Construction and application of oncolytic virus for providing replication selectivity through promoter and mir-TS

Abstract

The invention belongs to the technical field of gene engineering, and particularly discloses construction and application of an oncolytic virus for providing replication selectivity through a promoter and mir-TS. The oncolytic virus comprises an MAGEA6 promoter, a miR-TS coding sequence and a human interferon gamma-hIFNG coding gene. The invention discloses construction and application of an oncolytic virus for providing replication selectivity through a promoter and mir-TS. The oncolytic virus can effectively improve the oncolytic effect and reduce the system toxicity. According to the invention, the MAGEA6 promoter is combined with miR-TS for adenovirus modification for the first time, and a new strategy is provided for targeted therapy of MAGEA6 high-expression tumors.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of genetic engineering, and particularly relates to a kind of oncolytic virus construction and application provided with replication selectivity by promoter and mir-TS. BACKGROUND

[0002] Oncolytic virus is a kind of virus that can selectively replicate in tumor tissue and lyse tumor cells, while causing less damage to normal tissues. Its mechanism of action includes direct killing of tumor cells and activation of host immune response, and has become an important direction of tumor biological therapy. Adenovirus, as a commonly used genetic engineering vector, has the characteristics of large exogenous gene carrying capacity, high infection efficiency and strong genome stability. Among them, adenovirus type 5 (Ad5) is widely used in the development of oncolytic virus and gene therapy vectors due to its easy modification. The design of traditional oncolytic virus usually deletes virus replication essential genes and inserts tumor-specific promoters to achieve selective replication of the virus in tumor cells. However, there are many challenges such as insufficient targeting, immunogenicity and replication efficiency difference.

[0003] Replacement of tumor-specific promoters (such as hTERT, MAGEA family gene promoters) is a core strategy for targeting modification of oncolytic viruses. The hTERT promoter is active in tumor cells with high telomerase expression, but its specificity is insufficient in some tumors (such as MAGEA6 high expression tumors). MAGEA6 belongs to the cancer testis antigen (CTA) family, and its promoter is silenced in normal tissues due to methylation, and activated in various tumors (such as tongue cancer, liver cancer) due to demethylation, which can theoretically be used as a tumor-specific promoter. However, there are few studies on the application of MAGEA6 promoter in oncolytic viruses in the prior art, and its actual regulation efficiency and selectivity still need to be verified. SUMMARY

[0004] The present application aims to provide an oncolytic virus construction and application that provides replication selectivity through promoter and mir-TS, which can effectively improve the oncolytic effect and reduce systemic toxicity. The present application first combines MAGEA6 promoter with miR-TS for adenovirus modification, providing a new strategy for targeted therapy of MAGEA6 high expression tumors.

[0005] To solve the above technical problems, the technical solution adopted by the present application is as follows:

[0006] An oncolytic virus for MAGEA6 high expression tumors, the oncolytic virus comprising: a MAGEA6 promoter, a miR-TS coding sequence, and a human interferon gamma-hIFNG coding gene.

[0007] Preferably, the MAGEA6 promoter is used to regulate the expression of the adenovirus E1AB gene, and the MAGEA6 promoter is selected from a nucleotide sequence that activates transcription in MAGEA6 high-expression cells, such as SEQ ID NO: 1.

[0008] Preferably, the miR-TS coding sequence is a completely complementary target sequence of miR381-3p, miR381-5p, miR490-3p or miR490-5p, and the nucleotide sequence is shown as SEQ ID NO: 2-SEQ ID NO: 5.

[0009] Preferably, the hIFNG coding gene is co-expressed with the E1AB gene through a P2A self-cleavage peptide, and the nucleotide sequence is shown as SEQ ID NO: 6.

[0010] Preferably, the oncolytic virus is constructed based on adenovirus type 5, and the E1 region and the E3 region are deleted, and the MAGEA6 promoter, the miR-TS coding sequence and the hIFNG coding gene are introduced by homologous recombination.

[0011] The application also provides a construction method of the oncolytic virus, comprising the following steps:

[0012] S1, introducing the MAGEA6 promoter based on adenovirus type 5, and then introducing the miR-TS coding sequence and the hIFNG coding gene;

[0013] S2, inserting the sequence into a shuttle plasmid by enzyme digestion and ligation or recombination PCR method to construct a recombinant shuttle plasmid;

[0014] S3, co-transfecting the recombinant shuttle plasmid obtained in S2 and a backbone plasmid into HEK293 cells to obtain the oncolytic virus vector strain for MAGEA6 high-expression tumors.

[0015] The application also provides the use of the oncolytic virus in the preparation of a medicament for treating MAGEA6 high-expression tumors.

[0016] Preferably, the MAGEA6 high-expression tumors include tongue cancer, liver cancer or esophageal cancer.

[0017] The application also provides a pharmaceutical composition comprising the oncolytic virus and a pharmaceutically acceptable carrier.

[0018] Preferably, the pharmaceutical composition is administered by intratumoral injection, intraperitoneal administration or intravenous administration.

[0019] Compared with the prior art, the application has the following advantages and technical effects:

[0020] (1) The application discloses a kind of oncolytic virus construction and application by providing replication selectivity of promoter and mir-TS, by coupling MAGEA6 promoter with E1AB gene, make recombinant virus in MAGEA6 high expression tumor cell Selective high-efficiency replication, while the replication ability in normal cells is significantly reduced.Experimental results show that the genome copy number of the virus in HN6 cell supernatant is significantly higher than that of Hacat cell, and has similar target replication characteristics with hTERT promoter regulated virus, solve the toxicity problem caused by the replication of traditional oncolytic virus in normal tissue.

[0021] (2) by inserting the miR-TS coding sequence for low expression miRNA in cancer tissue, when the virus overflows to normal tissue, the corresponding miRNA in normal tissue is combined with miR-TS to inhibit virus replication, reduce the damage to normal cells;On the other hand, the expression of hIFNG is coupled with virus replication, so that the production of hIFNG depends on the replication of virus in tumor cells, significantly reducing its yield in non-susceptible cells, avoiding the non-selective toxicity of hIFNG.

