Construction method of zebrafish model with Sec24b gene knockout
The Sec24b gene knockout model was constructed in zebrafish using CRISPR/Cas9 technology, which solved the problems of short timeliness and cytotoxicity in traditional gene interference techniques. It achieved stable gene knockout and stable inheritance of mutants, supporting long-term biological research, especially the study of skeletal developmental diseases.
Patent Information
- Application Number
- CN202511880873.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-14
- Publication Date
- 2026-01-20
AI Technical Summary
Traditional gene interference techniques, such as morpholino antisense oligonucleotides, have short duration of action, significant off-target effects, and non-specific cytotoxicity in zebrafish, resulting in reduced embryo survival rate, poor phenotypic reproducibility, and the inability to obtain stably heritable mutant individuals, thus limiting their application in long-term biological effect studies.
Using CRISPR/Cas9 technology, a nucleic acid-protein complex was formed by designing target site gRNA and Cas9 protein to specifically recognize and cleave genomic target sites, introduce insertion/deletion mutations, and use the non-homologous end joining (NHEJ) repair pathway to achieve permanent knockout of the Sec24b gene, thus constructing a stable hereditary zebrafish model.
This study achieved efficient and stable knockout of the Sec24b gene, avoiding off-target effects and cytotoxicity, ensuring the stable inheritance and survival of the mutant, and supporting long-term biological research, especially research on skeletal developmental diseases.
Smart Images

Figure CN121362796A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The application belongs to the technical field of biological medicine, and particularly relates to a method for constructing a Sec24b gene knockout zebrafish model. BACKGROUND
[0002] Zebrafish (Danio rerio) as a representative of vertebrate model organisms has been widely used in the research fields of developmental biology, molecular genetics and human disease pathogenesis due to its advantages such as transparent embryos, in vitro development, short growth cycle and high reproductive capacity. In particular, it has shown irreplaceable research value in the regulation of skeletal development, neurological diseases and pathological mechanism analysis of cardiovascular diseases.
[0003] In gene function research, constructing a specific gene mutation model is a core means to clarify the biological function of the gene. Sec24b gene is a highly conserved and ubiquitous gene in vertebrates. By comparing the Sec24b protein sequence of zebrafish with that of humans, it is found that the similarity is 77% (Wang Qingqing, Function of Sec24b gene in zebrafish embryonic development and its correlation with human neural tube defects, Master's thesis of Shaanxi Normal University, 2013). Therefore, the construction of Sec24b gene knockout zebrafish model has important significance in the study of gene biological function.
[0004] Traditional gene interference techniques such as morpholino antisense oligonucleotide (Morpholino, MO) technology can achieve temporary inhibition of gene function, but this technology has inherent defects such as short action time, significant off-target effect and non-specific cytotoxicity, often leading to low embryo survival rate, poor phenotype repeatability, and inability to obtain stable heritable mutant individuals, which greatly limits its application in long-term biological effect research. SUMMARY
[0005] In order to solve the problems in the prior art, the application provides a method for constructing a Sec24b gene knockout zebrafish model, a nucleic acid protein complex is formed by a guide RNA (gRNA) and a Cas9 protein, a target genomic site is specifically recognized and cut, a double-strand break (DSB) is induced, an insertion / deletion (indel) mutation is introduced through a non-homologous end joining (NHEJ) repair pathway in the cell, and permanent knockout of the target gene is finally realized. The application uses a high-efficiency, stable and heritable CRISPR / Cas9 technology-mediated zebrafish gene knockout method, which is of great significance for studying the functions of related genes in development and diseases.
[0006] The application adopts the following technical scheme: The application provides a method for constructing a Sec24b gene knockout zebrafish model, characterized in that: Sec24b a target site gRNA is designed according to a gene sequence, the gRNA is transcribed in vitro, the gRNA and a Cas9 protein are mixed and injected into single-cell-stage zebrafish embryos to obtain F0 generation embryos, and stable genetic Sec24b gene deletion zebrafish are obtained through screening, identification and subculture. The target site gRNA sequence is selected from T1, T2 or T3, wherein the T1 sequence is GGGTTACGGCAACCCGCAGT (SEQ ID NO: 1); the T2 sequence is GTACTCCACCTCCAATGCCC (SEQ ID NO: 2); and the T3 sequence is GGGGCGCCTCCCACGTCAA (SEQ ID NO: 3).
[0007] According to an embodiment of the application, preferably, the target site gRNA sequence is selected from the T2 sequence GTACTCCACCTCCAATGCCC (SEQ ID NO: 2).
