990) Gene, 91:151; Ballad et al. (1989) Nucleic Acids Res. 17:7891; Joshi et al. (1987) Nucleic Acid Res., 15:9627).

[0056] In the above B3) or B11), the recombinant vector can be a recombinant expression vector containing the gene expression cassette constructed with a plant expression vector. The plant expression vector can be a Gateway system vector or a binary Agrobacterium vector, such as pGWB411, pGWB412, pGWB405, pBin438, pCAMBIA1302, pCAMBIA2301, pCAMBIA1301, pCAMBIA1300, pBI121, pCAMBIA1391-Xa, pMDC85, or pCAMBIA1391-Xb. When using MOG1 to construct a recombinant expression vector, any one of the enhanced, constitutive, tissue-specific, or inducible promoters can be added before the transcription initiation nucleotide, such as the Cauliflower Mosaic Virus (CAMV) 35S promoter, the ubiquitin gene Ubiqutin promoter (pUbi), and the like, which can be used alone or in combination with other plant promoters; in addition, when using the gene of the present application to construct a plant expression vector, enhancers, including translation enhancers or transcription enhancers, can also be used, and these enhancer regions can be the ATG start codon or the adjacent region start codon, but must be the same reading frame as the coding sequence to ensure correct translation of the entire sequence. The source of the translation control signal and the start codon is wide, which can be natural or synthetic. The translation initiation region can be from the transcription initiation region or the structural gene. As a specific example, the present application uses the pTCK303 vector as an expression vector. As a specific example, the present application uses the pC1300-Cas9 vector as a gene knockout vector.

[0057] As a specific example, the microbial strain in the recombinant microorganism can be Agrobacterium EHA105.

[0058] In the above application, the nucleic acid molecule of B1) is a DNA molecule whose nucleotide sequence is shown in SEQ ID NO: 1.

[0059] In the above application, the nucleic acid molecule of B8) is a gRNA targeting the protein-coding gene, and the target sequence of the gRNA is SEQ ID NO: 4.

[0060] To solve the above problems, the present application provides a method for breeding low-lodging and high-yield plants.

[0061] The method comprises down-regulating or weakening or reducing the expression amount of the protein-coding gene in the target plant, and / or the activity and / or content of the protein, to obtain a low-lodging and high-yield plant, wherein the low-lodging plant has lower lodging resistance and / or yield than the target plant.

[0062] In the above method or any of the above applications, the plant is any of the following:

[0063] J1) a plant of the family Poaceae;

[0064] J2) a plant of the genus Oryza;

[0065] J3) a plant of the species Oryza sativa.

[0066] the protein or the nucleic acid molecule.

[0067] The present application discloses a gene associated with lodging resistance and yield, which is named STRONG2, and the gene can be used to improve the lodging resistance and yield of rice, which is of great significance for breeding new rice varieties. BRIEF DESCRIPTION OF DRAWINGS

[0068] Figure 1 Cloning of STRONG2 gene;

[0069] Figure 2 Lodging phenotype and statistical graph of STRONG2 knockout and overexpression;

[0070] Figure 3 Yield phenotype and statistical graph of STRONG2 knockout and overexpression;

[0071] Figure 4 Grain type phenotype and statistical graph of STRONG2 knockout and overexpression;

[0072] Figure 5 Phenotype and statistical graph of secondary cell wall of STRONG2 knockout and overexpression. DETAILED DESCRIPTION

[0073] The present application will be further described in detail below with specific embodiments. The examples given are only to illustrate the present application, and are not intended to limit the scope of the present application. The examples provided below can serve as a guide for further improvement by those skilled in the art, and do not in any way constitute a limitation on the present application.

[0074] In the following examples, the experimental methods are conventional methods, and are performed according to the techniques or conditions described in the literature in the art or according to the product instructions, unless otherwise specified. The materials, reagents, etc. used in the following examples can be obtained from commercial channels, unless otherwise specified.

[0075] Example 1, obtaining of STRONG2 gene.