[0022] (3) the oncolytic virus has both the direct lysis effect of oncolytic virus and the immune regulation function of hIFNG, the replication of the oncolytic virus can directly lyse tumor cells, and the released virus particles further infect surrounding tumor cells, cell experiments show that its killing ability to susceptible tumor cells is significantly stronger than that of replication-defective virus, animal experiments show that it has a clear inhibitory effect on the growth of HN6 xenograft tumor, the oncolytic virus has no obvious adverse effects on the body weight and main organs of mice, and can effectively inhibit tumor growth, confirming that it has good safety and anti-tumor activity in vivo, providing a new type of high-efficiency, low-toxicity candidate for clinical treatment of MAGEA6 high expression tumor.

[0023] The technical solutions of the application will be further described in detail below with the help of drawings and examples. DETAILED DESCRIPTION

[0024] Figure 1 For the MAGEA6 and hTERT expression of the cells to be tested in example 1, wherein, Figure 1 (A) in the (A) is the MAGEA6 expression result of the cell to be tested, Figure 1 (B) in the (B) is the hTERT expression result of the cell to be tested;

[0025] Figure 2 For the results of verifying the influence of existing strain infection on HN6, HepG2 and Hacat cell activity in example 1, wherein, Figure 2 (A) in the (A) is the influence result of existing strain infection on HN6 cell activity, Figure 2(B) is the result of the effect of pre-existing strain infection on the viability of HepG2 cells, Figure 2 (C) is the result of the effect of pre-existing strain infection on the viability of Hacat cells;

[0026] Figure 3 (B) is the result of the effect of pre-existing strain infection on the viability of HepG2 cells, Figure 3 (A) is the infection of Hacat cells by pAd5-MAGEA6P at 100, 200, 400 MOI, Figure 3 (B) is the supernatant gene copy number of pAd5-MAGEA6P within 96h after infection of HN6 or HepG2 cells at 400 MOI, Figure 3 (C) is the infection of Hacat cells by pAd5-hTERTP at 100, 200, 400 MOI, Figure 3 (D) is the supernatant gene copy number of pAd5-hTERTP within 96h after infection of HN6 or HepG2 cells at 400 MOI;

[0027] Figure 4 (B) is the result of the effect of pre-existing strain infection on the viability of HepG2 cells,

[0028] Figure 5 (B) is the supernatant gene copy number of pAd5-MAGEA6P within 96h after infection of HN6 or HepG2 cells at 400 MOI, Figure 5 (A) is the infection of Hacat cells by pAd5-MAGEA6P-TS at 100, 200, 400 MOI, Figure 5 (B) is the supernatant gene copy number of pAd5-MAGEA6P-TS within 96h after infection of HN6 or HepG2 cells at 400 MOI, Figure 5 (C) is the infection of Hacat cells by pAd5-hTERTP-TS at 100, 200, 400 MOI, Figure 5 (D) is the supernatant gene copy number of pAd5-hTERTP-TS within 96h after infection of HN6 or HepG2 cells at 400 MOI, Figure 5 (E) is the infection of Hacat cells by pAd5-MAGEA6P-hIFNG-TS at 100, 200, 400 MOI, Figure 5 (F) is the supernatant gene copy number of pAd5-MAGEA6P-hIFNG-TS within 96h after infection of HN6 or HepG2 cells at 400 MOI;

[0029] Figure 6Figure 1 is an electron micrograph of the cell state change within 96 hours after infection of Hacat cells with pAd5-MAGEA6P-hIFNG-TS in Example 1, with a scale of 200 μm;

[0030] Figure 7 Figure 2 is an electron micrograph of the cell state change within 96 hours after infection of HN6 cells with pAd5-MAGEA6P-hIFNG-TS in Example 1, with a scale of 200 μm;

[0031] Figure 8 Figure 3 is a result of the cell activity and supernatant virus load change within 96 hours after infection of Hacat and HN6 cells with pAd5-MAGEA6-hIFNG-TS recombinant strains at 100, 200, and 400 MOI in Example 1, wherein, Figure 8 (A) in Figure 3 is a result of the cell activity and supernatant virus load change within 96 hours after infection of Hacat cells at 100 MOI in Example 1, Figure 8 (B) in Figure 3 is a result of the cell activity and supernatant virus load change within 96 hours after infection of HN6 cells at 100 MOI in Example 1, Figure 8 (C) in Figure 3 is a result of the cell activity and supernatant virus load change within 96 hours after infection of Hacat cells at 100 MOI in Example 1, Figure 8 (D) in Figure 3 is a result of the cell activity and supernatant virus load change within 96 hours after infection of HN6 cells at 100 MOI in Example 1, Figure 8 (E) in Figure 3 is a result of the cell activity and supernatant virus load change within 96 hours after infection of Hacat cells at 100 MOI in Example 1, Figure 8 (F) in Figure 3 is a result of the cell activity and supernatant virus load change within 96 hours after infection of HN6 cells at 100 MOI in Example 1;

[0032] Figure 9 Figure 4 is a histogram of the hIFNG content after infection of cells with pAd5-MAGEA6P-mCMV-hIFNG and pAd5-MAGEA6P-hIFNG-TS in Example 1, wherein, Figure 9 (A) in Figure 4 is a histogram of the hIFNG content after infection of cells with pAd5-MAGEA6P in Example 1, Figure 9 (B) in Figure 4 is a histogram of the hIFNG content after infection of cells with pAd5-MAGEA6P-hIFNG-TS in Example 1;

[0033] Figure 10 Figure 5 is a change in body weight of BALB / C mice and nude mice within 14 days after infection in Example 1, wherein, Figure 10 (A) in Figure 5 is a change in body weight of BALB / C mice, Figure 10 (B) in Figure 5 is a change in body weight of nude mice;

[0034] Figure 11 Figure 6 is a growth state of tumors in each group of mice after infection in Example 1, wherein,Figure 11 (A) in the blank group represents the tumor growth status. Figure 11 (B) in the diagram represents the tumor growth status of the control group. Figure 11 (C) in the figure represents the tumor growth status of the experimental group. Detailed Implementation

[0035] The technical solution of the present invention will be further described below with reference to the accompanying drawings and embodiments.

