Method for cultivating male cynoglossus semilaevis with rapid growth characteristic based on gene editing breeding technology

By using gene editing breeding technology, a dmrt1 gene mutant family was constructed, which solved the problem of slow growth in male half-smooth tongue sole and bred fast-growing male half-smooth tongue sole, significantly improving yield and economic benefits, and solving the problems of breeding costs and sustainable development of the industry.

CN121369302APending Publication Date: 2026-01-23YELLOW SEA FISHERIES RES INST CHINESE ACAD OF FISHERIES SCI
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511565557.4
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-10-30
Publication Date
2026-01-23

AI Technical Summary

Technical Problem

The slow growth of male half-smooth tongue sole leads to decreased aquaculture production and increased costs, hindering the sustainable development of the industry.

Method used

By using gene editing technology, a dmrt1 gene mutant family was constructed to breed a fast-growing male half-smooth tongue sole. The dmrt1 gene-edited family was then used for parental mating to obtain a male half-smooth tongue sole with fast growth characteristics.

Benefits of technology

The male half-smooth tongue soles bred exhibited remarkable rapid growth at different growth stages, with their weight and body length significantly exceeding those of ordinary males and approaching those of females, thus improving aquaculture yield and economic benefits.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121369302A_ABST
    Figure CN121369302A_ABST
Patent Text Reader

Abstract

The invention provides a method for cultivating male cynoglossus semilaevis with a rapid growth characteristic based on a gene editing breeding technology, which comprises the following steps of: mating ZmW female fish with a dmrt1 gene mutated with normal ZZ male fish in an F0 generation to breed offspring, and then selecting male fish with a dmrt1 gene mutated on one chromosome in an F1 generation to mate with the normal ZW female fish to obtain an F2 generation; male cynoglossus semilaevis with the dmrt1 gene mutated on one chromosome in the F2 generation and female cynoglossus semilaevis with the dmrt1 gene mutated on the Z chromosome are used as parents to cultivate male cynoglossus semilaevis with the dmrt1 gene mutated on two chromosomes. The rapid growth male cynoglossus semilaevis obtained by a gene editing technology shows excellent growth performance in different growth stages, and shows an obvious rapid growth advantage.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of gene editing breeding technology in aquatic biotechnology, specifically involving the application of gene editing breeding technology to cultivate male half-smooth tongue sole with rapid growth characteristics. Background Technology

[0002] Half-smooth tongue sole ( Cynoglossus semilaevis It is an important economic fish species unique to my country, belonging to the family Soleidae (Glossopteris). Cynoglossidae This species is mainly distributed in warm-water coastal areas such as the Yellow Sea and Bohai Sea. It is characterized by its tender flesh and high nutritional value.

[0003] Significant differences exist in the growth rate between male and female half-smooth tongue sole, with females typically growing 2–4 times faster than males. The slower growth and smaller size of males not only leads to reduced aquaculture yields but also increases farming costs, severely hindering the sustainable development of the industry. To address this issue, a research team established the world's first gene-editing technology for marine fish and successfully obtained gene-edited half-smooth tongue sole individuals. Based on this, they constructed a gene-editing breeding technology system centered on gene-mutant families, cultivating a new type of male fish with significantly accelerated growth. Its weight is 2–4 times greater than that of wild-type males, approaching the level of females.

[0004] This groundbreaking achievement not only fundamentally solves the problem of slow growth in male half-smooth tongue sole, providing a feasible path for creating new varieties of fast-growing male fish, but also lays an important foundation for promoting genetic improvement and molecular breeding technology innovation. This research has significant practical implications and broad application prospects for increasing aquaculture yield and economic benefits, promoting the sustainable development of the half-smooth tongue sole industry, and advancing the technological progress of marine fish aquaculture in my country.

[0005] This invention provides a gene-editing breeding technique for half-smooth tongue sole. By identifying and screening parents at the molecular level, a dmrt1 gene-edited family is constructed using mutant parents to obtain rapidly growing male offspring. This invention provides a feasible technical approach for gene-editing molecular breeding practices in half-smooth tongue sole. Summary of the Invention

[0006] The purpose of this invention is to provide a method for breeding male half-smooth tongue sole with rapid growth characteristics based on gene editing breeding technology, which can breed and quickly identify gene-edited fast-growing half-smooth tongue sole fish.