[0008] According to one embodiment of the present application, the gRNA is synthesized by a method of in vitro transcription using PCR product as template, a T7 promoter sequence as shown in SEQ ID NO: 4: 5' TAATACGACTCACTATA 3' is added in front of the designed target site to recognize the base GG, or a SP6 promoter sequence as shown in SEQ ID NO: 5: 5' ATTTAGGTGACACTATA 3' is added in front of the designed target site to recognize the base GA; and a backbone sequence as shown in SEQ ID NO: 6: 5' GTTTTAGAGCTAGAAATAGC 3' is added at the tail of the target site to constitute the forward primer of the PCR reaction.
[0009] In an embodiment of the present application, the primer identified by screening the F0 generation embryo is P1, P2 or P3, wherein The sequence of the P1 primer (5'→3') is Forward Primer: GACTCACAACTGGTGACAGC (SEQ ID NO: 7), Reverse Primer: CGCACATTCAGACTCACACC (SEQ ID NO: 8); The sequence of the P2 primer (5'→3') is Forward Primer: CAGGTCCAGGACAGGCGTAC (SEQ ID NO: 9), Reverse Primer: CTGAGAGGATCTCAGCGTGC (SEQ ID NO: 10); The sequence of the P3 primer (5'→3') is Forward Primer: GCACCAGCATTATCGACACC (SEQ ID NO: 11), Reverse Primer: GATGAATGCACAGAGGCGCC (SEQ ID NO: 12).
[0010] According to one embodiment of the present application, the passage is that the F0 generation chimeric mutant is crossed with wild type to obtain the F1 generation hybrid mutant by screening, the F1 generation hybrid mutant obtained after screening is self-crossed to obtain the F2 generation homozygous mutant, and the F2 generation homozygous mutant is self-crossed to obtain the Sec24b gene knockout zebrafish.
[0011] According to one embodiment of the present application, the method for obtaining the F1 generation hybrid mutant by crossing the F0 generation chimeric mutant with wild type fish is as follows: the F0 generation chimeric mutant is raised to sexual maturity, the tail fin is cut to screen the F0 generation chimeric mutant, the mutant chimeric mutant obtained by screening is crossed with wild type adult fish to obtain the F1 generation, which is raised to sexual maturity, and the tail fin is cut to screen the F1 generation hybrid mutant with 17 bp insertion by next generation sequencing.
[0012] According to one embodiment of the present application, the method for obtaining the F2 generation homozygous mutant by self-crossing the screened F1 generation hybrid mutant is as follows: the F1 generation hybrid mutant is self-crossed to obtain the F2 generation. After the adult fish is obtained, next generation sequencing and gel electrophoresis are used for identification. The homozygous mutant with stable heredity and 17 bp insertion is successfully obtained, which leads to the premature stop codon of the encoded protein at the 173th amino acid.
[0013] According to one embodiment of the present application, the F1 generation hybrid mutant is self-crossed to obtain the F2 generation, and next generation sequencing and gel electrophoresis are used for identification after the adult fish is obtained. The primer sequence for gel electrophoresis identification is as follows: Forward Primer: GCAGCACCAGGATCACAGAC (SEQ ID NO: 13), Reverse Primer: CCATGTGAGGGCTGACTATACGG (SEQ ID NO: 14).