[0036] Unless otherwise defined, the technical or scientific terms used in this invention shall have the ordinary meaning as understood by one of ordinary skill in the art to which this invention pertains.

[0037] Source of experimental materials:

[0038] In this embodiment, Hacat, A375, EC109, HCT116, HN6, HepG2, Hela, and HEK293 cells were obtained from the School of Life Sciences, Beijing University of Technology (Beijing International Science and Technology Cooperation Base for Antiviral Drugs).

[0039] In this embodiment, the WT-Ad5 wild-type strain, pAd5-mCMV-hIFNG, pAd5-MAGEA6P-E1AB-mCMV-hIFNG, and pAd5-hTERTP-E1AB-mCMV-hIFNG recombinant strains were obtained from the Institute of Viral Disease Control and Prevention, Chinese Center for Disease Control and Prevention.

[0040] In this invention, unless otherwise specified, all other test materials and instruments are conventional test materials in the field and can be purchased through commercial channels.

[0041] Example 1

[0042] Verifying the selective replication capability of MAGEA6

[0043] qPCR was used to detect the transcriptional activity of MAGEA6 and hTERT genes to identify non-susceptible and susceptible cells for subsequent experiments.

[0044] Relative quantitative qPCR was performed on gastrointestinal tumors such as esophageal cancer EC109, tongue cancer HN6, liver cancer HepG2, and colon cancer HCT116, as well as melanoma A375 and cervical cancer HeLa cell lines used as references. The expression of MAGEA6 and hTERT was detected using GAPDH as an internal reference, and the relative expression level ΔCt was calculated as a marker of gene transcription activity.

[0045] qPCR primer design: The CDS region sequence of MAGEA6 and hTERT was found in the NCBI database (https: / / www.ncbi.nlm.nih.gov), and then the qPCR primer was designed in Primer premier 5.0 software, and the primer specificity was determined by BLAST search. The primer sequences used in this study were synthesized by Beijing Qikang Biotechnology Co., Ltd., and the primer sequences are shown in Table 1.

[0046] Table 1 RT-PCR primer sequence

[0047] Primer name Primer sequence (5'-3') Sequence ID GAPDH-F ATGTTCGTCATGGGTGTGAAC SEQ ID NO: 8 GAPDH-R ATGGACTGTGGTCATGAGTCC SEQ ID NO: 9 MAGEA6-F CGGTCACAAAGGCAGAAAT SEQ ID NO: 10 MAGEA6-R AGGCAGGTGGCAAAGATG SEQ ID NO: 11 hTERT-F CCAGCATCATCAAACCC SEQ ID NO: 12 hTERT-R CGACGGCATCCCTCA SEQ ID NO: 13

[0048] Extraction of total RNA: Add Trizol lysis to the cell culture bottle, and place it on the shaker for 5 min to make it fully react. Transfer the mixture to a 1.5 mL EP tube without RNA / DNA enzyme, centrifuge at 12000 rcf for 5 min at 4°C. Collect the supernatant, add chloroform with a volume ratio of Trizol reagent: chloroform = 5:1, stand at room temperature for 5 min, centrifuge at 12000 rcf for 15 min at 4°C. Collect the upper aqueous phase. Add isopropanol with a ratio of Trizol reagent: isopropanol = 2:1, mix well, stand at room temperature for 10 min to precipitate RNA, centrifuge at 12000 rcf for 10 min at 4°C. Discard the supernatant, add 75% ethanol with a ratio of TriIzol reagent: 75% ethanol = 1:1, suspend and wash the precipitate, centrifuge at 12000 rcf for 5 min at 4°C. Discard the supernatant, dry thoroughly in a clean environment such as a clean bench or safety cabinet, finally add 50 uL of enzyme-free water, stand at room temperature for 3 min, use ultraviolet spectrophotometer to determine the nucleic acid concentration and OD value at 260 / 280, and store at 4°C for standby.

[0049] DNA removal and reverse transcription of total RNA extracted to cDNA. The DNA removal system is as follows:

[0050] 10x Buffer 1 μL

[0051] gDNA Remover 1 μL

[0052] Template 10 μg

[0053] Enzyme-free water to 10 μL

[0054] Put the EP tube into the PCR instrument for reaction. After the reaction is completed, configure the cDNA synthesis system:

[0055] 5x Buffer 4 μL

[0056] RT 61 μL

[0057] DTT 1 μL

[0058] DT17 or Randomer 1 μL

[0059] Enzyme-free water 2 μL

[0060] After the system configuration, the EP tube is placed in the PCR instrument for reaction.

[0061] qPCR relative quantification: the relative expression of the target gene is detected using SYBR Green Realtime PCR Master Mix. The primers used are shown in Table 1, and the system is configured as follows:

[0062] Enzyme-free water 17.5 μL

[0063] Primer mixture 3.52 μL

[0064] Template 1 μL

[0065] Add 22 μL SYBR Green under light protection, and place in the qPCR instrument for reaction. Record the data, and obtain the amplification cycle number (Ct value) when the fluorescence intensity reaches the threshold value from the PCR reaction curve. Take GAPDH as the internal reference to calculate the relative expression, and the specific calculation method is as follows:

[0066] ΔCt = Ct target gene - Ct internal reference; Relative expression = 2 -ΔCt ;

[0067] The results are shown in Figure 1 .

[0068] According to the qPCR results, HN6 and HepG2 are selected as the susceptible cells for MAGEA6 or hTERT promoter regulation of E1AB strain: among the tested EC109, HN6, HepG2, HCT116, A375, and Hela cell lines, the MAGEA6 transcriptional activity of HN6 is the highest, and the hTERT transcriptional activity of HepG2 is the highest, as shown in Figure 1 . In subsequent studies on recombinant strains regulated by the above gene promoters, HN6 and HepG2 are selected as the susceptible cells.