[0007] This invention first provides a method for breeding male half-smooth tongue sole with rapid growth characteristics. The method involves using the F0 generation... dmrt1The mutated ZmW female fish was mated with a normal ZZ male fish to produce offspring. Then, in the F1 generation, a male fish with a mutation in the dmrt1 gene on one chromosome was selected and mated with a normal ZW female fish to obtain the F2 generation. Then, a male fish with a mutation in the dmrt1 gene on one chromosome from the F2 generation was used to produce offspring. dmrt1 Male fish with gene mutations and on the Z chromosome dmrt1 Mutant female fish were used as parent stock to breed two chromosomes. dmrt1 Both are male half-smooth tongue soles that have undergone mutations and exhibit rapid growth characteristics.

[0008] The mutation dmrt1 The gene sequence fragment, located on the Z chromosome, is 389 bp in length, and its sequence is as follows: CGGGCAAAGGGAGAAGGTTGACCTATAGCTGCAACCCATGGCACCGCAGCAGACTTTAAGTAGCCTTGTCTTCAGGGACGAGCACGAACTCCGTGGCTGAAGTCCCGAGACTCCCACAGACAAGGACCATGAACAAGAACAAGCAGCGCCCTGACTACACTGGACCACAGTCCCCATCCAAAGGCCGAAGACCACC CAGGACGCCCAAGTGCTCCCGCTGCAGGAACCACGGCTTCGTGTCTCCGTTGAAGGGCCACAAACGCTACTGTGACTGGAGGGAGTGTCGCTGTGACAAGTGTAACCTCATAGCGGAGAGACAGCGAATCATGGCGGCGCAGGTAACCGTTAGTCCACCTGTTAGCGCCGCTTAGCCCTCAGGAGATGTTTTTT (SEQ ID NO:1); The aforementioned dmrt1 The sequence of the gene at the specific site of editing is as follows: CGGGCAAAGGGAGAAGGTTGACCTATAGCTGCAACCCATGGCACCGCAGCAGACTTTAAGTAGCCTTGTCTTCAGGGACGAGCACGAACTCCGTGGCTGAAGTCCCGAGACTCCCACAGACAAGGACCATGAACAAGAACAAGCAGCGCCCTGACTACACTGGACCACAGTCCCCATCCAAAGGCCGAAGAC CACCCAGGACGCCCAAGTGCTCCCGCTGCAGGAACCACGGCTCCGTTGAAGGGCCACAAACGCTACTGTGACTGGAGGGAGTGTCGCTGTGACAAGTGTAACCTCATAGCGGAGAGACAGCGAATCATGGCGGCGCAGGTAACCGTTAGTCCACCTGTTAGCGCCGCTTAGCCCTCAGGAGATGTTTTTT (SEQ ID NO:2).

[0009] The sequence information of one of the primer pairs used to detect mutations in the dmrt1 gene is as follows: Upstream primer: 5′-CGGGCAAAGGGAGAAGG-3′ (SEQ ID NO:3); Downstream primer: 5′-AAAAACATCTCCTGAGGGCTAA-3′ (SEQ ID NO:4).

[0010] Furthermore, the method uses the following primer pair to detect the sex of the half-smooth tongue sole; Upstream primer: 5′-GTCACAGTTCCAACCAGGACAAGAG-3′ (SEQ ID NO:5); Downstream primer: 5′-CCTGTTGTTGTTCTACTAAGTCTG-3′ (SEQ ID NO:6).

[0011] This invention utilizes gene editing technology to obtain fast-growing male tongue soles, which exhibit excellent growth performance at different growth stages. The results show that at 8 months of age, the average body length and weight of the gene-edited fast-growing males were not significantly different from those of ordinary males and females; however, at 13 months of age, their average body length was similar to that of ordinary females but significantly higher than that of ordinary males (P<0.01), while their average weight was between that of ordinary females and males; by 15 months of age, both their average body length and average weight were significantly higher than those of ordinary males (P<0.01), demonstrating a clear advantage in rapid growth. Attached Figure Description

[0012] Figure 1 Sequence alignment was used to select female ZmW parent fish. Figure 2 Sequencing peak diagram, screening diagram of ZmZ male fish parents; Figure 3 Breeding roadmap for gene-edited, rapidly growing male half-smooth tongue sole; Figure 4 Electrophoresis results of genetic sex determination in gene-edited fish; Figure 5 Sequencing results of a fast-growing male half-smooth tongue sole (Gastrodon spp.) after gene editing. Figure 6 Growth phenotype of gene-edited fast-growing male tongue sole; where A in the figure shows the body length change trend of gene-edited fast-growing male fish at 8 months, 13 months, and 15 months of age; B shows the body weight change trend of gene-edited fast-growing male fish at 8 months, 13 months, and 15 months of age. Figure 7 Growth comparison of gene-edited male half-smooth tongue sole. Detailed Implementation

[0013] The genetic sex type of the tongue sole is ZW, where ZZ represents males and ZW represents females. Drmt1 Genes are located on the Z chromosome, and when two Z chromosomes have the same gene... dmrt1 After all mutations occur, the male fish becomes infertile. In the embodiments of this invention, ZmW represents a female fish with a dmrt1 mutation on chromosome Z, ZmZ represents a male fish with a dmrt1 mutation on one chromosome, ZmZm represents a male fish with dmrt1 mutations on both chromosomes, and ZW and ZZ represent normal male and female fish.