[0014] According to one embodiment of the present application, the method for obtaining the Sec24b gene knockout zebrafish is as follows: the F2 generation homozygous mutant is self-crossed to obtain the Sec24b gene knockout zebrafish larvae, and the growth and development process is observed. Compared with the wild type zebrafish, the mutant shows abnormal notochord development, body axis bending, and discontinuous change of local notochord at 3 days after fertilization, and the body length is slightly shortened. Beneficial effects
[0015] The present application provides a method for constructing a Sec24b gene knockout zebrafish model. Sec24b According to the present application, a plurality of target sites are designed based on the gene sequence, gRNA is transcribed in vitro, the gRNA and Cas9 protein are mixed and injected into single-cell stage zebrafish embryos to obtain F0 generation embryos, and a series of screening, identification and subculture are performed to finally obtain the stable heredity Sec24b gene deletion zebrafish. Compared with the traditional method, the present application has the advantages of higher knockout efficiency, less off-targeting, and less embryonic toxicity. The Sec24b gene knockout zebrafish constructed by the present application can be stably inherited and can be used for the research of skeletal development diseases. BRIEF DESCRIPTION OF DRAWINGS
[0016] Figure 1 is the sequencing graph of the F0 generation chimeric mutation map after microinjection of gRNA; Figure 2 is the sequencing graph of the F1 generation heterozygous mutant obtained by one generation sequencing screening after crossbreeding of the chimeric mutant and wild type zebrafish; Figure 3 is the sequencing graph and gel electrophoresis graph of the F2 generation homozygous mutant, and finally the homozygous mutant with 17 bp insertion is obtained; Figure 4 is the protein domain and mutant sequence truncation schematic diagram: after 17 bp insertion, the encoded protein prematurely appears a stop codon at the 173th amino acid, resulting in a truncated protein; Figure 5 is the general picture of 3 dpf larvae after self-crossing of the homozygous mutant: the notochord bends dorsally and the notochord discontinuity-like change phenomenon appears. DETAILED DESCRIPTION
[0017] In order to further illustrate the present application and its advantages, the technical solutions of the present application will be further illustrated by specific embodiments below, and it should be understood that these embodiments only help to understand the present application, and should not be regarded as specific limitation to the present application. Unless otherwise specified, the parts described in the present application are weight parts, and the percentages are mass percentages. Example 1
[0018] Experimental animals The wild type zebrafish (AB strain) used in this study was introduced from the laboratory of Professor Chen Lin of the Army Special Medical Center. All zebrafish were raised in a semi-closed circulation system. The feeding environment was kept at a constant temperature (27-28℃), with a light-dark cycle of 14:10 hours. All zebrafish strains were raised and maintained according to standard procedures, and early embryos were incubated in breeding water in a constant temperature incubator at 28.5℃.
[0019] Experimental reagents RTaq enzyme was purchased from TaKaRa Company of Japan, DNA rapid purification kit was purchased from TIANGEN Company of China, RNA rapid purification kit and Cas9 protein were purchased from NEB Company of the United States, agarose was purchased from Solabio Company of China, transcription kit was purchased from Roche Company of Switzerland, and low melting point agarose powder was purchased from Biyun Tian Company of China.
[0020] Main instruments PCR machine was purchased from Thermo, electrophoresis machine and gel imaging machine were purchased from Bio-Rad, pH meter was purchased from Shimadzu, low-temperature high-speed centrifuge was purchased from Eppendorf, microinjector was purchased from ThermoFisher, stereomicroscope was purchased from Leica.
[0021] Methods Zebrafish genomic extraction 50ul of 50mM NaOH solution was added to 200ul PCR tube, a little fish tail fin was added to the prepared tube, and was lysed at 95℃ for 30min in PCR machine, and was stored at 4℃; 5ul of 1M Tris-HCl pH 8.0 solution was added to the lysed liquid, and was vortexed to neutralize NaOH; the product was subjected to PCR amplification.
[0022] Reaction system: Sample DNA 2ul ddH2O 11ul Forward Primer 1ul Reverse Primer 1ul 2x Rapid Taq Master Mix 15ul Amplification procedure: 95℃ 5min 95℃ 30sec 55℃ 30sec 72℃ 30sec Go to ② 35times 72℃ 5min 4℃ Hold Gel electrophoresis 3g of agarose powder was weighed and dissolved in 100ml of 0.5x TBE solution, heated and melted, 5ul of nucleic acid dye was added, mixed well and poured into the mold, and stood for 20min. 2ul of PCR stock solution was taken, 0.5ul of 10x Loading Buffer was added, and was mixed well and added to the gel plate hole, 110V for 90min.
[0023] Target design Using the target prediction website (CRISPOR.tefor.net), a separate prediction analysis was performed for each of the encoded exon sequences, and a 20-base sequence starting with GG or GC was evaluated, and finally 3 targets were designed on the 1st, 2nd and 3rd exons of zebrafish. The gRNA was synthesized by in vitro transcription using PCR product as template, and the T7 promoter sequence 5 'TAATACGACTCACTATA 3'(SEQ ID NO: 4) was added in front of the designed target to recognize the base GG, or the SP6 promoter sequence 5 'ATTTAGGTGACACTATA 3'(SEQ ID NO: 5) to recognize the base GA; and the backbone sequence 5 'GTTTTAGAGCTAGAAATAGC 3'(SEQ ID NO: 6) was added at the tail of the target to constitute the forward primer of the PCR reaction, and the gRNA in vitro transcription template primer sequence was designed and prepared (Table 1).
