Application of ZmMYB127 gene or homologous gene thereof in regulating and controlling yield and / or quality of cereal crops

Abstract

The invention discloses an application of a ZmMYB127 gene or a homologous gene thereof in regulating and controlling the yield and / or quality of cereal crops, and discloses and verifies that the ZmMYB127 gene or the homologous gene thereof plays an important role in regulating and controlling the yield and quality of the cereal crops. Wherein the ZmMYB127 is over-expressed in corn, so that the grain weight, the grain amino acid content, the starch content, the protein content and / or the vitamin B6 content of crops can be remarkably improved. The rice grain weight is also increased by overexpressing the homologous gene OsMYB20 of the ZmMYB127 in the rice. According to the application, available genetic tools and germplasm resources can be provided for crop yield increase and nutritional quality improvement, meanwhile, a new direction is provided for cultivation of excellent germplasm resources, and the application has important significance.

Description

TECHNICAL FIELD

[0001] The present application belongs to the technical field of plant genetic engineering, and particularly relates to application of ZmMYB127 gene or a homologous gene thereof in regulating yield and / or quality of cereal crops. BACKGROUND

[0002] Maize (Zea mays L.) is one of the most widely distributed food crops, and is also an important industrial raw material and energy crop. The increase of maize yield includes three elements of ear number per unit area, kernel number per ear and kernel weight, among which, kernel weight is a direct factor determining yield and has important significance in high-yield breeding. In addition, maize kernels are mainly composed of embryo and endosperm, and the weight of endosperm accounts for about 80%-85% of the whole kernel. Kernel endosperm is the main storage organ of nutrients, and stores a large amount of carbohydrates and proteins. The development of maize endosperm involves complex and fine regulation of a large number of genes, and the transcriptional regulatory genes related to maize endosperm development such as O2, NAC128, NAC130, NKD1 and NKD2 have been reported. Further perfecting the endosperm regulatory network and obtaining new genes that can be used for genetic improvement of maize still have important significance for maintaining the sustainable development of maize production.

[0003] MYB transcription factors are the largest family of transcription factors in plants, and the members thereof are widely present in plants and are involved in various biological processes. MYB transcription factors are known for their N-terminal highly conserved MYB domain. The domain is generally composed of 1-4 segments of tandem and incomplete repeat sequences (R). According to the number of repeat units contained in the MYB domain, MYB transcription factors can be divided into R1 / R2-MYB, R2R3-MYB and R1R2R3-MYB three subgroups. It has been shown that MYB family transcription factors have multiple functions in plant growth and development, metabolic regulation and response to environmental stress.

[0004] However, the functional research and application of MYB transcription factor genes or their encoded proteins in regulating crop yield and / or nutritional quality are very limited at present. SUMMARY

[0005] Therefore, the primary purpose of the present application is to provide application of ZmMYB127 gene or a homologous gene thereof, or ZmMYB127 protein or a homologous protein thereof, or biological material containing ZmMYB127 gene or a homologous gene thereof in improving yield and / or nutritional quality of cereal crops or cultivating transgenic crops with improved yield and / or nutritional quality. By overexpressing ZmMYB127 gene or a homologous gene thereof, or ZmMYB127 protein or a homologous protein thereof in starting crops, the yield and / or nutritional quality of crops can be significantly improved, thereby providing available genetic tools and germplasm resources for crop yield increase and nutritional quality improvement.

[0006] To achieve the above objectives, this application adopts the following technical solution:

[0007] One aspect of this application provides the application of the ZmMYB127 gene or its homolog, or the ZmMYB127 protein or its homolog, or biological material containing the ZmMYB127 gene or its homolog, said biological material being an expression cassette, a recombinant expression vector, or a transgenic cell line, characterized in that the application is at least one of the following (1) or (2):

[0008] (1) Application in improving the yield and / or nutritional quality of cereal crops;

[0009] (2) Application in the development of transgenic crops that improve the yield and / or nutritional quality of cereal crops.

[0010] Another aspect of this application provides a method for improving the yield and / or nutritional quality of cereal crops, comprising:

[0011] Overexpression of the ZmMYB127 gene or its homologous gene, or the ZmMYB127 protein or its homologous protein in crops, yields transgenic crops with improved yield and / or nutritional quality compared to the starting crop.

[0012] Another aspect of this application provides a method for cultivating a genetically modified crop, said genetically modified crop having high yield and / or high nutritional quality, comprising the following steps:

[0013] Construct expression cassettes, recombinant vectors, or transgenic cell lines that overexpress the ZmMYB127 gene or its homologs, or the ZmMYB127 protein or its homologs.

[0014] The expression cassette, recombinant vector, or transgenic cell line is introduced into the target crop.

[0015] The beneficial effects of this application are:

[0016] The ZmMYB127 gene or homologous gene thereof, or the ZmMYB127 protein or homologous protein thereof provided in the application has a positive effect on regulating the yield and / or nutritional quality of cereal crops, and the grain weight and / or nutritional quality of the cereal crops can be significantly increased by overexpressing the ZmMYB127 gene or homologous gene thereof, or the ZmMYB127 protein or homologous protein. Compared with the wild-type crops, the yield, protein content and vitamin content of the crop plants overexpressing the ZmMYB127 gene or ZmMYB127 protein are significantly improved; overexpressing the homologous gene or homologous protein of ZmMYB127 in cereal crops can also achieve the same biological effect, for example, the homologous gene OsMYB20 of ZmMYB127 in rice can increase the grain weight of rice. It is shown that the ZmMYB127 gene or homologous gene thereof, or the ZmMYB127 protein or homologous protein thereof has an important role in regulating the endosperm development process, and the discovery of the function and application of the gene can provide available genetic tools and germplasm resources for crop yield increase and quality improvement. BRIEF DESCRIPTION OF DRAWINGS

[0017] Figure 1 To construct the CRISPR-Cas9 vector map for knocking out ZmMYB127 Figure 1 A) and the gene editing type of the ZmMYB127 gene knockout mutant Figure 1 B).