[0014] The present invention will now be described in further detail with reference to the accompanying drawings and specific embodiments.

[0015] Example 1: Breeding route for rapidly growing male half-smooth tongue sole through gene editing 1. Screening for parent fish of gene-edited, rapidly growing male half-smooth tongue sole (1) Preparation of instruments Prepare experimental equipment including a PCR instrument, centrifuge, electrophoresis apparatus, electrophoresis tank, water bath, voltage regulator, microwave oven, gel imaging system, and other necessary reagents, tools, and consumables. Set up and construct the laboratory appropriately within the farm to ensure the smooth conduct of the experiments.

[0016] (2) Collection of fin rays from parent fish to be identified Prepare numbered centrifuge tubes and corresponding electronic tags, ensuring a one-to-one correspondence between the numbers. In the gene-editing workshop, collect a small amount of fin rays from each of the gene-edited fish to be identified, placing them into the corresponding numbered centrifuge tubes. Inject the electronic tags into the sampled parent fish and release them back into the pool. The sex of the parent fish can be determined by their body size; females are 2-4 times larger than males.

[0017] (3) Extraction of genomic DNA Fish fin tissue was lysed using 50 mM NaOH, with 200 μL of lysis buffer added to each fin. The samples were heated at 95 °C for 15 min, then removed and thoroughly vortexed. This heating and lysis process was repeated once more. After heating, the mixture was vortexed again. Subsequently, 1 / 10 volume of 1 M Tris-HCl solution (pH 8.0) was added to the lysis system for neutralization, and the mixture was vortexed again. The resulting solution was the crude genomic DNA extract.

[0018] (4) PCR amplification and sequencing of DNA from the parent fish to be tested Genomic DNA extracted using primer pair 1 was amplified by PCR. The PCR reaction volume was 10 μL, including 5 μL of 2 × TaqMaster Mix (Novizan), 0.5 μL each of forward and reverse primers, 2 μL of template DNA, and 2 μL of ddH2O. The reaction program was 95℃ for 10 minutes, followed by 35 cycles of denaturation at 95℃, annealing at 60℃, and extension at 72℃, and then cooling at 72℃ for 10 minutes. The DNA was then sent to a sequencing company for sequencing.

[0019] (5) Sequencing alignment The sequencing results were compared with the sequence of SEQ ID NO:1, such as... Figure 1 As shown, fish numbered D1-D6, lacking 8 bases of "TTCGTGTC", are homozygous mutant female parents. The sequencing peak diagram is shown below. Figure 2 As shown, those exhibiting bimodal distributions at specific locations are used as heterozygous mutant male parent fish.

[0020] (6) Preparation of rapidly growing male half-smooth tongue sole through gene editing Due to the F0 generation of ZZ male fish dmrt1 The genes have been edited, preventing the production of sperm, which cannot be used for reproduction. Therefore, the breeding strategy uses... dmrt1 When gene-edited ZmW female fish are mated with normal ZZ male fish, ZmZ male fish will appear in the F1 generation, with one Z chromosome... dmrt1The edited male fish can produce sperm for reproduction. The ZmZ male is then mated with a ZW female to obtain the F2 generation, which contains both ZmZ males and ZmW females. Using the ZmZ males and ZmW females from the F2 generation as parents, the ZmZm half-smooth tongue sole gene-edited fast-growing males can eventually be obtained.

[0021] Example 2: Screening of Gene-Edited, Rapidly Growing Male Half-Smooth Tongue Sole 1. Genetic sex determination of half-smooth tongue sole (1) Collection of fin rays from parent fish to be identified Prepare numbered centrifuge tubes and corresponding labels, ensuring a one-to-one correspondence between the numbers. In the gene-editing workshop, collect a small number of fin rays from each of the gene-edited fish to be identified, placing them into the corresponding numbered centrifuge tubes. After sampling, place the parent fish in cylindrical plastic bags, fill them with seawater and oxygen at a 1:2 ratio, seal them, affix labels matching the centrifuge tube numbers, and temporarily store them in a cool, dark place.

