Construction method and application of Elizabeth mileli for expressing Nanoluc luciferase

Abstract

The invention discloses a construction method and an application of Elizabeth mileli for expressing Nanoluc luciferase. The Elizabeth mileli can be used for expressing Nanoluc luciferase. The coding gene of the Nanoluc luciferase is knocked into the genome of the Elizabeth mileli FL160902 strain in a fixed-point manner through a homologous recombination technology, so that the report strain capable of stably expressing the luciferase is successfully constructed. The reporter strain has normal growth characteristics, and the in-vitro detection sensitivity can reach 100 CFU. By utilizing a xenopus laevis infection model, the real-time dynamic tracing of the report strain in a living animal body is realized for the first time. The Nluc report strain constructed by the invention has the characteristics of strong luminescence stability, high detection sensitivity and the like, and provides a high-sensitivity visual research tool for analyzing the infection dynamic state and pathogenic mechanism of Elizabeth mileli.

Description

Technical Field

[0001] This invention belongs to the field of bioluminescence imaging technology, specifically relating to a method for constructing and applying Elizabethan mil expressing Nluc luciferase. Background Technology

[0002] Elizabethan miltiorrhiza ( Elizabethkingiamiricola This disease can infect various farmed and wild frogs, causing frog meningoblastic septicemia (commonly known as "wry neck disease"). It is highly contagious and has a high mortality rate, seriously jeopardizing frog farming in my country. Currently, the infection routes, colonization characteristics, and migration patterns of *Elizabeth mil* in frogs are still unclear. There is an urgent need to establish a highly sensitive tracing technology that can track the pathogen in real time and in situ to elucidate its pathogenic mechanism.

[0003] Bioluminescence imaging technology generates light signals through a substrate-specific catalytic reaction of luciferase, offering advantages such as low background noise, real-time visualization, and high spatiotemporal resolution. Among these, light signals derived from deep-sea shrimp (…) Oplophorusgracilirostris The NanoLuc (Nluc) luciferase system, due to its substrate diversity, strong tissue penetration, and excellent signal-to-noise ratio, has become an ideal reporter tool for bacterial in vivo tracing, demonstrating extremely high application value in real-time monitoring of bacterial infection processes. Currently, there is no luciferase-based in vivo tracing technology for *Elizabeth mil*, which greatly limits the analysis of the interaction mechanism between this bacterium and its host. Based on this, this invention constructs an Nluc-labeled *Elizabeth mil* reporter strain and establishes a visualization tracing platform for this bacterium in live animals (amphibians), providing technical support for elucidating the infection dynamics and pathogenic mechanisms of *Elizabeth mil*. Summary of the Invention

[0004] The purpose of this invention is to provide a *Elizabethan mil* strain expressing Nluc luciferase. This strain exhibits excellent genetic stability and can stably express Nluc protein under antibiotic-free selective pressure. The bioluminescent signal generated by this strain has ultra-high sensitivity and a high signal-to-noise ratio, making it suitable for real-time, dynamic, and quantitative tracing of the *Elizabethan mil* infection process in live animal models.

[0005] Another objective of this invention is to provide a method for preparing Elizabethan mierneae expressing Nluc luciferase. This method is based on homologous recombination technology, which precisely integrates the marker gene into a specific site in the Elizabethan mierneae genome, and features simple operation and high efficiency.

[0006] Another objective of this invention is to provide an application of Elizabethan milneaculosa expressing Nluciferase in animal models. Using this engineered strain, dynamic visualization of Elizabethan milneaculosa infection was achieved for the first time in an amphibian model, supporting continuous monitoring of the systemic infection process and providing key technical support for studying the pathogenic mechanism of this bacterium.