[0018] Figure 2 To construct the backbone vector for overexpressing ZmMYB127 Figure 2 A), the recombinant vector for overexpressing ZmMYB127 Figure 2 B) and the ZmMYB127 expression level of the overexpression line Figure 2 C); ** indicates that the difference is extremely significant in statistics.

[0019] Figure 3 For grain phenotype analysis of wild type and ZmMYB127 gene knockout materials; wherein, Figure 3 A is the grain phenotype observation of wild type and two independent knockout lines (KO1 and KO2); Figure 3 B is the statistical data of the hundred-grain weight of wild type and two independent knockout lines; Figure 3 C is the starch content detection of wild type and two independent knockout lines; ** indicates that the difference is extremely significant in statistics.

[0020] Figure 4 For phenotype analysis of wild type and ZmMYB127 overexpression lines; wherein, Figure 4 A is the stick observation of wild type and two independent overexpression lines (OE1 and OE2); Figure 4B. Grain length, grain width and grain thickness observation of wild type and two independent overexpression lines; Figure 4 C. Cross section observation of wild type and two independent overexpression lines; Figure 4 D. Figure 4 G. Statistical analysis of 100-grain weight, grain length, grain width and grain thickness of wild type and two independent overexpression lines, respectively; Figure 4 H. Field growth observation of wild type and two independent overexpression lines; Figure 4 I. Figure 4 J. Statistical analysis of plant height and ear height of wild type and two independent overexpression lines, respectively; ** indicates that the difference is extremely significant in statistics; ns indicates that the difference is not significant in statistics.

[0021] Figure 5 Storage substance content and related gene expression analysis of wild type and ZmMYB127 overexpression lines; wherein, Figure 5 A. SDS-PAGE analysis of alcohol-soluble proteins (upper) and non-alcohol-soluble proteins (lower) in seeds of wild type and overexpression lines (OE1 and OE2); Figure 5 B. Alcohol-soluble protein gene expression level analysis in seeds of wild type and overexpression lines (OE1); Figure 5 C. Semi-thin section observation of wild type and overexpression lines (OE1 and OE2) at 16DAP; Figure 5 D. Statistical analysis of aleurone layer thickness of wild type and overexpression lines (OE1 and OE2); Figure 5 E. Figure 5 H. Relative expression level analysis of NKD1, NKD2, AL9 and CE4 of wild type and overexpression lines (OE1), respectively; ** indicates that the difference is extremely significant in statistics; * indicates that the difference is significant in statistics; ns indicates that the difference is not significant in statistics.

[0022] Figure 6 Nutritional quality detection of wild type and ZmMYB127 overexpression lines; wherein, Figure 6 A. Total amino acid content detection in seeds of wild type and overexpression lines (OE1 and OE2); Figure 6 B. Figure 6 D. Total starch, total protein and vitamin B6 content analysis in seeds of wild type and overexpression lines (OE1 and OE2); ** indicates that the difference is extremely significant in statistics; ns indicates that the difference is not significant in statistics.

[0023] Figure 7 OsMYB20 overexpression vector map of rice.

[0024] Figure 8 CRISPR-Cas9 vector map of rice OsMYB20 knockout material Figure 8A) and OsMYB20 gene knockout mutant gene editing type Figure 8 B).

[0025] Figure 9 Grain phenotype analysis of wild type and OsMYB20 overexpression lines; wherein, Figure 9 A is the grain phenotype observation of wild type and two independent knockout lines (OsMYB20-1 and OsMYB20-2) under white light; Figure 9 B ~ Figure 9 C is the grain length and grain width phenotype observation of wild type and two independent knockout lines, respectively; Figure 9 D ~ Figure 9 F is the grain length, grain width and 1000-grain weight statistics of wild type and two independent knockout lines, respectively; ** indicates that the difference is extremely significant in statistics; ns indicates that the difference is not significant in statistics.

[0026] Figure 10 Grain phenotype analysis of wild type and OsMYB20 overexpression lines; wherein, Figure 10 A ~ Figure 10 B is the seed grain length phenotype observation and statistics of wild type and overexpression lines (Os-OE1 and Os-OE2), respectively; Figure 10 C ~ Figure 10 D is the seed grain width phenotype observation and statistics of wild type and overexpression lines, respectively; Figure 10 E is the 1000-grain weight statistics of wild type and overexpression lines; ** indicates that the difference is extremely significant in statistics. DETAILED DESCRIPTION

[0027] The embodiments of the present application will be clearly and completely described below. The technical solutions in the embodiments described below are exemplary, and only some possible technical implementations of the present application, not all possible implementations. Those skilled in the art can combine the embodiments of the present application without creative labor to obtain other embodiments, and these embodiments are also within the protection scope of the present application.

[0028] In this paper, sometimes for the sake of description, the protein, such as the transcription factor ZmMYB127 gene name and the name of ZmMYB127 protein are mixed, and those skilled in the art should understand that they represent different substances in different description occasions. For example, for ZmMYB127 as a gene, it refers to the gene whose nucleotide sequence is shown in SEQ ID NO. 1, and as a protein, it refers to the protein whose amino acid sequence is SEQ ID NO. 2, which is easily understood by those skilled in the art.