[0076] Through whole genome association analysis of stem diameter of 390 germplasm materials, a major association locus qSTRONG2 (3.1) was found on chromosome 3. Figure 1a) After analysis, we found that the site was located in the interval of 14.86Mb~15.14Mb, and there were 26 predicted genes. In order to determine the candidate gene of qSTRONG2, we performed local Manhattan plot analysis and linkage disequilibrium analysis on chromosome 3, and found 11 predicted genes in the linkage interval of 14.86Mb~14.93Mb Figure 1 b-c) Then, through the analysis of the candidate genes in the interval, we found that the leadSNP was located in the promoter of Gene1, which encodes a cellulose synthase-like enzyme, and we speculated that this gene was the candidate gene, named STRONG2.

[0077] The cDNA of rice variety Nipponbare was used as a template, and 5'-ATGGAGGCCGGCGAGGCAGCCG' and 5'-TCAGAAGCAGCAATGATCAGGT' were used as primers to amplify STRONG2 gene by PCR.

[0078] After sequencing, the CDS sequence of STRONG2 gene was SEQ ID NO: 1, the nucleotide sequence was SEQ ID NO: 3, and the amino acid sequence of the encoded protein was SEQ ID NO: 2, which was named STRONG2 protein.

[0079] SEQ ID NO: 1 (Sequence 1) is as follows:

[0080] ATGGAGGCCGGCGAGGCAGCCGGCGCCGTCCTCTTCCTCCTCGCCGCCGCCGTCTCCCTCCTCGCCGCCGTCTCCACCGGCGCCCTCGACTTCACCTACCTCGTCACAGTCGTCGGCGAGGGATCGTCGACGTCGCCGGGGAGCGGCGGCGGCGCGTGGTGGCGCGAGGCGTGGGTGGGGGCGCGGTCGCGCGCGGTGGCGCCGGCGCTGCAGGTCGGGGTGTGGGCGTGCATGGTGATGTCGGTGATGCTGGTGGTGGAGGCCACCTACAACTCCGCCGTCAGCGTCGCCGCCAGGCTCGTCGGCTGGAGGCCGGAGCGGTGGTTCAAGTGGGAGCCCCTCGGCGGCGGCGCCGGCGCCGGCGACGAGGAGAAGGGGGAGGCTGCTGCTGCTGCTTATCCCATGGTCATGGTCCAGATACCCATGTATAATGAGCTCGAGGTGTACAAGTTGTCAATCGGAGCAGTTTGTGGGCTCAAGTGGCCAAAGGAGAGGTTGATAATCCAAGTTTTGGATGATTCCACGGACGCATTTATCAAGAATTTGGTTGAGCTGGAATGTGAGGATTGGGCAAGCAAAGGTCTAAACATTAAGTATGCCACCAGAAGTGGCCGCAAAGGGTTCAAAGCAGGAGCCTTGAAGAAGGGAATGGAGTGGGACTATGCCAAGCAATGCGAATATGTTGCCATATTTGATGCTGATTTCCAGCCAGAACCGGATTTCCTTCTCAGAACTGTCCCGTTCCTCATGCACAATCAGAATGTTGCGCTTGTACAAGCTCGGTGGGTTTTTGTGAATGACAGAGTAAGCCTACTGACAAGGATACAGAAGACATTCCTTGATTACCACTTCAAAGCTGAGCAGGAGGCAGGATCGGCTACATTTGCTTTCTTCAGTTTCAATGGGACCGCTGGTGTATGGCGCACAGAAGCTATCAATGACGCAGGAGGTTGGAAGGATCGAACTACAGTTGAAGACATGGACTTGGCTGTCCGAGCAACCTTAAAGGGATGGAAATTCATCTATTTAGGGGACCTCAGAGTAAAGAGTGAGCTTCCATCCACTTATAAAGCATACTGCCGACAACAGTTCCGGTGGTCTTGTGGCGGTGCAAACTTGTTCCGAAAGATGATATGGGATGTCTTGGTTGCCAAGAAAGTGTCATCCTTGAAGAAGATCTACATACTGTATAGCTTCTTCCTGGTGAGGAGAGTTGTTGCCCCTGCTGTTGCCTTTATTCTCTACAATGTTATCATCCCTGTGTCGGTCATGATCCCAGAGCTCTTCCTGCCAATCTGGGGCGTTGCCTACATTCCTACAGCACTCCTGATTGTCACTGCCATAAGAAATCCAGAAAATCTGCACACAGTGCCACTGTGGATTTTATTCGAGAGCGTCATGTCCATGCATCGGTTGAGAGCTGCTGTAGCTGGTCTGCTGCAACTGCAAGAATTCAACCAATGGATTGTGACGAAGAAAGTGGGGAACAATGCCTTCGACGAGAATAATGAGACTCCATTGCTTCAAAAATCCAGGAAAAGGTTAATAAACAGAGTGAATCTACCTGAGATCGGATTATCGGTGTTCCTCATCTTTTGTGCATCCTACAACCTTGTCTTCCATGGAAAGAACAGCTTCTACATAAATCTCTATCTCCAAGGATTAGCCTTCTTTCTTCTGGGGCTGAATTGCGTTGGCACTCTACCTGATCATTGCTGCTTCTGA.