[0069] Using data from the NCBI database, miRNAs with significantly lower content in cancer samples than in adjacent samples and moderate absolute expression in the corresponding part of the susceptible cell are screened by bioinformatics methods. Select a suitable part of the fragment that may contain the binding site of the target miRNA on the target gene, design a DNA sequence encoding the above fragment according to base complementary pairing, and predict the target sequence to design the miR-TS coding sequence.

[0070] The miRNAs and target sequences with significantly lower content than surrounding tissues in the above HN6 and HepG2 cancer cells were obtained by bioinformatics method: 43 miRNAs with significant differential expression were obtained in 335 cancer samples and 32 cancer-adjacent samples derived from tongue cancer / oral cancer, of which 24 met the requirements; 17 miRNAs with significant differential expression were obtained in 408 cancer samples and 58 cancer-adjacent samples of liver cancer, of which 4 met the requirements. After comprehensive evaluation of differential significance and absolute content in samples, the 3p and 5p binding sites of miR381 and miR490 were selected and predicted, respectively, and the miR-TS coding sequence was designed according to base complementary pairing.

[0071] The miR-TS coding sequence is a completely complementary target sequence of miR381-3p, miR381-5p, miR490-3p or miR490-5p, and the nucleotide sequence is shown in SEQ ID NO:2-SEQ ID NO:5.

[0072] SEQ ID NO: 2: AAATTACTCTAAACCGAACATAT;

[0073] SEQ ID NO: 3: CAAACCTTCCAGTGCTGGAGCGT;

[0074] SEQ ID NO: 4: TTTATACAATCGGGAGGTCCAAT;

[0075] SEQ ID NO: 5: TAGGTTTTGTAGATTTAGGTACT.

[0076] The safety and oncolysis ability of several recombinant strains obtained in the pre-stage were detected, and the details are as follows:

[0077] Three recombinant strains have been obtained in the pre-stage, which are pAd5-mCMV-hIFNG without introducing E1AB coding region, mCMV promoter regulating hIFNG, pAd5-MAGEA6P-E1AB-mCMV-hIFNG with MAGEA6 promoter regulating E1AB and mCMV promoter regulating hIFNG, and pAd5-hTERT-E1AB-mCMV-hIFNG with hTERT promoter regulating E1AB and mCMV promoter regulating hIFNG. The killing ability of the three recombinant strains on non-susceptible and susceptible cells was compared by cell experiment, and the influence of hIFNG regulated by strong promoter carried into cells by replication-deficient vector or selectively replicative vector on cell activity was evaluated. The detection scheme is as follows:

[0078] Virus infection: non-susceptible and susceptible cells in good growth state were trypsinized and inoculated into 96-well plates, and the cell density was ensured to reach 80% after 24 h. Then, virus solution containing replication-deficient Ad5 (Ad5-WT) or the recombinant strain to be tested was diluted with DMEM medium to 100, 200, 400 MOI (in terms of viral genome copy number), and 100 μL of the diluted solution was added to each well. The diluted solution of the blank control group should contain PBS, and the diluted solution of the negative control group should contain WT-Ad5.

[0079] Cell activity detection: 1:10 CCK8 reagent was prepared in a 15 mL centrifuge tube according to the number of wells to be tested, and then mixed well by blowing. The 96-well plate was taken out, and the old culture medium was aspirated. 110 uL of the above CCK8 reagent was added to each well, and the reaction was carried out in the incubator for 2 h. The absorbance at 450 nm wavelength was measured by an enzyme-labeled instrument, and the cell activity was calculated. The results are shown in Figure 2 .

[0080] From Figure 2 it can be seen that, compared with the replication-deficient Ad5-WT strain, the pAd5-mCMV-hIFNG, pAd5-MAGEA6P-mCMV-hIFNG, and pAd5-hTERTP-mCMV-hIFNG recombinant strains can effectively kill non-susceptible Hacat cells and the corresponding susceptible HN6 or HepG2 cells. The cell activity of the three cells linearly decreases after pAd5-mCMV-hIFNG infection, and pAd5-MAGEA6P-mCMV-hIFNG and pAd5-hTERTP-mCMV-hIFNG cause a large decrease in cell activity in the three cells, and reach a similar amplitude to high MOI at low MOI. The killing ability of the above recombinant strains on non-susceptible cells is stronger than that on susceptible cells, and subsequent verification of whether the MAGEA6 promoter can provide selective replication ability for the recombinant strain.

[0081] Nucleic acid amplification, extraction and separation, and the specific test scheme is as follows:

[0082] The recombinant strains pAd5-MAGEA6P and pAd5-hTERTP obtained in the early stage were used to infect non-susceptible and corresponding susceptible cells, and the viral genome copy number in the cell culture supernatant after a certain time was determined to determine whether the MAGEA6 promoter can provide selective replication ability for the recombinant strain.

[0083] Virus infection: non-permissive and permissive cells in good growth state were trypsinized and inoculated into 96-well plates, 24 h later, the virus liquid of the recombinant strain to be tested was diluted to 100, 200, 400 MOI (in terms of viral genome copy number) using DMEM medium, 100 μL of the diluent was added to each well, and the diluent of the blank control group should contain PBS and the diluent of the negative control group should contain WT-Ad5.

[0084] Virus genome extraction: collect the supernatant in all the duplicate wells of each group into a 600 μL EP tube. Add 0.2 mg of proteinase K, digest at 55°C for 1 h, then heat at 95°C for 5 min to inactivate the proteinase, and obtain the virus genome in the supernatant.

[0085] qPCR absolute quantification: use gene-specific probes to detect the genome copy number of the sample. Avoid light, add the following components to a 200 μL EP tube placed on ice:

[0086] 2x Probe qPCR Mix 22 μL

[0087] Ad5 Probe 0.88 μL

[0088] Primer Mix 0.88 μL

[0089] Template 20.24 μL

[0090] Dilute the Ad5 standard in gradient, and configure the system according to 1 / 2 of the above usage for each titer of the standard. Mix and centrifuge, add 10 μL of the mixture to each well of a 384-well plate, and centrifuge at 2500 rpm for 5 min. Place the 384-well plate into a qPCR instrument. Record the data, and obtain the amplification cycle number (Ct value) and the genome copy number of the sample to be tested from the PCR reaction curve and the standard curve when the fluorescence intensity reaches the threshold value, as shown in Figure 3 .