[0029] The skilled person in the art knows that members of MYB transcription factors are ubiquitous in plants and are involved in various biological processes. Studies have shown that MYB family transcription factors have multiple functions in plant growth and development, metabolic regulation, and response to environmental stress. However, so far, the functional research and application of MYB transcription factor genes or their encoded proteins in regulating crop yield and / or nutritional quality are very limited. The applicant has studied in the field of plant genetic loci for many years. After observing the grain phenotype of the knockout mutant of the gene, the applicant found that the expression amount and / or activity of the ZmMYB127 gene or ZmMYB127 protein described herein changed, which caused the yield and / or nutritional quality of crops to change significantly. Therefore, based on this finding, the function of the ZmMYB127 gene and its homologous genes described herein was verified, and the results showed that overexpression of the ZmMYB127 gene or protein described herein could significantly improve the grain weight and nutritional quality of crops. Overexpression of homologous genes or homologous proteins of ZmMYB127 in cereal crops can also achieve the same effect, for example, the homologous gene OsMYB20 of ZmMYB127 in rice can improve the grain weight of rice.

[0030] The first aspect of the present application discloses the application of ZmMYB127 gene or its homologous gene, or ZmMYB127 protein or its homologous protein, or biological material containing ZmMYB127 gene or its homologous gene, the biological material being an expression cassette, a recombinant expression vector or a transgenic cell line, characterized in that the application is at least one of the following (1) or (2):

[0031] (1) the application of improving the yield and / or nutritional quality of cereal crops;

[0032] (2) the application of cultivating transgenic crops with improved yield and / or nutritional quality of cereal crops.

[0033] The second aspect of the present application discloses a method for improving the yield and / or nutritional quality of cereal crops.

[0034] The third aspect of the present application discloses a method for cultivating transgenic crops with high yield and / or high nutritional quality.

[0035] The cereal crops described herein refer to plants of the family Poaceae, which are cultivated for the purpose of harvesting grains, and specific examples include corn (Zea mays L.), rice (Oryza sativa L.), wheat (Triticum aestivum L.), barley (Hordeum vulgare L.), sorghum (Sorghum bicolor (L.) Moench), or millet (Setaria italica), but are not limited thereto.

[0036] The yield described herein mainly refers to the grain weight of the crops.

[0037] The nutritional quality described herein refers to the amino acid content, starch content, protein content, and / or vitamin B6 content of the grains.

[0038] In the present application, the ZmMYB127 gene has the NCBI accession number Zm00001d041935, and has the nucleotide sequence shown in SEQ ID NO. 1. The encoded protein is the ZmMYB127 protein, and has the amino acid sequence shown in SEQ ID NO. 2. In addition, the homologous gene of ZmMYB127 refers to a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or more, or at least 99% homology with the nucleotide sequence shown in SEQ ID NO. 1, and having the function of regulating the yield and / or nutritional quality of crops, and having the same functional effect as the ZmMYB127 gene in the present application, which is also considered to be within the scope of the present application. Similarly, the homologous protein of ZmMYB127 refers to a homologous amino acid sequence having at least 50% sequence identity with the amino acid sequence shown in SEQ ID NO. 2 in cereal crops, which is also considered to be within the scope of the present application.

[0039] In the present application, "homology" has the definition generally recognized by those skilled in the art, and refers to the degree of similarity between the nucleotide sequences of two nucleic acid molecules or the amino acid sequences of two protein molecules. When there are the same bases or amino acids at the position in the compared sequences, the molecules at the position are homologous.

[0040] In the present application, "sequence identity" refers to the degree of identity of the amino acid residues of the selected sequence, and the value represents the proportion of the completely identical amino acid residues at the same position in the aligned sequences.

[0041] In the present application, the biological material containing the ZmMYB127 gene refers to an expression cassette, a recombinant vector, or a transgenic cell line overexpressing the ZmMYB127 gene or its homologous gene.

[0042] The overexpression refers to the expression amount and / or activity of the ZmMYB127 gene or its homologous gene, or the ZmMYB127 protein or its homologous protein in the cereal crops.

[0043] In the present application, the expression cassette refers to the minimum nucleotide sequence framework required for gene expression, which at least includes three key elements, i.e. the promoter, the target gene and the terminator.

[0044] In the present application, the recombinant vector refers to the effective connection of the nucleotide sequence molecule of the ZmMYB127 gene or the homologous gene to the expression vector, which can be any one of virus, plasmid, bacteriophage or artificial chromosome; preferably, the expression vector is a plasmid. In some preferred examples, the specific promoter of the ZmMYB127 gene or the homologous gene is introduced into the recombinant vector to enhance the expression effect of the ZmMYB127 gene or the homologous gene. For the ZmMYB127 gene, in one embodiment of the present application, the standard binary vector pTF102 is optimized and modified to construct pTF102-p27::MCS-3xFLAG as a backbone vector, and the recombinant vector pTF102-p27-ZmMYB127-3xFLAG is constructed based on the constructed backbone vector, wherein p27 is a 27kD prolamin gene promoter, which is specifically and efficiently expressed in the grain-filling period of endosperm, and the nucleotide sequence of p27 is SEQ ID NO. 3.

[0045] In the present application, the transgenic cell line refers to the insertion of exogenous genes into the genome of crop cells by the gene engineering technology well known in the art, and these exogenous genes can be stably expressed in the cells.

[0046] Preferably, the transgenic cell line is realized by the Agrobacterium-mediated transgenic technology well known in the art.

[0047] According to the research of the present application, the overexpression of the ZmMYB127 gene or the homologous gene thereof, or the ZmMYB127 protein or the homologous protein thereof can significantly improve the yield and / or nutritional quality of the cereal crops.

[0048] In the present application, the method for improving the yield and / or nutritional quality of crops mainly includes the following steps:

[0049] The overexpression of the ZmMYB127 gene or the homologous gene thereof, or the ZmMYB127 protein or the homologous protein thereof in the crops can obtain the transgenic crops with improved yield and / or nutritional quality compared with the starting crops.

[0050] In one embodiment of the present application, the overexpression is performed by introducing an expression cassette, a recombinant vector or a transgenic cell line into the starting crop, wherein the expression cassette, the recombinant vector or the transgenic cell line contains the ZmMYB127 gene or a homologous gene thereof, or the ZmMYB127 protein or a homologous protein thereof.