[0007] To achieve the above objectives, the present invention adopts the following technical solution: The gene encoding Nluc luciferase was inserted into the genome of Elizabethan mierne Elizabethan strain using homologous recombination technology; preferably, it was inserted between the FE632_RS03525 and FE632_RS03526 genes in the genome (NZ_CP040516.1) of Elizabethan mierne Elizabethan strain FL160902; thus, Elizabethan mierne Elizabethan strain expressing Nluc luciferase was obtained.

[0008] The technical solution of this invention is as follows: A method for constructing Elizabethan mierella expressing Nanoluc luciferase includes the following steps: 1) Construct the recombinant plasmid Nluc-Up-Down-pYT354; 2) The recombinant plasmid Up-Down-Nluc-pYT354 obtained in step 1) was introduced into Elizabethan miernea strain via conjugation transfer. The Nluc luciferase gene was integrated into the strain genome using homologous recombination technology to obtain Elizabethan miernea expressing Nluc luciferase.

[0009] Preferably, step 1) includes: 1.1) Using the fragment between the FE632_RS03525 and FE632_RS03526 genes of Elizabethan mil FL160902 as the knock-in site, PCR amplification was performed using Up-F / R and Down-F / R respectively to obtain the upstream and downstream homologous arm fragments of the knock-in site. 1.2) Based on the multiple cloning restriction sites of plasmid pYT354, the suicide plasmid pYT354 was double-digested with SacI and KpnI. The upstream and downstream homologous arm fragments obtained in step 1.1) were seamlessly ligated into the linearized vector pYT354 to construct the gene knock-in plasmid Up-Down-pYT354. 1.3) Using plasmid Nluc-PUC-SP as a template, nluc Gene primer PCR amplification yields promoter- nluc Fragment fusion; 1.4) The gene knock-in plasmid Up-Down-pYT354 obtained from SalI and BamHI double digestion step 1.2) is then inserted into the promoter- nluc The fusion fragment was seamlessly cloned into the gene knock-in plasmid Up-Down-pYT354, and the ligation product was transformed into competent cells. E. coli S17-1 λpir was plated on BHI plates containing 100 μg / mL ampicillin and incubated at 37°C for 16 h. Positive clones were screened and identified by PCR using internal primers of the nluc gene, which confirmed the presence of the recombinant plasmid Up-Down-Nluc-pYT354. E. coli The S17-1λpir strain was used to extract plasmids to obtain the recombinant plasmid Up-Down-Nluc-pYT354.

[0010] The enzyme digestion system used in steps 1.2) and 1.4) is as follows: Enzyme digestion system volume 10×Quick Cut buffer 3 μL 1 μg of plasmid 1 μL of restriction endonuclease Add ddH2O to 30 μL; Enzyme digestion reaction conditions: 37℃ for 30 min.

[0011] The ligation system used for seamless cloning in steps 1.2) and 1.4) is: Connecting system volume 2×MultiF Seamless Assembly Mix 10μL Linearized carrier 0.03 pmol Fragment 0.06 pmol Add ddH2O to 20 μL; Recombination reaction conditions: Recombination at 50℃ for 30 min.

[0012] Preferably, step 2) includes: 2.1) The plasmid Up-Down-Nluc-pYT354 obtained in step 1) E. coli S17-1 λpir was used as the donor bacterium, and Elizabethan mil was used as the donor bacterium FL160902 for conjugation transfer; 2.2) Incubate the donor and recipient bacteria overnight to the logarithmic phase; 2.3) Mix the donor bacteria and recipient bacteria at a volume ratio of 1:1 to 4:1 (preferably 2:1) and drop the mixture onto a BHI plate covered with a nitrocellulose membrane, and incubate at 37°C for 24 h. 2.4) The bacterial growth on the membrane was washed off with BHI liquid medium and spread onto BHI containing 50 μg / mL erythromycin. The culture was then incubated at 37°C for 48 h. Single colonies from the plates were subcultured on BHI liquid medium and spread onto BHI plates containing 10% sucrose. The culture was then incubated at 37°C for 48 h. Single colonies from the sucrose plates were selected for PCR verification to obtain Elizabethan mierne Elizabethan, which expresses Nluc luciferase.