[0091] As can be seen from Figure 3 , after the non-permissive cells Hacat and the permissive cells HN6 were infected with pAd5-MAGEA6P, the genome copy number of the recombinant strain in the culture supernatant of HN6 was significantly higher than that of Hacat after 96 h of experimental period, showing a similar replication ability difference as when pAd5-hTERTP infected non-permissive cells Hacat and permissive cells HepG2, which indicates that pAd5-MAGEA6P has the ability to selectively replicate in cells with higher MAGEA6 transcriptional activity, and the replication ability in normal or immortalized tissue cells is lower than that of the same type of recombinant strain regulated by the hTERT promoter region.

[0092] Example 2

[0093] A method for constructing an oncolytic virus, comprising the following steps:

[0094] Introducing a MAGEA6 promoter based on adenovirus type 5, and then introducing a miR-TS coding sequence and a hIFNG coding gene;

[0095] The nucleotide sequence of the MAGEA6 promoter is shown in SEQ ID NO: 1.

[0096] SEQ ID NO: 1:

[0097] CATCACCATCTTCATGCTTACCTCCACCCCCATCCGATCCCCATCCAGGCAGAATCCAGTTCCACCCCTGCCCGGAACCCAGGGTAGTACCGTTGCCAGGATGTGACGCCACTGACTTGCGCATTGGAGGTCAGAAGACCGCGAGATTCTCGCCCTGAGCAACGAGCGACGGCCTGACGTCGGCGGAGGGAAGCCGGCCCAGGCTCGGTGAGGAGGCAAGGTAAGACGCTGAGGCTCAGATAGTGCCAACGGTGAAGGTTTGCCTTGGATTCAAACCAAGGGCCCCACCTGCCCCAGAACACATGGACTCCAGAGCGCCTGGCCTCACCCTCAATACTTTCAGTCCTGCAGCCTCAGCATGTGCTGGCCGGATGTACCCTGAGGTGCCCTCTCACTTCCTCCTTCAGGTTCTGAGGGGACAGGCTGACGTGGAGGAACAGAGGCCCCCGGAGGAGCACTGAAGGAGAAGATCTGTAAGTAAGCCTTTGTTAGAGCCTCCAAGGTTCCATTCAGTACTCAGCTGAGGTCTCTCACATGCTCCCTCTCTCCCCAGGCCAGTGGGTCTCCATTGCCCAGCTCCTGCCCACACTCCCGCCTGTTGCCCTGACCAGAGTCATC.

[0098] The miR-TS coding sequence is a complete complementary target sequence of miR381-3p (SEQ ID NO: 2), miR381-5p (SEQ ID NO: 3), miR490-3p (SEQ ID NO: 4) or miR490-5p (SEQ ID NO: 5).

[0099] The hIFNG coding gene is co-expressed with the E1AB gene through a P2A self-cleavage peptide, and the nucleotide sequence thereof is shown as SEQ ID NO: 6.

[0100] SEQ ID NO: 6:

[0101] ATGAAGTACACCAGCTACATCCTGGCCTTCCAGCTGTGCATCGTGCTGGGCAGCCTGGGCTGTTATTGCCAAGACCCCTACGTGAAGGAGGCCGAGAACCTGAAGAAGTACTTCAACGCCGGCCACAGCGACGTGGCCGATAATGGCACACTGTTCCTGGGCATCCTGAAGAACTGGAAGGAGGAGAGCGACAGAAAGATCATGCAGAGCCAGATCGTGAGCTTCTACTTCAAGCTGTTCAAGAACTTCAAGGACGACCAGAGCATCCAGAAGAGCGTGGAGACAATCAAGGAGGACATGAACGTGAAGTTCTTCAACAGCAACAAGAAGAAGAGGGACGACTTCGAGAAGCTGACCAACTACAGCGTGACCGACCTGAACGTGCAGAGAAAGGCCATCCACGAGCTGATCCAGGTGATGGCCGAGCTGAGCCCCGCTGCTAAAACAGGCAAAAGAAAGAGAAGCCAGATGCTGTTCAGAGGCAGAAGAGCCAGCCAGTGA.

[0102] Based on the shuttle plasmid of the recombinant strain of the adenovirus type 5 introducing the MAGEA6 promoter and the hTERTP promoter, the 3p (SEQ ID NO: 2) and 5p (SEQ ID NO: 3) TS coding sequences of miR381 and the 3p (SEQ ID NO: 4) and 5p (SEQ ID NO: 5) TS coding sequences of miR490 are connected by using the enzyme digestion and ligation method, and the double-stranded oligonucleotide short fragments are obtained by annealing. The annealing products are respectively connected to the shuttle plasmid pDC316-MAGEA6P or pDC316-hTERTP linearized by HindIII and SalI double enzyme digestion. The products are used to transform the DH5a competent cells, and single colonies are picked and sent for sequencing. After selecting the correct clones, the plasmids are amplified and extracted. The recombinant plasmids are named as pDC316-MAGEA6P-TS and pDC316-hTERTP-TS.

[0103] Based on the shuttle plasmid for packaging pAd5-MAGEA6P-TS recombinant strain, the shuttle plasmid was constructed using recombinant PCR method, and the hIFNG sequence with P2A sequence at the 5' end was inserted between E1AB and miR-TS coding sequence.

[0104] The P2A sequence is shown in SEQ ID NO: 7.

[0105] SEQ ID NO: 7:

[0106] GCTACAAATTTTCAGCCTGCTGAAGCAGGCCGGCGACGTG GAGGAGAACCCCGGCCCC;

[0107] The recombinant plasmid is named pDC316-MAGEA6P-hIFNG-TS, and the inserted miR-TS is indicated by the purple arrow in the map, as shown in Figure 4 .