[0051] Preferably, the expression cassette or the recombinant vector further contains an endosperm-specific strong promoter which can enhance the expression of the ZmMYB127 gene or a homologous gene thereof; in some examples, the promoter is p27 with the nucleotide sequence as shown in SEQ ID NO. 3; in other examples, the promoter is GluB-4 with the nucleotide sequence as shown in SEQ ID NO. 5.

[0052] In the present application, the main steps of the method for breeding the transgenic crop include:

[0053] constructing an expression cassette, a recombinant vector or a transgenic cell line which overexpresses the ZmMYB127 gene or a homologous gene thereof, or the ZmMYB127 protein or a homologous protein thereof;

[0054] introducing the expression cassette, the recombinant vector or the transgenic cell line into the target crop, thereby obtaining the transgenic crop with high yield and / or high nutritional quality.

[0055] In the present application, the transgenic crop has at least one of the following characteristics compared with the starting crop:

[0056] a: the expression amount and / or activity of the ZmMYB127 gene or a homologous gene thereof, or the ZmMYB127 protein or a homologous protein thereof is increased;

[0057] b: the grain weight is increased;

[0058] c: the content of amino acid, the content of starch, the content of protein and / or the content of vitamin B6 in the grain is increased.

[0059] The following are specific examples of the present application, and it should be noted that the following specific examples are only for illustrative purposes, and do not limit the scope of the present application in any way.

[0060] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. The terminology used in the description herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the application.

[0061] In addition, unless otherwise specified, the methods without specifically recorded conditions or steps are conventional methods, and the reagents and materials used are commercially available.

[0062] Obtaining of ZmMYB127 gene knockout and overexpression plants of Example 1

[0063] In this example, ZmMYB127 gene knockout material and ZmMYB127 gene overexpression plants were first constructed for subsequent verification of the function of ZmMYB127 gene.

[0064] The ZmMYB127 gene knockout mutant material used in this application was first designed by designing a CRISPR-CAS9 vector for ZmMYB127 gene and transforming the maize HiII AXB inbred line, then the obtained transgenic plants were backcrossed to the B73 inbred line three times, and the obtained genetic material was obtained by selfing and separation. The ZmMYB127 gene overexpression plant was obtained by constructing a recombinant vector and then transforming the maize embryo mediated by Agrobacterium, and then transforming the maize inbred line B104.

[0065] Among them, the sequence information of each primer involved in this example is shown in Table 1:

[0066] Table 1 Primer sequence information involved in Example 1

[0067]

[0068] 1.1, Obtaining of ZmMYB127 gene knockout plants

[0069] The knockout sequence was designed using the online website http: / / skl.scau.edu.cn / , and the target sequence was named gRNA1 (see Table 1). The primers U6F1+U6R1 and primers UMYB127F+U6R2 in Table 1 were used for PCR amplification, respectively, and after recovering the two fragments, the two fragments were homologously recombined into the CRISPR / Cas9 vector using SmaI and PstI sites. The vector uses the CRISPR / Cas9 vector system described in the article published by Ma et al. in 2016 (see Ma X, Liu YG. CRISPR / Cas9-based multiplex genome editing in monocot and dicot plants [J]. Current protocols in molecular biology, 2016, 115(1): 31.6.1-31.6.21.). The vector map used in this example is shown in Figure 1 A.

[0070] The vector was sequenced and verified, and the plasmid with correct sequencing was selected to transform the EHA105 strain. The constructed vector was transformed into the maize High II B X A inbred line embryo by Agrobacterium-mediated method, and then the obtained transgenic plants were backcrossed to the B73 inbred line three times, and then self-crossed to obtain homozygous materials.

[0071] Through sequencing analysis, the two types of knockout materials obtained were named KO1 (G deletion at position 158 after the start codon) and KO2 (7bp deletion at positions 154-160 after the start codon) Figure 1 B).

[0072] 1.2, obtaining of ZmMYB127 gene overexpression plant

[0073] 1.2.1 Construction of recombinant vector for overexpression of ZmMYB127 gene

[0074] In this embodiment, the standard binary vector pTF102 was used as a basis for optimization and modification. Specifically, the maize endosperm-specific strong promoter p27 (nucleotide sequence SEQ ID NO. 3) for enhancing the expression of ZmMYB127 gene or ZmMYB127 protein was inserted into the pTF102 vector, and a 3xFLAG tag was inserted, to construct the backbone vector pTF102-p27::MCS-3xFLAG (vector map see Figure 2 A).

[0075] The full-length CDS sequence of ZmMYB127 gene was cloned into the above-mentioned backbone vector pTF102-p27::MCS-3xFLAG, wherein the cloning gene primers used were MYB127F and MYB127R in Table 1, to obtain a recombinant vector for overexpression of ZmMYB127 gene (plasmid map see Figure 2 B).

[0076] 1.2.2 Obtaining of ZmMYB127 gene overexpression plant

[0077] The above-mentioned recombinant vector was transformed into Agrobacterium EHA105, and Agrobacterium-mediated method was used to transform maize embryo, and then maize inbred line B104 was transformed to obtain ZmMYB127 gene overexpression plant, and two parallel lines were recorded as OE1 and OE2.

[0078] 1.2.3 Quantitative detection of ZmMYB127 gene in ZmMYB127 gene overexpression plant

[0079] After pollination of the offspring homozygous plants, 16DAP grain was quickly frozen in liquid nitrogen, and RNA was extracted, wherein the RNA extraction steps were as follows:

[0080] (1) After grinding sufficiently, 100 mg of the tissue was taken into a 2 mL centrifuge tube, 500 μL of RNA extraction buffer (50 mM TRIS pH 8.0, 150 mM LiCI, 5 mM EDTA pH 8.0, 1% SDS) was added, and mixed.