[0081] SEQ ID NO: 2 (Sequence 2) is specified as follows:

[0082] MEAGEAAGAVLFLLAAAVSLLAAVSTGALDFTYLVTVVGEGSSTSPGSGGGAWWREAWVGARSRAVAPALQVGVWACMVMSVMLVVEATYNSAVSVAARLVGWRPERWFKWEPLGGGAGAGDEEKGEAAAAAYPMVMVQIPMYNELEVYKLSIGAVCGLKWPKERLIIQVLDDSTDAFIKNLVELECEDWASKGLNIKYATRSGRKGFKAGALKKGMEWDYAKQCEYVAIFDADFQPEPDFLLRTVPFLMHNQNVALVQARWVFVNDRVSLLTRIQKTFLDYHFKAEQEAGSATFAFFSFNGTAGVWRTEAINDAGGWKDRTTVEDMDLAVRATLKGWKFIYLGDLRVKSELPSTYKAYCRQQFRWSCGGANLFRKMIWDVLVAKKVSSLKKIYILYSFFLVRRVVAPAVAFILYNVIIPVSVMIPELFLPIWGVAYIPTALLIVTAIRNPENLHTVPLWILFESVMSMHRLRAAVAGLLQLQEFNQWIVTKKVGNNAFDENNETPLLQKSRKRLINRVNLPEIGLSVFLIFCASYNLVFHGKNSFYINLYLQGLAFFLLGLNCVGTLPDHCCF*.

[0083] SEQ ID NO: 3 (Sequence 3) is specified as follows:

[0084]

[0085] SEQ ID NO:4 (Sequence 4) is specified as follows:

[0086] TGTCAATCGGAGCAGTTTGTGGG

[0087] TGGATTATCAACCTCTCCTTTGG

[0088] Example 2, functional verification of STRONG2.

[0089] I. Construction of knockout vector

[0090] (1) Log in to the website http: / / crispor.tefor.net / , and screen the target site. The two target site sequences designed in this experiment are: 5'-TGTCAATCGGAGCAGTTTGTGGG-3' and 5'-TGGATTATCAACCTCTCCTTTGG-3' (SEQ ID NO:4).

[0091] (2) The primer sequences are as follows:

[0092] STRONG2-MT1-BsF:

[0093] 5'-ATATATGGTCTCTGGCGGTCAATCGGAGCAGTTTGTGTT-3'

[0094] STRONG2-MT1-F0:

[0095] 5'-TGGTCAATCGGAGCAGTTTGTGTTTTAGAGCTAGAAATAGC-3'

[0096] STRONG2-MT2-R0:

[0097] 5'-AACAAGGAGAGGTTGATAATCCCGCTTCTTGGTGCC-3'

[0098] STRONG2-MT2-BsR:

[0099] 5'-ATTATTGGTCTCTAAACAAGGAGAGGTTGATAATCCC-3'

[0100] (3) PCR amplification: four-primer PCR amplification was performed with pCBC-MT1T2 (publicly available from China Agricultural University, A CRISPR / Cas9 toolkit for multiplex genome editing in plants. BMC Plant Biology, 2014, 14: 327.) as a template. -BsF / -BsR was 10 μM; -F0 / -R0 was 0.5 μM.