[0108] Plasmid transformation and amplification: Add DH5a competent cells and plasmid to an EP tube, mix by flicking, and incubate on ice for 30 min. Place the EP tube in a 42°C metal bath for heating, and then take it out and incubate on ice for 5 min. Add Amp-free liquid LB and shake at 200 rpm for 1 h. Add 50 μL of bacterial solution to an Amp-containing solid LB culture plate, spread and air dry, and incubate at 37°C overnight. Pick a single colony into Amp-containing LB medium and incubate overnight, then collect the bacterial solution.

[0109] Plasmid extraction: Use E.Z.N.A Plasmid Mini Kit I kit to extract the plasmid.

[0110] Agarose gel electrophoresis: Add an appropriate amount of 1xTAE to a conical flask, weigh an appropriate amount of agarose according to the desired gel concentration, and then add 3 μL of nucleic acid dye after cooling. Pour into the gel plate and let stand for 20 min until the gel is completely solidified. Place the gel in the electrophoresis tank and add Takara DL5000 DNA marker to the leftmost loading well. Mix the test solution with 6xDNA loading buffer at a ratio of 1:5 and add it to the remaining loading wells. Connect the electrophoresis apparatus, adjust the voltage and electrophoresis time, and place the completed electrophoresis gel in the gel imager to take pictures and collect data.

[0111] Gel recovery: Use the agarose gel DNA recovery kit from TIANGEN to recover the DNA fragments separated by electrophoresis.

[0112] Plasmid construction

[0113] The recombinant PCR method is used to construct a shuttle plasmid for packaging a new recombinant strain, and the human interferon hIFNG coding sequence is introduced into the viral genome. The A6 promoter is coupled with the similar expression form of the viral E1A-E1B55K gene, and the constructed plasmid is sent to Beijing Genki Biotechnology Co., Ltd. for sequencing, and the correct clone is selected, amplified and extracted. The shuttle plasmid pDC316-MAGEA6P-E1AB-hIFNG-TS containing the corresponding miR-TS is constructed for introducing the recombinant strain, and the influence of these sequences on the replication capacity of the recombinant strain is investigated and compared. At the cell level, the killing ability of the susceptible cells is detected. The test scheme is as follows:

[0114] The double-stranded DNA oligos are annealed, and the following components are added to a 200ul EP tube:

[0115] 10xPCRBuffer 2μL

[0116] DNAoligos mixture 6μL

[0117] Enzyme-free water 12μL

[0118] Mix and centrifuge, and place the EP tube into a PCR instrument, and set the reaction program.

[0119] Enzymatic digestion and ligation: use two different restriction enzymes and the corresponding buffers to obtain a linearized vector fragment. Add the following components to a 200ul EP tube placed on ice:

[0120] NEBuffer 5μL

[0121] Endonuclease A 1.5μL

[0122] Endonuclease B 1.5μL

[0123] Template 1ug

[0124] Enzyme-free water to 50ul

[0125] Mix and centrifuge, and place the EP tube into a PCR instrument, and determine the reaction conditions and inactivation conditions according to the type of endonuclease, and recover the linearized vector as a long fragment to construct a plasmid.

[0126] Use T4 ligase to connect the short fragment and the long fragment. Add the following components to a 200ul EP tube placed on ice:

[0127] T4Buffer 2μL

[0128] T4 ligase 2μL

[0129] Short fragment 4μL

[0130] Long fragment >50ng / 12μL

[0131] Mix and spin down, place EP tube in PCR machine, set reaction program.

[0132] Recombineering PCR: Linearize vector fragment using restriction enzyme and corresponding buffer. In a 200 μL EP tube on ice add the following components:

[0133] NEBuffer 5 μL

[0134] Restriction enzyme 1.5 μL

[0135] Template 1 ug

[0136] Nuclease free water to 50 μL

[0137] Mix and spin down, place EP tube in PCR machine, set reaction program and inactivation conditions according to enzyme type, recover linearized vector.

[0138] Amplify long fragment using linearized vector as template. In the same EP tube add the following components:

[0139] 2 x PhantaMax Master Mix 25 μL

[0140] Primer mix 4 μL

[0141] Template 1 ug

[0142] Nuclease free water to 50 μL

[0143] Mix and spin down, place EP tube in PCR machine, set reaction program.

[0144] Amplify short fragment using plasmid containing fragment of interest as template. In a 200 μL EP tube on ice add the following components:

[0145] 2 x Taq Plus Master Mix 25 μL

[0146] Primer mix 4 μL

[0147] Template 1 ug

[0148] Nuclease free water to 50 μL

[0149] Mix and spin down, place EP tube in PCR machine, set reaction program.

[0150] Use CE recombinase to ligate short and long fragment. In a 200 μL EP tube on ice add the following components:

[0151] 2 x CE Mix 5 μL

[0152] Short fragment 1.25 μL

[0153] Long fragment 3.75 μL

[0154] Mix and centrifuge, put the EP tube into PCR instrument, set the reaction program. The pDC316-MAGEA6P-TS and pDC316-hTERTP-TS shuttle plasmids were successfully constructed and placed at 4℃ for standby or stored at -20℃.

[0155] Bacterial liquid PCR:

[0156] According to the structure of the plasmid to be tested, design PCR primers, at least one primer binding site should be completely located on the exogenous sequence. Take an appropriate amount of bacterial liquid to be tested, heat at 95℃ to break the bacterial body. Use the heated bacterial liquid as a template to detect whether it contains the fragment to be tested. Add the following components to the 200 μL EP tube placed on ice:

[0157] 2x TaqPlus Master Mix 25 μL

[0158] Primer mixture 4 μL

[0159] Template 10 μL

[0160] Enzyme-free water to 50 μL

[0161] Mix and centrifuge, put the EP tube into PCR instrument, the reaction program is 95℃ for 3 min -> (95℃ for 30 s -> 55℃ for 30 s -> 72℃ for 60 s) x 30 cycles -> 72℃ for 5 min. After 1% agarose gel electrophoresis, observe in the gel imaging system. Since the primer binding site is located on the exogenous sequence, if the primer can bind to the template and amplify a band, it proves that the exogenous sequence has been successfully connected to the plasmid. The pDC316-MAGEA6P-hIFNG-TS shuttle plasmid was successfully constructed and placed at 4℃ for standby or stored at -20℃.