[0013] The PCR verification described in step 2.4) specifically involves: using... nluc Gene primer Pro- nluc PCR amplification was performed using -F / R, and the Nluc-labeled strain yielded a 583bp amplification product, while the wild-type strain did not. nluc PCR amplification was performed using external primers check-F / R. The amplification product obtained from the Nluc-labeled strain differed from that of the wild-type strain by 500 bp.

[0014] The primer sequences used in the above method are as follows: Primer sequence 5'-3' Up-F GGGAACAAAAGCTGGAGCTCGGTGGAGCACCTATGT Up- R TCGTATGAGGGCTCTTTTTGTTAATTTG Down-F ACGAGGATCCTGTCGACGGGCCTCTGTAATAAT Down- R TAGGGCGAATTGGGTACCGGAACCCCTGCTCAA Pro-nluc-F AGAGCCCTCATACGAGGATCCCTTGCCACATTTGGTG Pro-nluc- RTTATTACAGAGCCCGTCGACCTTACGCCAGAATGCG Check-F ACAATACCAATCAGGCAG Check- R CTTATGGCATTCTGCCAA.

[0015] This invention also provides the application of Elizabethan mierne filtrate expressing Nluc luciferase in real-time dynamic tracking in amphibians; comprising the following steps: (1) overnight culture of Elizabethan mierne filtrate expressing Nluc luciferase to the logarithmic growth phase, washing 3 times with sterile PBS to obtain a bacterial suspension; (2) intraperitoneal injection of a concentration of 10... 7(3) The African clawed frog was subjected to in vivo optical imaging analysis on days 1, 3, 5 and 7 after infection.

[0016] Compared with the prior art, the present invention has the following advantages and effects: 1. Highly Genetically Stable Engineered Bacteria: Based on homologous recombination technology, the Nluc expression cassette was precisely integrated into a specific site in the genome of *Elizabeth Mildred*, successfully constructing a recombinant engineered strain. This strain overcomes the genetic instability limitation of traditional plasmid vectors that rely on antibiotics for maintenance, and can continuously and stably express the Nluc protein even without antibiotic selection pressure.

[0017] 2. Precise and efficient construction method: Utilizing genome-specific homologous recombination technology, the Nluc gene is directionally integrated, effectively avoiding the risk of strain virulence distortion caused by random insertion. This method offers significant advantages such as simple operation, high integration efficiency, and short construction cycle. Furthermore, it has broad applicability and can be extended to other species within the genus *Elizabeth*.

[0018] 3. Pioneering Application Value: For the first time, dynamic visualization of Elizabethanella miltiorrhiza infection was achieved in an amphibian model (frog). Using this engineered strain, the bacterial infection pathway can be monitored quantitatively in real time, capturing the spatiotemporal dynamics of systemic infection, providing a key tool platform for elucidating the pathogenic mechanism of the bacteria. Attached Figure Description

[0019] Figure 1 This is a schematic diagram of the recombinant plasmid Nluc-Up-Down-pYT354. Figure 2 This is a schematic diagram of PCR identification of a Nluc reporter strain. Figure 3 Growth curves for a Nluc reporter strain and a wild-type strain; Figure 4 This is a schematic diagram illustrating the correlation between the concentration of Nluc reporter bacteria culture and luminescence intensity. Figure 5 This is a schematic diagram of in vivo imaging results of Xenopus laevis on days 1, 3, 5, and 7 after infection with a Nluc reporter bacterium. Detailed Implementation

[0020] This application uses Elizabethanella miltiorrhiza FL160902 as an example to further illustrate the present invention; The Elizabethan mil FL160902 strain used was preserved in the Aquatic Animal Disease Control and Healthy Aquaculture Laboratory of the College of Fisheries, Huazhong Agricultural University; its whole genome information has been published: Hu Ruixue. Identification, Molecular Epidemiology and Carbapenemase Diversity Study of Elizabethan mil from Frogs [D]. Hubei: Huazhong Agricultural University, 2020. E. coli S17-1 λpir source: purchased from Weidi Biotechnology Co., Ltd.