[0101] (4) The PCR product was purified and recovered, and the following enzyme digestion-connection system was established.

[0102]

[0103] Note: pHUE411 is publicly available from China Agricultural University, A CRISPR / Cas9 toolkit for multiplex genome editing in plants. BMC Plant Biology, 2014, 14: 327.

[0104] (5) The ligation product was transformed into E. coli competent cells. The correct vector was named STRONG2-CR after sequencing.

[0105] II. Construction of overexpression vector

[0106] The nucleotide sequence of the STRONG2 gene was amplified with primers STRONG2-OE-F / R to obtain a PCR product with a size of 1725 bp, which was connected to the plant expression vector pCM1307 (publicly available from China Agricultural University, Rice SPL10 positively regulates trichome development through expression of HL6 and auxin-related genes. Journal of Integrative Plant Biology, 2021, 63: 1521-1536) by homologous recombination. The primers used are as follows:

[0107] STRONG2-OE-F:

[0108] GACGAGCTCTCTAGA ACTAGT ATGGAGGCCGGCGAGGCAGCCG (underlined is the recognition site of restriction endonuclease Spe I)

[0109] STRONG2-OE-R:

[0110] GCGGAGTACCCG GGTACCACCTCAGAAGCAGCAATGATCAGGT (underlined are the recognition sites of restriction enzyme Kpnl)

[0111] The recombinant plasmid which was sequenced correctly was named STRONG2-OE.

[0112] III. Obtaining of Transgenic Rice

[0113] (1) Recombinant bacteria

[0114] The knock-out vector STRONG2-CR and the over-expression vector STRONG2-OE were transformed into Agrobacterium tumefaciens EHA105 by freeze-thawing method to obtain recombinant bacteria, which were used to infect the callus of transgenic receptor variety (Nipponbare).

[0115] (2) Transgenic rice

[0116] The classical Agrobacterium-mediated callus infection method was adopted, and the specific steps were as follows:

[0117] a. Obtaining of embryogenic callus: The mature seeds were shelled and then sterilized with alcohol, and then sterilized twice with sodium hypochlorite and rinsed once with sterile water, and then dried in a clean bench. The obtained sterile Nipponbare seeds were inoculated into NB medium, and cultured at 28°C in the dark for 2 weeks. The embryogenic callus was peeled off and subcultured into new NB medium, and subcultured for 2 weeks (subcultured twice).

[0118] b. Preparation of infection liquid: The preserved Agrobacterium liquid was taken and spread on solid medium containing rifampicin and kanamycin, and cultured at 28°C in the dark for 2 days. A small amount of Agrobacterium was scraped into AAM liquid medium, and the concentration of the bacterial liquid was about OD600 0.3.

[0119] c. Co-culture: The naturally dispersed, bright yellow, and granular callus with a diameter of about 3-5 mm was selected and added into a triangular flask, and the prepared infection liquid was added for 10 min. The excess infection liquid was absorbed with sterile filter paper, and then placed on co-culture medium with a layer of filter paper, and co-cultured at 20°C for 2-3 days.

[0120] d. Screening of resistant callus: The callus after co-culture was taken out, washed quickly with sterile water for 5-6 times, and then washed with sterile water containing cefotaxime and carbenicillin for 20 min, and finally drained for 3 h on sterile filter paper. Then it was moved to the delay screening medium. After one week, it was moved to the first round of screening medium, and after two weeks, it was moved to the second round of screening medium, and continued to culture for two weeks.

[0121] e. Differentiation: The resistant callus obtained by screening was inoculated into pre-differentiation medium, and cultured at 28°C in the dark for 2 weeks, and then transferred to differentiation medium, and cultured under light for 2-3 weeks to obtain regenerated transgenic seedling plants.