[0081] (2) 500 μL of 1:1 phenol-chloroform was added, and mixed. Centrifugation was performed at 10000 g at 4°C for 10 min, and 300 μL of supernatant was taken into a new tube.

[0082] (3) 300 μL of chloroform was added, and mixed. Centrifugation was performed at 10000 g at 4°C for 10 min.

[0083] (4) 200 μL of supernatant was taken into a new tube, and 1 mL of TRIZOL was added. Shaking was performed for 15 seconds, and incubation was performed at room temperature for 5 min.

[0084] (5) 200 μL of chloroform was added, shaking was performed at room temperature for 2-3 min, and centrifugation was performed at 10000 g at 4°C for 10 min.

[0085] (6) 700 μL of supernatant was taken into a new tube. 500 μL of isopropanol was added, mixed, and incubation was performed at -20°C for 10 min.

[0086] (7) Centrifugation was performed at 10000 g at 4°C for 10 min. The supernatant was poured out, and 500 μL of 70% ethanol (DEPC-treated water) was added.

[0087] (8) Centrifugation was performed at 10000 g at 4°C for 10 min. The supernatant was poured out, and the RNA pellet was air-dried. 50 μL of DEPC-treated water was added, and the pellet was dissolved.

[0088] The extracted RNA was reverse transcribed into cDNA using a HiScript III 1st Strand cDNA Synthesis Kit (+gDNA wiper) kit from vazyme company, according to the kit operation method. ZmMYB127 gene-specific primers qMYB127F and qMYB127R (see Table 1) were designed, and Actin was used as an internal reference gene (primers were ActinF and ActinR) (see Table 1), to detect the expression level of ZmMYB127 gene in wild type and overexpression material 16DAP seeds, wherein the quantitative reaction conditions were: pre-denaturation 95°C, 30 s; amplification 95°C, 5 s; 60°C, 30 s; 95°C to 60°C for 40 cycles; termination 95°C, 15 s; 60°C, 60 s; 95°C, 15 s. EXCELL 2010 and △△CT method were used to analyze the quantitative data.

[0089] By quantitative analysis, it was found that the expression level of ZmMYB127 gene in two overexpression lines OE1 and OE2 was significantly higher than that in wild type ( Figure 2 C).

[0090] Example 2 Phenotype analysis of ZmMYB127 gene knockout and overexpression plants

[0091] 2.1 Phenotype analysis of ZmMYB127 gene knockout plants

[0092] Phenotype observation was performed on the homozygous knockout material obtained in Example 1, and it was found that the mutant endosperm of the kernel developed defects, the mature kernel became small, and presented powderization, showing opaque endosperm ( Figure 3 A). Compared with the wild type, the kernel hundred-grain weight of the two mutant lines decreased ( Figure 3 B), and the starch content was further reduced ( Figure 3 C).

[0093] Among them, the hundred-grain weight statistical method is to select three independent rods, and randomly select 100 seeds from each rod, and weigh the weight. The starch content of the kernel is determined by using the total starch kit (K-TSTA-100A) of Megazyme brand.

[0094] 2.2 Phenotype analysis of ZmMYB127 gene overexpression plants

[0095] In the overexpression lines in Example 1, the observation of the homozygous material of the offspring found that the kernels of the overexpression transgenic lines (OE1 and OE2) were larger than the wild type ( Figure 4 A- Figure 4 C). The statistical results of the hundred-grain weight showed that the kernel weight of the overexpression lines was significantly increased compared with the wild type ( Figure 4 D). When measuring the kernel size index, we found that the kernel length of the seeds of the overexpression lines decreased ( Figure 4 E), and the kernel width and kernel thickness were significantly increased ( Figure 4 F and Figure 4 G).

[0096] Further, in order to investigate whether the overexpression of ZmMYB127 gene affects the plant type of corn, the wild type and the overexpression lines were planted in the field, and the results showed that the plant height and ear height of the two independent overexpression lines were not different compared with the wild type ( Figure 4 H- Figure 4 J), indicating that the overexpression of ZmMYB127 does not affect the plant type of corn, and it can be improved in the future to improve the yield of corn.

[0097] Example 3 Analysis of kernel nutritional value of ZmMYB127 gene overexpression plants

[0098] The endosperm accounts for about 80-85% of the total kernel weight and is the main storage tissue of maize. The fully developed endosperm accumulates large amounts of starch and storage proteins, of which the major protein, prolamin, comprises four families: a (19 and 22 kDa), b (15 kDa), g (50, 27 and 16 kDa) and d (18 and 10 kDa). In this example, the maize kernel prolamin and non-prolamin proteins were detected and analyzed. In addition, the aleurone layer of the kernel and the total amino acid content, total starch, total protein content and vitamin B6 were further analyzed. The nutritional value of the kernel of the ZmMYB127 gene overexpression plant was comprehensively analyzed.