[0162] Virus packaging, virus replication capacity determination

[0163] Using the Admax packaging system, the successfully constructed pDC316-MAGEA6P-TS and pDC316-hTERTP-TS, pDC316-MAGEA6P-hIFNG-TS shuttle plasmids were co-transfected with pBHG backbone plasmid into HEK293 cells, obtaining pAd5-MAGEA6P-TS, pAd5-hTERTP-TS and pAd5-MAGEA6P-hIFNG-TS complete type recombinant strains.

[0164] The pAd5-MAGEA6P-TS, pAd5-hTERTP-TS and pAd5-MAGEA6P-hIFNG-TS full-type recombinant strains were used to infect 2000 non-susceptible or susceptible cells in each well of a 96-well plate at 100, 200, 400 MOI, and the replication capacity was detected by qPCR absolute quantification 96 h later, and the results are shown in Figure 5 .

[0165] As can be seen from Figure 5 , compared with pAd5-MAGEA6P and pAd5-hTERTP, the replication capacity of pDC316-MAGEA6P-TS and pDC316-hTERTP-TS recombinant strains in non-susceptible and susceptible cells was decreased. Although the replication capacity in susceptible cells was also affected to a certain extent, the selectivity of the replication capacity was more significant.

[0166] The pAd5-MAGEA6-hIFNG-TS recombinant strain was used to infect non-susceptible or susceptible cells at 100, 200, 400 MOI, and the killing capacity and replication capacity were detected every 24 h, and the changes in cell activity and supernatant virus load are shown in Figure 6 - Figure 8 .

[0167] As can be seen from Figure 6 - Figure 8 , under the same conditions, the cell activity decreased after 48 h of infection of Hacat and HN6, but the slope of the change curve of the cell activity was larger and the decrease was faster after infection of HN6. After infection of Hacat at 400 MOI, the virus replication was significantly faster, and after infection of HN6, the supernatant virus load had been maintained at a high level from 24 h or earlier, indicating that the initial content of the recombinant strain may affect its effect. pAd5-MAGEA6P-hIFNG-TS has good safety in non-susceptible cells, and has the potential to enhance the killing capacity with the increase of infection time.

[0168] The successfully constructed pDC316-MAGEA6P-TS and pDC316-hTERTP-TS, pDC316-MAGEA6P-hIFNG-TS shuttle plasmids were co-transfected with pBHG backbone plasmids into HEK293 cells, and P0 generation virus was collected 14 d later. The P0 generation virus was used to infect HEK293 cells, and cell lesions were observed again 72 h later, proving that the P1 generation virus has the ability to infect, and can be used for amplification and subsequent experiments. The P1 generation virus was collected, and the Ad5 genome copy number was determined by qPCR absolute quantification.

[0169] Co-transfection: well-grown HEK293 cells were seeded in 6-well plates, 2 ug plasmid DNA was added to EP tube containing Transfection Buffer, vortexed for 5 s, Transfection Reagent was added, vortexed for 1 s, and incubated at room temperature for 10 min. While shaking the 6-well plate, the mixture was added to the wells, and low serum DMEM medium was replaced after 4 h.

[0170] Virus collection and passage: after observing the rounding-off and shedding of cells in the 6-well plate containing infected cells, the cells and supernatant were collected and transferred to a 2-ml EP tube, which was repeatedly frozen and thawed at -80℃ / 37℃ for 3 times. After centrifugation at 5000 r for 5 min, the supernatant was collected.

[0171] Virus genome extraction: the supernatant in all the replicate wells of each group was collected into a 600-μL EP tube. After digestion with 0.2 mg of proteinase K at 55℃ for 1 h, the proteinase was inactivated by heating at 95℃ for 5 min to obtain the virus genome in the supernatant.

[0172] qPCR absolute quantification: gene-specific probes were used to detect the genome copy number of the sample. In the dark, the following components were added to a 200-μL EP tube placed on ice:

[0173] 2x Probe qPCR Mix 22 μL

[0174] Ad5 Probe 0.88 μL

[0175] Primer Mix 0.88 μL

[0176] Template 20.24 μL

[0177] The Ad5 standard was diluted in gradient, and the standard of each titer was configured according to 1 / 2 of the above-mentioned usage amount. After mixing and centrifugation, 10 μL of the mixture was added to each well of a 384-well plate, which was centrifuged at 2500 rpm for 5 min. The 384-well plate was placed in a qPCR instrument. The data were recorded, and the amplification cycle number (Ct value) and the genome copy number of the sample to be detected were obtained from the PCR reaction curve and the standard curve when the fluorescence intensity reached the threshold value.

[0178] Flow protein content determination, the specific test scheme is as follows:

[0179] Determination of the endogenous hIFNG content in Hacat cells infected with pAd5-MAGEA6P-mCMV-hIFNG, pAd5-MAGEA6P-hIFNG-TS recombinant strains, well-grown cells to be tested were inoculated in a 6-well plate, the cells were digested with trypsin and transferred to a 1.5 mL EP tube, centrifuged at 2000 r for 5 min, the supernatant was discarded, 200 μL of PBS containing 1% FBS was added to wash the cells, and centrifuged at 2000 r for 5 min. Discard the supernatant, add 200 μL of PBS containing 0.1% Triton-X100, incubate at 4°C for 30 min, then add 5 μL of antibody, continue to incubate for 30 min or more, centrifuge at 2000 r for 5 min. Discard the supernatant, add 200 μL of PBS containing 0.1% Triton-X100 to remove the antibody, use a pipette to blow the cell suspension through a sieve and collect it into a flow tube. The results are as follows Figure 9 .