[0122] f. The seedlings are moved to a strong seedling culture medium, and after the seedlings have rooted and grown, the culture bottles are removed, the medium on the roots is washed off, and the seedlings are hardened for 1-2 weeks and then transplanted to the field until maturity.

[0123] The medium formula used in the above transgenic process is shown below.

[0124] YEP medium: 10 g / L peptone + 10 g / L yeast extract + 5 g / L NaCl + 15 g / L agar powder, pH 7.0.

[0125] AAM liquid medium: AA salt (AA macro, AA micro, iron salt) + MS vitamin + AA amino acid + 500 mg / L hydrolyzed casein + 68.5 g / L sucrose + 36 g / L glucose + 20 mg / L acetosyringone, pH 5.2.

[0126] Co-culture medium: NB medium basic components + 2 mg / L 2,4-D + 10 g / L glucose + 20 mg / L acetosyringone, pH 5.4.

[0127] Delayed screening medium: NB medium basic components + 2 mg / L 2,4-D + 500 mg / L cephalosporin, pH 5.8.

[0128] First round screening medium: NB medium basic components + 2 mg / L 2,4-D + 500 mg / L cephalosporin + 50 mg / L hygromycin, pH 5.8.

[0129] Second round screening medium: NB medium basic components + 2 mg / L 2,4-D + 50 mg / L hygromycin, pH 5.8.

[0130] Pre-differentiation medium: NB medium basic components + 1 mg / L 6-BA + 2 mg / L NAA + 5 mg / L ABA + 50 mg / L hygromycin, pH 5.8.

[0131] Differentiation medium: NB medium basic components + 2 mg / L 6-BA + 1 mg / L NAA + 1 mg / L KT + 50 mg / L hygromycin, pH 5.8.

[0132] Strong seedling medium: 1 / 2MS medium basic components + 0.5 mg / L NAA + 0.25 mg / L paclobutrazol, pH 5.8.

[0133] Note: NB medium basic components include N6 macro elements, B5 micro elements, B5 organic components, 150 mg / L myo-inositol, 300 mg / L hydrolyzed casein, 500 mg / L glutamine, 600 mg / L proline, 30 g / L sucrose, and 3 g / L phytagel.

[0134] IV. Identification of the Related Traits of Each Transgenic Rice

[0135] The stem diameter, cavity wall thickness, cross-sectional modulus, bending resistance, pushing resistance, branch number, grain number per panicle, yield per plant and grain type of each transgenic rice positive line obtained in Step Three of the artificial investigation and its corresponding recipient variety (Nipponbare) were determined.

[0136] Figure 2 The overexpression and knockout anti-lodging phenotype and statistical chart. Compared with the wild type (NIP), the stem diameter, bending resistance, pushing resistance and cross-sectional modulus of the knockout material decreased, and the cavity wall thickness did not change significantly; the stem diameter, bending resistance, pushing resistance and cross-sectional modulus of the overexpression plant increased significantly, and the cavity wall thickness did not change significantly. (a) Wild type and knockout transgenic plant phenotype at mature stage. (b) Wild type and knockout transgenic plant stem diameter phenotype chart at yellow ripe stage. (c) Stem diameter, unit: mm, (d) Cavity wall thickness, unit: mm, (e) Bending resistance, unit: N, (f) Pushing resistance, unit: N, (g) Cross-sectional modulus, unit: mm 3 (h) Wild type and overexpression transgenic plant phenotype at mature stage. (i) Wild type and overexpression transgenic plant stem diameter phenotype chart at yellow ripe stage. (j) Stem diameter, unit: mm, (k) Cavity wall thickness, unit: mm, (l) Bending resistance, unit: N, (m) Pushing resistance, unit: N, (n) Cross-sectional modulus, unit: mm 3 .