[0099] Table 2 primer information involved in Example 3

[0100] Sequence name Primer sequence (5'→3') 10kD-qF AGATGATGACGCCTAACA 10kD-qR ATGAATGGTAACTGCTG 15kD-qF CTACCGCACCAACCCCTG 15kD-qR TCAAGCGGCCGATAGATTC 16kD-qF CGGCGGTGTCTACTACTGAG 16kD-qR GGTTCATTCAGGTCATTGCTC 18kD-qF TGATGCCGAGCATGGTG 18kD-qR TTCCTAAACAATGAGTCGCA 19z1AF GCTCCTTGGTCTTTCTGCAA 19z1AR GGTAACTGCTGTAATAGGGCTGATG 19z1BF CCAGCCCTATCTTTGGTGCA 19z1BR TCAGTGCGGCCAATTGGTTA 19z1DF GCACAACAACTACAACAACA 19z1DR AATGGTAGTAGCTGTTGTGC 22kD-qF TTCCACAATGCTCACTTGCT 22kD-qR GTTGTTGTAAGACGCTCGCC 27kD-qF TGCCTACAGCCGTCTCG 27kD-qR GAGGGCAACGAGCAACAC 50kD-qF CAACAACAGCACCAACAACAA 50kD-qR TTGCTGTTGTGATTTTTCCTG NKD1qF GCAGGGTCCGCCGTCGTC NKD1qR TGTTGCCCTGCAGGAACGA NKD2qF CAGCGCAGCCTCCGTCCT NKD2qR TGGCCTGCAGCTGAAGGAA AL9qF GATGGAGACTGTGAGAATGACCTC AL9qR CAGTTTCTTTGGTGACCTTGGAG CR4qF CCTCTGCGCACTGAGAGCTG CR4qR GAGCAAACAAGCCACAATTGAACA

[0101] 3.1, Detection of kernel prolamin and non-prolamin proteins of ZmMYB127 gene overexpression plant

[0102] First, the overexpression of kernel prolamin and non-prolamin proteins was extracted, and the specific method was as follows:

[0103] (1) Take dry seeds and grind directly, weigh 100 mg in a 2 mL centrifuge tube;

[0104] (2) Add 1 mL of maize prolamin extraction solution (70% ethanol, 2% 2-mercaptoethanol, 3.75 mM sodium borate (pH 10), 0.3% SDS);

[0105] (3) Place at room temperature (25°C) for more than 2 hours or overnight, or in a 28°C incubator;

[0106] (4) After 2 hours or overnight incubation, shake the sample on a tissue grinder at a frequency of 60 hz for 60 s, then place it on the workbench for 20 min;

[0107] (5) Centrifuge at 13000 rpm for 15 min, transfer 100 μL of supernatant to a new 2 mL tube, and add 10 μL of 10% SDS;

[0108] (6) Vacuum dry for more than 60 min until all the liquid evaporates, and after drying, dissolve with 100 μL of pure water to obtain the prolamin protein;

[0109] (7) Suck dry the supernatant of the above step 5, and leave the precipitate;

[0110] (8) Repeat the extraction of maize prolamin 3 times, and discard the supernatant;

[0111] (9) Vacuumize to dry the precipitate, add 1 mL of corn non-alcohol soluble protein extraction buffer (12.5 mM sodium borate, 5% SDS, 2% 2-mercaptoethanol), mix well and stand for 2 hours;

[0112] (10) Centrifuge at 13000 rpm for 15 minutes, and transfer the supernatant to a new tube to obtain the non-alcohol soluble protein.

[0113] Take 5 μL of the alcohol soluble protein and non-alcohol soluble protein solution for SDS-PAGE gel electrophoresis analysis. The lower gel formula for the alcohol soluble protein is: 2.25 mL of pure water, 2.5 mL of 1.5 M Tris-Hcl (pH 8.8), 5 mL of 37.5:1 acrylamide / methylene bisacrylamide, 100 μL of 10% SDS, 100 μL of 10% APS, and 6 μL of TEMED. The lower gel formula for the non-alcohol soluble protein is: 4.1 mL of pure water, 2.5 mL of 1.5 M Tris-Hcl (pH 8.8), 3.33 mL of 37.5:1 acrylamide / methylene bisacrylamide, 100 μL of 10% SDS, 100 μL of 10% APS, and 6 μL of TEMED. The upper gel formula is: 6.1 mL of pure water, 2.5 mL of 1.5 M Tris-Hcl (pH 6.8), 1.35 mL of 37.5:1 acrylamide / methylene bisacrylamide, 100 μL of 10% SDS, 100 μL of 10% APS, and 6 μL of TEMED. After running the gel, use Coomassie brilliant blue staining solution (0.25 g of Coomassie brilliant blue R250, 45 mL of methanol, 10 mL of glacial acetic acid, and 45 mL of pure water) for staining, and then use the decolorizing solution (15 mL of methanol, 15 mL of glacial acetic acid, and 470 mL of pure water) for destaining. Analyze the staining results.

[0114] The results show that, compared with the wild type, the overexpression of part of the alcohol soluble protein and non-alcohol soluble protein in the grain increases the content of the alcohol soluble protein and non-alcohol soluble protein in the grain Figure 5 A). Quantitative detection of the alcohol soluble protein gene shows that the expression of δ10, β15, γ16 and δ18 in the grain is significantly increased Figure 5 B), wherein the quantitative primers are 10kD-qF and 10kD-qR; 15kD-qF and 15kD-qR; 16kD-qF and 16kD-qR; 18kD-qF and 18kD-qR; 19z1AF and 19z1AR; 19z1BF and 19z1BR; 19z1DF and 19z1DR; 22kD-qF and 22kD-qR; 27kD-qF and 27kD-qR; 50kD-qF and 50kD-qR in Table 2.

[0115] 3.2, Analysis of the endosperm structure of the ZmMYB127 gene overexpression plant

[0116] The aleurone layer structure of the grain overexpression plants was observed using semi-thin sections, and the specific method was as follows:

[0117] The central part of the 16DAP grain was cut with a blade and fixed in FAA fixing solution (50 mL of anhydrous ethanol, 5 mL of glacial acetic acid, 10 mL of 37% formaldehyde, and 35 mL of pure water), and vacuum treatment was performed to allow the fixing solution to penetrate into the tissue. 30%, 50%, 70%, 80%, 95%, and 100% ethanol were used in sequence for dehydration for 20 minutes, during which the centrifuge tube was inverted several times and slowly shaken. Then, 100% acetone was used for washing three times, each for 30 minutes. Subsequently, 25% Epon resin (solvent: acetone), 50% Epon resin, 75% Epon resin, and 100% Epon resin were used for slow shaking, each for 24 hours. After the penetration was completed, the sample was placed on an embedding plate and placed in an oven at 60°C for 48 hours. The embedded sample was sectioned using a microtome, and toluidine blue was used for staining and observation.