[0180] It can be seen from Figure 9 that the hIFNG content after infection with pAd5-MAGEA6P-hIFNG-TS complete recombinant strain is significantly lower than that after infection with the other two strains, and the results show that coupling the production of hIFNG with virus replication indeed helps to reduce the production of endogenous hIFNG after the recombinant strain enters non-susceptible cells, and improves safety.

[0181] Virus amplification and purification: study the direct killing effect of the complete recombinant strain on tumors and the effect of virus infection on the life status of mice. First, purify the pAd5-MAGEA6P-E1AB-hIFNG-TS recombinant strain after mass amplification, and intravenously inject BALB / C mice to analyze the safety of the above-mentioned recombinant strain by observing the body weight and the state of the main organs after dissection of BALB / C mice. The HN6 xenotransplantation model constructed using nude mice is used to detect the killing effect of the above-mentioned strain on tumors in the tumor microenvironment.

[0182] Virus mass amplification: in order to obtain easily separable virus bands in the subsequent purification step, about 10 10 cm culture dishes or more area of cells are needed for amplification. Observe the cell state daily, and prepare for recovery when the cells are observed to be round under a microscope and about to fall off. Blow the bottom of the bottle or pat to make the cells fall off, transfer the cells to a centrifuge tube, centrifuge at 2000 rpm for 5 min, repeat several times until all the cells are precipitated at the bottom of the centrifuge tube, collect the supernatant and store at -20°C. Resuspend the cells using 6 mL of the above-mentioned DMEM and collect them in several EP tubes, freeze-thaw 3 times, and store at -20°C for later use.

[0183] Virus purification: Take out the EP tube containing virus liquid, centrifuge at 10000r for 5min. Transfer the supernatant to a 15mL centrifuge tube, add 1uL nuclease, react at room temperature for 10min. Slowly add 1.5mL CsCl solution with density of 1.35, 1.3, 1.25g / mL to the empty test tube in turn, add the virus liquid treated by nuclease on the uppermost layer, and supplement PBS to fill the test tube. Put the test tube into an ultracentrifuge tube, centrifuge at 40000r for 90min at 4℃. After centrifugation, take out the test tube, carefully suck off the liquid above the complete virus band, use a syringe to suck out the solution near the band and inject into a dialysis card. Put the dialysis card into a suitable container, pour dialysis solution containing Tris-HCl and sucrose to the liquid level in the dialysis card.

[0184] The weight changes of BALB / C mice and nude mice within 14d after the pAd5-MAGEA6P-E1AB-hIFNG-TS recombinant strain was injected into the tail vein of BALB / C mice or the tumor of nude mice inoculated with HN6 xenograft in the forelimb axilla are shown in Figure 10 The life state and weight have no obvious change compared with the blank group injected with PBS and the negative control group injected with Ad5-WT replication-deficient strain, which indicates that the safety evaluation in BALB / C mice shows that the recombinant strain still maintains good safety in vivo.

[0185] The tumor samples of HN6 xenograft nude mice were recovered after the recombinant strain was injected into the nude mice as the HN6 xenograft model by the foregoing method, and the results are shown in Figure 11 The tumor volume of the experimental group is obviously smaller than that of the blank group and the control group, which indicates that the complete recombinant strain shows a certain effect of killing tumor cells and inhibiting the growth of tumor tissue in mice.

[0186] Finally, it should be noted that: the above examples are only used to illustrate the technical solutions of the present application rather than limit them, although the present application has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technical solutions of the present application can still be modified or replaced by equivalents, and these modifications or equivalent replacements cannot make the modified technical solutions deviate from the spirit and scope of the technical solutions of the present application.

Claims

1. An oncolytic virus providing replication selectivity by a promoter and mir-TS, characterized in that, The oncolytic virus comprises: a MAGEA6 promoter, a miR-TS coding sequence, and a human interferon gamma-hIFNG coding gene.

2. The oncolytic virus of claim 1, wherein, The MAGEA6 promoter is used to regulate the expression of an adenovirus E1AB gene, and the MAGEA6 promoter is selected from a nucleotide sequence that activates transcription in MAGEA6 high-expression cells, as shown in SEQ ID NO:

1.

3. The oncolytic virus of claim 1, wherein, The miR-TS coding sequence is a complete complementary target sequence of miR381-3p, miR381-5p, miR490-3p or miR490-5p, and the nucleotide sequence is shown in SEQ ID NO: 2-SEQ ID NO 5.

4. The oncolytic virus of claim 1, wherein, The hIFNG coding gene is co-expressed with the E1AB gene through a P2A self-cleavage peptide, and the nucleotide sequence is shown in SEQ ID NO:

6.

5. The oncolytic virus of claim 4, wherein the oncolytic virus is a herpes simplex virus (HSV) or an adenovirus. The oncolytic virus is constructed based on adenovirus type 5, and the E1 region and the E3 region are deleted, and the MAGEA6 promoter, the miR-TS coding sequence and the hIFNG coding gene are introduced by homologous recombination.

6. A method of constructing an oncolytic virus according to any one of claims 1 to 5, wherein, The method comprises the following steps: S1, introducing a MAGEA6 promoter based on adenovirus type 5, and then introducing a miR-TS coding sequence and a hIFNG coding gene; S2, inserting the sequences into a shuttle plasmid by enzyme digestion and ligation or recombination PCR method to construct a recombinant shuttle plasmid; S3, co-transfecting the recombinant shuttle plasmid obtained in S2 with a backbone plasmid into HEK293 cells to obtain an oncolytic virus vector strain for MAGEA6 high-expression tumors according to any one of claims 1-5.

7. Use of the oncolytic virus according to any one of claims 1-5 in the preparation of a medicament for treating MAGEA6 high-expression tumors.

8. Use according to claim 7, characterized in that, The MAGEA6 high-expression tumors include tongue cancer, liver cancer or esophageal cancer.

9. A pharmaceutical composition, characterized by, The pharmaceutical composition comprises the oncolytic virus according to claim 1 and a pharmaceutically acceptable carrier.

10. The pharmaceutical composition according to claim 9, wherein The pharmaceutical composition is administered by intratumoral injection, intraperitoneal administration or intravenous administration.

Images