[0137] Figure 3 STRONG2 overexpression and knockout yield phenotype and statistical chart. Compared with the wild type (NIP), the secondary branch number, grain number per panicle and yield per plant of the knockout material decreased significantly, and the secondary branch number, grain number per panicle and yield per plant of the overexpression plant increased significantly. (a) Wild type NIP and knockout plant panicle phenotype. (b) Wild type NIP and knockout plant primary branch number, (c) Secondary branch number, (d) Grain number per panicle, (e) Yield per plant, unit: g. (f) Wild type NIP and overexpression plant panicle phenotype. (g) Wild type NIP and overexpression plant primary branch number, (h) Secondary branch number, (i) Grain number per panicle, (j) Yield per plant, unit: g.

[0138] Figure 4Figure 6 STRONG2 overexpression and knockout grain phenotypes and statistics. Knockout material has reduced grain length, unchanged grain width, and reduced thousand kernel weight compared to wild type (NIP). Overexpression material has increased grain length, unchanged grain width, and increased thousand kernel weight compared to wild type (NIP). Cytological observations show that knockout material has reduced cell length and reduced cell number compared to wild type (NIP); overexpression material has increased cell length and increased cell number compared to wild type (NIP). (a) Wild type NIP and knockout grain phenotype plot. (b) Wild type NIP and knockout grain length in mm, (c) grain width in mm, (d) thousand kernel weight in g. (e) Wild type NIP and overexpression grain phenotype plot. (f) Wild type NIP and overexpression grain length in mm, (g) grain width in mm, (h) thousand kernel weight in g. (i) Wild type NIP and knockout and overexpression seed grain cytology phenotype. (j) Wild type NIP and knockout and overexpression seed grain cell length in pm, (k) cell width in pm, (1) cell number.

[0139] Figure 5 Figure 7 STRONG2 secondary cell wall phenotypes and statistics. Knockout material has reduced secondary cell wall thickness and reduced cellulose content compared to wild type (NIP). Overexpression material has increased secondary cell wall thickness and increased cellulose content compared to wild type (NIP). (a) Wild type NIP and knockout and overexpression secondary cell wall scanning electron microscopy observation phenotype plot. (b) secondary cell wall thickness in pm, (c) cellulose content in pg / mg.

[0140] The above detailed description of the application is provided. For those skilled in the art, without departing from the spirit and scope of the application, and without unnecessary experiments, the application can be implemented in a wider range of equivalent parameters, concentrations and conditions. Although the application gives a special example, it should be understood that the application can be further improved. In general, according to the principle of the application, the present application intends to include any change, use or improvement of the application, including changes made by conventional techniques known in the art, which deviates from the scope disclosed in the present application. Some basic features can be applied within the scope of the following attached claims.

Claims

1. A method for improving lodging resistance and / or yield of a plant, characterized in that, The application relates to a method for improving the lodging resistance and / or yield of a plant, comprising up-regulating or enhancing or increasing the expression of a gene encoding a protein in the plant, and / or the activity and / or content of the protein; The protein is any one of the following proteins: B1) a protein with an amino acid sequence as shown in SEQ ID NO: 2; B2) a protein obtained by substitution and / or deletion and / or addition of amino acid residues of the protein of B1) and having more than 80% identity with the protein shown in B1) and having the same function; B3) a fusion protein obtained by connecting a protein tag to the N terminal and / or C terminal of B1) or B2).

2. A method for breeding lodging resistant and / or high yielding plants, characterized in that, The application relates to a method for improving the lodging resistance and / or yield of a plant, comprising up-regulating or enhancing or increasing the expression of a gene encoding a protein in the plant, and / or the activity and / or content of the protein; 3. The method of claim 1 or 2, wherein, The up-regulating or enhancing or increasing the expression of a gene encoding a protein in the plant of claim 1 or 2 comprises introducing the nucleic acid molecule of B1), the expression cassette of B2) or the recombinant vector of B3) into the plant.