[0024] CRISPR / Cas9 technology gRNA preparation Amplification of gRNA DNA System: gRNA Plasmid 10 ng Primer star 0.8 µl dNTP 4 µl 5×PS Buffer 10 µl 3`Prime 1 µl 5`Prime 1 µl ddH2O Up to 50 µl Amplification of gRNA DNA process 98℃ 5 min 98℃ 10 sec 55℃ 15 sec 72℃ 20 sec Go to② 40 times 72℃ 5 min 4℃ Hold gRNA DNA Transcription system Template 1 ng 10×Reaction Buffer 2 µl RNase inhibitor 1 µl NTP mix 4 µl T7 RNA polymerase 1 µl RNase Free Water Up to 20 µl gRNA DNA transcription condition Incubate in 37℃ water bath for 5 h, add appropriate amount of DNase enzyme to the tube to eliminate template for 1 h, and obtain gRNA transcription product.
[0025] gRNA purification Add 1 ml Trizol to the synthesis product, mix well, and stand at room temperature for 2 min.
[0026] (1) Add 200 μl chloroform to the test tube, shake by hand for 15 s, stand at room temperature for 2 min, and centrifuge at 12000g at 4℃ for 15 min; (2) Take the supernatant, add 500 μl isopropanol to the test tube, invert several times, and stand in the -20℃ refrigerator for 25 min; (3) Centrifuge at 12000g at 4℃ for 15 min; (4) Discard the supernatant, add 1 ml 75% ethanol to the test tube, invert several times, and centrifuge at 7500g at 4℃ for 5 min; (5) Repeat step (4) once; (6) Discard the supernatant, stand on ice to dry for 10 min, add 20 μl RNase Free Water to the test tube, invert several times, and measure the concentration after blowing. Store at -80℃.
[0027] Microinjection Use a knife to cut the blind end of the microinjection needle tip into an appropriate size bevel, dilute gRNA and Cas9 protein to 100 nM / μl, and then add to the injection needle. Collect wild-type 1-cell stage embryos, arrange them on the injection plate with the animal pole facing one side, and inject a small amount of mixed solution (about 1 / 20 of the animal pole) through the yolk pole to the animal pole.
[0028] Primer sequence gRNA primer
[0029] Identification primer
[0030] Obtain F0 generation chimeric mutants after microinjection Collect wild type zebrafish embryos, inject the pre-mixed gRNA and Cas9 protein into the animal pole, and then raise them in a 28.5℃ incubator. At 2 days post-fertilization, randomly select 10 embryos, PCR amplify the DNA sequence, and use first-generation sequencing to show that the T2 target site on exon 2 is successfully knocked out.
[0031] Screen the F1 generation heterozygous mutants by crossing the F0 generation chimeric mutants with wild type fish Raise the F0 generation chimeric mutants to sexual maturity, cut off the tail fins to screen the F0 generation chimeric mutants. Cross the screened chimeras with mutant fish with wild type adult fish to obtain F1 generation. Raise them to sexual maturity, cut off the tail fins, and use first-generation sequencing to screen the F1 generation heterozygous mutants with 17 bp insertions.
[0032] Obtain F2 generation homozygous mutants by crossing the screened F1 generation heterozygous mutants Cross the screened F1 generation heterozygous mutants to obtain F2 generation. After they reach adulthood, use first-generation sequencing and gel electrophoresis for identification. Successfully obtain homozygous mutants with 17 bp insertions that can be stably inherited, resulting in premature stop codons at the 173th amino acid of the encoded protein.
[0033] Homozygous mutants have abnormal notochord development Obtain juvenile fish by crossing the F2 generation homozygous mutants, and observe their growth and development process. Compared with wild type zebrafish, the mutants have abnormal notochord development at 3 days post-fertilization, body axis bending, and local notochord showing discontinuous changes. At the same time, the body length is slightly shortened.
[0034] Conclusion: The inventors successfully used CRISPR / Cas9 technology to construct Sec24b Gene knockout zebrafish. Compared with traditional technology, this technology can achieve complete gene knockout, not knockdown. It can avoid the decrease in mutant exogenous rate caused by residual gene function, affecting subsequent research. At the same time, traditional technology (such as Morpholino) often causes extensive apoptosis, making it difficult for zebrafish to survive to sexual maturity. Therefore, this technology can be used for continuous observation and exploration of the complete process of skeletal development in mutant zebrafish.