[0022] (2) PCR amplification and sex detection of the fish DNA to be tested DNA extraction from the fish to be tested was performed using the same method as described above, employing sex-identifying molecular markers designed by the Yellow Sea Fisheries Research Institute of the Chinese Academy of Fishery Sciences. 5′-GTCACAGTTCCAACCAGGACAAGAG-3′, 5′-CCTGTTGTTGTTCTACTAAGTCTG-3′ The extracted genomic DNA was amplified by PCR. The PCR reaction volume was 10 μL, including 5 μL of 2 × Taq MasterMix (Novizan), 0.5 μL each of forward and reverse primers, 2 μL of template DNA, and 2 μL of ddH2O. The reaction program was 95℃ for 10 minutes, followed by 35 cycles of denaturation at 95℃, annealing at 60℃, and extension at 72℃, and then cooling at 72℃ for 10 minutes.

[0023] Add 3 μL of 6× Loading Buffer, perform 1% agarose gel electrophoresis, incubate at 150V for 15 minutes, and observe under a gel imaging system. Record the reaction results corresponding to each number; fish with one DNA band are male, and fish with two DNA bands are female. Figure 4 ).

[0024] (3) Detection of gene-edited, rapidly growing male half-smooth tongue sole in test fish Genomic DNA extracted using primer pair 1 was amplified by PCR. The PCR reaction volume was 10 μL, including 5 μL of 2 × TaqMaster Mix (Novizan), 0.5 μL each of forward and reverse primers, 2 μL of template DNA, and 2 μL of ddH2O. The reaction program was 95℃ for 10 minutes, followed by 35 cycles of denaturation at 95℃, annealing at 60℃, and extension at 72℃, and then cooling at 72℃ for 10 minutes.

[0025] The PCR product was sent to a sequencing company for sequencing. Combined with the sex identification results from step 1.2, the sex was determined to be male. Furthermore, the sequencing results showed an 8-base reduction at the mutation site, indicating a fast-growing male half-smooth tongue sole (Gastrodon halys). Figure 5 ).

[0026] (4) Measurement of growth traits in fast-growing male half-smooth tongue sole after gene editing Body weight and length were measured in gene-edited, rapidly growing male half-smooth tongue sole at 8, 13, and 15 months of age, with 5-6 specimens per group for each test. Results showed that at 8 months of age, the average body length and weight of the gene-edited, rapidly growing males were not significantly different from those of ordinary males and females. At 13 months of age, the average body length of the gene-edited, rapidly growing males was similar to that of ordinary females and significantly greater than that of ordinary males (P<0.01), while their average weight was between that of ordinary females and males. At 15 months of age, the average body length and average weight of the gene-edited, rapidly growing males were significantly greater than those of ordinary males (P<0.01), and their average weight was even slightly higher than that of ordinary females. Figure 6 and Figure 7 ).

[0027] Therefore, the gene-edited, fast-growing male half-smooth tongue sole obtained by this invention not only possesses the phenotypic stability and breeding convenience of male fish, but also exhibits rapid growth characteristics, which can significantly improve aquaculture yield and economic benefits. This provides a new technical approach for the large-scale breeding and aquaculture of half-smooth tongue sole, and is of great significance for promoting the industrial application of this species and the sustainable and healthy development of the aquaculture industry.

Claims

1. A method for breeding male half-smooth tongue sole with rapid growth characteristics, characterized in that, The method described is used in the F0 generation. dmrt1 Female fish with a gene mutation were mated with normal male fish to produce offspring. Then, in the F1 generation, male fish with a mutation in the dmrt1 gene on one chromosome were selected and mated with normal female fish to obtain the F2 generation. Then, a male fish with a mutation in the dmrt1 gene on one chromosome from the F2 generation was used to produce offspring. dmrt1 Male fish with gene mutations and on the Z chromosome dmrt1 Mutant female fish were used as parent stock to breed two chromosomes. dmrt1 Both are male half-smooth tongue soles that have undergone mutations and exhibit rapid growth characteristics.

2. The method as described in claim 1, characterized in that, The aforementioned dmrt1 The gene sequence is SEQ ID NO:

1.

3. The method as described in claim 1, characterized in that, The method encoding dmrt1 The sequence of the gene-specific site is SEQ ID NO:

2.

4. The method as described in claim 1, characterized in that, The primer pair used in the method for detecting mutations in the dmrt1 gene has the sequence of SEQ ID NO:3 for the upstream primer and SEQ ID NO:4 for the downstream primer.

5. The method as described in claim 1, characterized in that, The primer pair used in the method for detecting the sex of the half-smooth tongue sole has the sequence of SEQ ID NO:5 for the upstream primer and the sequence of SEQ ID NO:6 for the downstream primer.