4. Use of a protein, a substance for regulating the expression of a gene encoding the protein or a substance for regulating the activity or content of the protein in any one of the following: A1) improving the lodging resistance of a plant in the Gramineae family and / or preparing a product for improving the lodging resistance of a plant in the Gramineae family; A2) improving the yield of a plant in the Gramineae family and / or preparing a product for improving the yield of a plant in the Gramineae family; The protein is any one of the following proteins: F1) a protein with an amino acid sequence as shown in SEQ ID NO: 2; F2) a protein obtained by substitution and / or deletion and / or addition of amino acid residues of the protein of F1) and having more than 80% identity with the protein shown in F1) and having the same function; F3) a fusion protein obtained by connecting a protein tag to the N terminal and / or C terminal of F1) or F2); The substance for regulating the expression of a gene encoding the protein or the substance for regulating the activity or content of the protein is any one of the following: B1), a nucleic acid molecule encoding the protein of claim 1 or 2; B2), an expression cassette containing the nucleic acid molecule of B1); B3), a recombinant vector containing the nucleic acid molecule of B1) or the expression cassette of B2); B4), a recombinant microorganism containing the nucleic acid molecule of B1) or the expression cassette of B2) or the recombinant vector of B3); B5), a transgenic plant cell line containing the nucleic acid molecule of B1) or the expression cassette of B2) or the recombinant vector of B3); B6), a transgenic plant tissue containing the nucleic acid molecule of B1) or the expression cassette of B2) or the recombinant vector of B3). B7) a transgenic plant organ comprising the nucleic acid molecule of B1), or a transgenic plant organ comprising the expression cassette of B2), or a transgenic plant organ comprising the recombinant vector of B3); B8) a nucleic acid molecule that inhibits or reduces or down-regulates the expression of the gene encoding the protein of claim 1 or 2, or inhibits or reduces or down-regulates the activity or content of the protein; B9) a gene encoding the nucleic acid molecule of B8); B10) an expression cassette comprising the gene of B9); B11) a recombinant vector comprising the gene of B9), or a recombinant vector comprising the expression cassette of B10); B12) a recombinant microorganism comprising the gene of B9), or a recombinant microorganism comprising the expression cassette of B10), or a recombinant microorganism comprising the recombinant vector of B11); B13) a transgenic plant cell line comprising the gene of B9), or a transgenic plant cell line comprising the expression cassette of B10), or a transgenic plant cell line comprising the recombinant vector of B11); B14) a transgenic plant tissue comprising the gene of B9), or a transgenic plant tissue comprising the expression cassette of B10), or a transgenic plant tissue comprising the recombinant vector of B11); B15) a transgenic plant organ comprising the gene of B9), or a transgenic plant organ comprising the expression cassette of B10), or a transgenic plant organ comprising the recombinant vector of B11).

5. Use according to claim 4, characterized in that, The protein is derived from rice.

6. Use according to claim 4 or 5, characterized in that, The nucleic acid molecule of B1) is a DNA molecule whose nucleotide sequence is SEQ ID NO:

1.

7. Use according to claim 4 or 5, characterized in that, The nucleic acid molecule of B8) is a gRNA targeting the gene encoding the protein of claim 1, and the target sequence of the gRNA is SEQ ID NO:

4.

8. A method of breeding for lodging susceptibility and / or low yield, characterized in that, The protein is derived from rice.

9. The method of any one of claims 1-3 or 8 or the use of any one of claims 4-7, wherein, B1) the nucleic acid molecule is a DNA molecule whose nucleotide sequence is SEQ ID NO:

1. B8) the nucleic acid molecule is a gRNA targeting the gene encoding the protein of claim 1, and the target sequence of the gRNA is SEQ ID NO:

4. The protein is derived from rice. B1) the nucleic acid molecule is a DNA molecule whose nucleotide sequence is SEQ ID NO:

1.

10. The protein or the nucleic acid molecule of claim 4.

Citation Information

Patent Citations

  • Seed specificity highly effective promoter and its application

    CN101063139A

  • Seed specific highly effective promoter and its application

    CN101063139B

  • Recombinant DNA: transformed microorganisms, plant cells and plants: a process for introducing an inducible property in plants, and a process for producing a polypeptide or protein by means of plants or plant cells

    US5057422A

  • Plant proteins, promoters, coding sequences and use

    US5187267A