[0118] It was found that the aleurone layer of OE1 and OE2 was increased by 1-2 layers, and the thickness of the aleurone layer was also significantly increased compared with the wild type. Figure 5 C and Figure 5 D). Quantitative detection of the genes regulating the aleurone layer showed that the expression levels of NKD1, NKD2, and AL9 of OE1 were significantly increased, and the expression level of CR4 was significantly down-regulated compared with the wild type Figure 5 E- Figure 5 H), indicating that increasing the expression level of ZmMYB127 can affect the development of the aleurone layer. The quantitative primers are NKD1qF and NKD1qR; NKD2qF and NKD2qR; AL9qF and AL9qR; CR4qF and CR4qR in Table 2.

[0119] 3.3, Detection of the total amino acid content of the grain of the ZmMYB127 gene overexpression plant

[0120] The specific method was as follows:

[0121] The grain was ground into powder, and 0.5 g was weighed and added with 0.01 M hydrochloric acid for ultrasonic treatment for 30 minutes, and centrifuged at 12000 rpm for 15 minutes, and the supernatant was taken as the amino acid extraction solution. The extraction solution was added with 6 M hydrochloric acid, and hydrolyzed at 110°C for 24 hours in a nitrogen environment. After hydrolysis, the hydrochloric acid was removed by rotary evaporation, and the residue was dissolved with distilled water. The product was passed through high performance liquid chromatography (HPLC) to detect the total amino acid content.

[0122] The results show that the total amino acid content of OE1 and OE2 is significantly increased compared with the wild type, and the contents of human essential amino acids valine (Val), lysine (Lys), threonine (Thr), methionine (Met), isoleucine (Ile) and leucine (Leu) are also significantly increased Figure 6 A).

[0123] 3.4, Detection of total starch, total protein content and vitamin B6 of ZmMYB127 overexpression plant seeds

[0124] The total protein content was detected using Thermo Scientific product kit (23225, 23215) according to the instructions. The pretreatment step of vitamin B6 is the same as that of total amino acid, and then the product is subjected to high performance liquid chromatography (HPLC) to detect the content of vitamin B6.

[0125] The results show that the total starch, total protein content and vitamin B6 content of the overexpression strain are also significantly increased Figure 6 B- Figure 6 D), indicating that increasing the expression level or protein level of ZmMYB127 can improve the nutritional quality of the grain.

[0126] Example 4 Effect of ZmMYB127 rice homologous gene

[0127] In this embodiment, the amino acid sequence of ZmMYB127 gene of corn is searched in NCBI database, and it is found that the protein sequence of rice gene numbered Os01g0977300 (LOC_Os01g74590) has the highest sequence similarity with ZmMYB127 (sequence identity is 52%), which is named as OsMYB20, and its amino acid sequence is shown as SEQ ID NO. 4. Corresponding research is carried out to determine whether the homologous gene of ZmMYB127 has the same biological effect as ZmMYB127.

[0128] Table 3 Primer information involved in Example 4

[0129]

[0130]

[0131] 4.1, Construction of overexpression OsMYB20 recombinant vector

[0132] GluB-4 (nucleotide sequence as shown in SEQ ID NO. 5) as a strong endosperm-specific promoter, GluB-4 and the CDS sequence of OsMYB20 (SEQ ID NO. 6) were constructed into pCAMBIA2300 vector (VT1383, Yibio) to obtain a recombinant vector overexpressing OsMYB20.

[0133] The specific method is as follows:

[0134] Primers pGluBF and pGluBR (see Table 3) were designed for amplifying GluB-4; primers OSMYB20F1 and OSMYB20R1 (see Table 3) were designed for amplifying the CDS sequence of OsMYB20; primers NOSF and NOSR (see Table 3) were designed for amplifying the NOS fragment. The above fragments and the vector were recombined and connected using a recombinase after linearizing the pCAMBIA2300 vector with BamH I and Kpn I, and the correct plasmid was obtained after sequencing. The map of the recombinant vector overexpressing OsMYB20 is shown in Figure 7 .

[0135] 4.2, Obtaining of OsMYB20 overexpression plants

[0136] The constructed vector was sent to a company for genetic transformation, and the transformation background was Zhonghua 11. The obtained seeds were screened on kanamycin-resistant plates, and finally homozygous overexpression transgenic plants were obtained, and two parallel overexpression lines were recorded as Os-OE1 and Os-OE2, respectively.

[0137] 4.3, Obtaining of OsMYB20 knockout material

[0138] The Os01g0977300 gene was edited using CRISPR-Cas9 technology, and two specific single gRNA target points (gRNA-OsMYB20-1 and gRNA-OsMYB20-2, primer information is shown in Table 3) of the gene were used to connect the two primers to the rice CRISPR-Cas9 vector (vector system is the same as in Example 1), and the correct recombinant vector was obtained by sequencing (the map is shown in Figure 8 A).

[0139] The recombinant vector was transformed into EHA105 Agrobacterium, and then transfected into Zhonghua 11 callus, and positive seedlings were screened in T0 generation and T1 generation seeds were obtained. Two independent homozygous knockout lines osmyb20-1 (deletion of 23 bases) and osmyb20-2 (deletion of 92 bases) were obtained by sequencing identification Figure 8 B).

[0140] T1 generation seeds were planted, and it was found that compared with wild type, the two mutant knockout lines showed a certain chalkinessFigure 9 A), which had no significant difference in grain length and grain width Figure 9 B- Figure 9 E), but the thousand-grain weight decreased Figure 9 F).