Claims
1. A method for constructing a Sec24b knockout zebrafish model, characterized by: According to Sec24b Gene sequence design target site gRNA, in vitro transcription gRNA, mixing gRNA and Cas9 protein and injecting into single cell stage zebrafish embryos to obtain F0 generation embryos, screening and identification and subculture, obtaining stable genetic Sec24b Gene deletion zebrafish; the target site gRNA sequence is selected from T1, T2 or T3, wherein: the T1 sequence is shown as SEQ ID NO: 1: GGGTTACGGCAACCCGCAGT; The sequence of T2 is shown in SEQ ID NO: 2: GTACTCCACCTCCAATGCCC. The sequence of T3 is shown in SEQ ID NO: 3: GGGGCGCCTCCCACGTCAA.
2. The method of claim 1, wherein, The target site gRNA sequence is selected from the sequence of T2 shown in SEQ ID NO: 2: GTACTCCACCTCCAATGCCC.
3. The method of claim 1, wherein, The gRNA is synthesized by using the method of in vitro transcription with PCR product as template, and a T7 promoter sequence shown in SEQ ID NO: 4: 5' TAATACGACTCACTATA 3' is added in front of the designed target site to recognize the base GG, or a SP6 promoter sequence shown in SEQ ID NO: 5: 5' ATTTAGGTGACACTATA 3' is added to recognize the base GA; and a backbone sequence shown in SEQ ID NO: 6: 5' GTTTTAGAGCTAGAAATAGC 3' is added at the tail of the target site to constitute the forward primer of the PCR reaction.
4. The method of claim 1 or 3, wherein, The primers screened and identified from the F0 generation embryos are P1, P2 or P3, wherein The sequence of P1 primer (5'→3') is Forward Primer: shown in SEQ ID NO: 7: GACTCACAACTGGTGACAGC, Reverse Primer: shown in SEQ ID NO: 8: CGCACATTCAGACTCACACC; The sequence of P2 primer (5'→3') is Forward Primer: shown in SEQ ID NO: 9: CAGGTCCAGGACAGGCGTAC, Reverse Primer: shown in SEQ ID NO: 10: CTGAGAGGATCTCAGCGTGC; The sequence of P3 primer (5'→3') is Forward Primer: shown in SEQ ID NO: 11: GCACCAGCATTATCGACACC, Reverse Primer: shown in SEQ ID NO: 12: GATGAATGCACAGAGGCGCC.
5. The method of claim 1, wherein, The F0 generation chimeric mutant is mated with wild type to obtain F1 generation hybrid mutant after screening, the F1 generation hybrid mutant after screening is selfed to obtain F2 generation homozygous mutant, and the F2 generation homozygous mutant is selfed to obtain Sec24b gene knockout zebrafish.
6. The method of claim 5, wherein, The method for obtaining F1 generation hybrid mutant by mating F0 generation chimeric mutant with wild type after screening is as follows: the F0 generation chimeric mutant is bred to sexual maturity, the tail fin is cut to screen F0 generation chimeric mutant, the screened chimeric mutant with mutation is mated with wild type adult fish to obtain F1 generation, which is bred to sexual maturity, the tail fin is cut, and first generation sequencing is used to screen F1 generation hybrid mutant with 17 bp insertion.
7. The method of claim 6, wherein, The method for obtaining the F2 generation homozygous mutant from the screened F1 generation hybrid mutant is as follows: the screened F1 generation hybrid mutant is self-crossed to obtain the F2 generation, and after the F2 generation reaches adulthood, first-generation sequencing and gel electrophoresis are used for identification, and a homozygous mutant with stable heredity which inserts 17 bp is successfully obtained, resulting in a premature stop codon at the 173th amino acid of the encoded protein.
8. The method of claim 7, wherein, The F1 generation hybrid mutant is self-crossed to obtain the F2 generation, and after the F2 generation reaches adulthood, first-generation sequencing and gel electrophoresis are used for identification, and the primer sequence for gel electrophoresis identification is as follows: Forward primer: as shown in SEQ ID NO: 13: GCAGCACCAGGATCACAGAC, Reverse primer: as shown in SEQ ID NO: 13: CCATGTGAGGGCTGACTATACGG.
9. The method of claim 8, wherein, The method for obtaining the Sec24b gene knockout zebrafish is as follows: the F2 generation homozygous mutant is self-crossed to obtain the Sec24b gene knockout zebrafish larvae, and the growth and development process is observed, and compared with the wild type zebrafish, the mutant shows abnormal notochord development, body axis bending, and local notochord changes in a discontinuous manner, and the body length is slightly shortened at 3 days after fertilization.