[0141] In the overexpression lines, the grain length, grain width and thousand-grain weight were all significantly increased compared with the wild type Figure 10 A- Figure 10 E).

[0142] The above results show that the expression level of overexpression of OsMYB20 can increase the grain weight of rice and improve crop yield.

[0143] The above examples show that ZmMYB127 and its homologous genes have the function of regulating crop yield and / or nutritional quality.

[0144] Each technical feature of the above-described embodiments can be combined arbitrarily, and to make the description simple, all possible combinations of each technical feature in the above-described embodiments are not described, however, as long as the combinations of the technical features do not exist contradictory, it should be considered as the scope of the present disclosure.

[0145] The above-described embodiments only express several embodiments of the present application, and the description is more specific and detailed, but it should not be understood as limiting the scope of the patent application. It should be noted that for ordinary skilled in the art, without departing from the concept of the present application, a number of variations and improvements can be made, which are all within the scope of the present application. Therefore, the scope of the patent of the present application should be subject to the appended claims.

Claims

1. Application of ZmMYB127 gene or its homologous gene, or ZmMYB127 protein or its homologous protein, or biological material containing ZmMYB127 gene or its homologous gene, the biological material being one of expression cassette, recombinant expression vector or transgenic cell line, characterized in that, The application is at least one of the following (1) or (2): (1) increasing yield and / or nutritional quality of cereal crops; (2) cultivating transgenic crops with increased yield and / or nutritional quality of cereal crops; Preferably, the ZmMYB127 gene has a nucleotide sequence as shown in SEQ ID NO. 1; Preferably, the homologous gene of ZmMYB127 has a nucleotide sequence with at least 80% or more, at least 85% or more, at least 90% or more, at least 95% or more, at least 98% or more, or at least 99% or more homology with the nucleotide sequence shown in SEQ ID NO. 1 and has the same biological function; Preferably, the ZmMYB127 protein has an amino acid sequence as shown in SEQ ID NO. 2; Preferably, the homologous protein of ZmMYB127 is a homologous amino acid sequence with at least 50% or more sequence identity with the amino acid sequence shown in SEQ ID NO. 2 in cereal crops; Preferably, the homologous protein of ZmMYB127 is from rice, and its amino acid sequence is shown in SEQ ID NO.

4.

2. Use according to claim 1, wherein The application is to increase the expression amount and / or activity of ZmMYB127 gene or its homologous gene, or ZmMYB127 protein or its homologous protein.

3. The use according to claim 1, wherein The cereal crops include corn, rice, wheat, barley, sorghum or millet.

4. The use according to claim 1, wherein The yield refers to kernel weight.

5. The use according to claim 1, wherein The nutritional quality includes kernel amino acid content, starch content, protein content and / or vitamin B6 content.

6. A method for increasing yield and / or nutritional quality of a cereal crop, characterized in that, The application includes: Overexpressing ZmMYB127 gene or its homologous gene, or ZmMYB127 protein or its homologous protein in crops to obtain transgenic crops with increased yield and / or nutritional quality compared with the starting crops.

7. The method of claim 6, wherein, The ZmMYB127 gene has a nucleotide sequence as shown in SEQ ID NO. 1; The homologous gene of ZmMYB127 has a nucleotide sequence with at least 80% or more, at least 85% or more, at least 90% or more, at least 95% or more, at least 98% or more, or at least 99% or more homology with the nucleotide sequence shown in SEQ ID NO. 1 and has the same biological function; The ZmMYB127 protein has an amino acid sequence as shown in SEQ ID NO. 2; The homologous protein of ZmMYB127 is a homologous amino acid sequence with at least 50% or more sequence identity with the amino acid sequence shown in SEQ ID NO. 2 in cereal crops.

8. The method of claim 6, wherein, The overexpression is performed by introducing a biological material into the starting crops, and the biological material is one of an expression cassette, a recombinant expression vector or a transgenic cell line, and the biological material contains the ZmMYB127 gene or its homologous gene.

9. The method of claim 8, wherein, The biological material is an expression cassette or a recombinant expression vector; Preferably, the expression cassette or the recombinant expression vector further contains a specific strong promoter that enhances the expression of the ZmMYB127 gene or its homologous gene, or ZmMYB127 protein or its homologous protein. Preferably, the specific strong promoter is a maize specific strong promoter, and the maize specific strong promoter is a maize endosperm specific strong promoter p27, and the nucleotide sequence of the maize endosperm specific strong promoter p27 is shown as SEQ ID NO.

3.

10. A method of breeding a transgenic crop plant having high yield and / or high nutritional quality, characterized in that, The method comprises the following steps: constructing an expression cassette, a recombinant vector or a transgenic cell line overexpressing a ZmMYB127 gene or a homologous gene thereof, or a ZmMYB127 protein or a homologous protein thereof; introducing the expression cassette, the recombinant vector or the transgenic cell line into a starting target crop; the ZmMYB127 gene has a nucleotide sequence shown as SEQ ID NO. 1; the homologous gene of the ZmMYB127 has a nucleotide sequence having at least 80% or more, at least 85% or more, at least 90% or more, at least 95% or more, at least 98% or more, or at least 99% or more homology with the nucleotide sequence shown as SEQ ID NO. 1 and has the same biological function; the ZmMYB127 protein has an amino acid sequence shown as SEQ ID NO. 2; the homologous protein of the ZmMYB127 is a homologous amino acid sequence having at least 50% or more sequence identity with the amino acid sequence shown as SEQ ID NO. 2 in cereals; Preferably, the transgenic crop has at least one of the following characteristics compared with the starting crop: a: the expression amount and / or activity of the ZmMYB127 gene or the homologous gene thereof, the ZmMYB127 protein or the homologous protein thereof is increased; b: the grain weight is increased; c: the amino acid content, the starch content, the protein content and / or the vitamin B6 content of the grain is increased.

Images