[0021] The plasmid Nluc-PUC-SP was synthesized by Sangon Biotech Co., Ltd.; PUC-SP is a commercially available cloning plasmid provided by Sangon Biotech Co., Ltd.; the Nluc sequence is shown in SEQ ID NO.3; Sangon Biotech Co., Ltd. synthesized the plasmid by ligating the Nluc sequence into the commercially available plasmid PUC-SP, and will subsequently use this plasmid as a template to amplify the Nluc fragment.

[0022] Plasmid pYT354: kindly provided by Associate Professor Yongtao Zhu of Xi'an Jiaotong-Liverpool University. This plasmid and its preparation method are disclosed in Zhu Y, et al 2017, Genetic analyses unravel the crucial role of ahorizontally acquired alginate lyase for brown algal biomass degradation by Zobellia galactanivorans. Environ Microbiol 19:2164–2181. The complete genome sequence of this suicide plasmid pYT354 is shown in SEQ ID NO.4.

[0023] Brain Heart Infusion (BHI) medium was purchased from Qingdao Haibo Company; agar powder was purchased from Bioroxx AG, Germany.

[0024] BHI liquid culture medium: Dissolve 38.5 g of BHI powder in 800 mL of distilled water, bring the volume up to 1 L, dispense into containers, and autoclave at 121°C for 25 min. BHI solid medium: 1.5% agar powder is added to its liquid medium, and then it is sterilized by high temperature and high pressure steam.

[0025] Example 1: This embodiment provides a method for constructing Elizabethan mierae engineered bacteria expressing Nluc luciferase, comprising the following steps: 1. Construction of recombinant plasmid Nluc-Up-Down-pYT354 (1) The nucleotide sequence of the fragment between the FE632_RS03525 gene and the FE632_RS03526 gene of Elizabethan mil FL160902 (Gen Bank: CP040516) (70 bases between positions 782215-782285) is shown in SEQ ID NO.1, where the knock-in site is between positions 45 and 46. Primers (Up-F / R and Down-F / R) were designed to amplify the upstream homologous arm sequence and the downstream homologous arm fragment of this site by PCR, respectively. The amplified fragment was purified by a gel extraction kit.

[0026] SEQ ID NO.1 AGGATATATCCACATAACAAATTAACAAAAAGAGCCCTCATACGA (knock-in site)GGGCTCTGTAATAATTCGGGATTTA (2) Based on the multiple cloning restriction sites of the suicide plasmid pYT354, the suicide plasmid pYT354 was double-digested with SacI and KpnI. The upstream and downstream homologous arms were then seamlessly cloned and ligated into the linearized vector pYT354 to construct the gene knock-in plasmid Up-Down-pYT354.

[0027] (3) Using plasmid Nluc-PUC-SP as a template, a promoter was designed. nluc Fusion fragment primer (Pro- nluc The fragment was amplified by PCR (-F / R), and the amplified fragment was purified using a gel extraction kit. The nucleotide sequence of the promoter is shown in SEQ ID No. 2, and the nucleotide sequence of the luciferase gene is shown in SEQ ID No. 3.

[0028] (4) The gene was knocked into plasmid Up-Down-pYT354 by double digestion with SalI and BamHI, and the promoter was... nluc The fusion fragment was seamlessly cloned and ligated into a linearized vector, and the ligation product was transformed into competent cells. E. coli S17-1λpir was plated on BHI plates containing 100 μg / mL ampicillin and incubated at 37°C for 16 h. Positive clones, i.e., those containing the recombinant plasmid Nluc-Up-Down-pYT354, were screened. E. coli S17-1λpir, plasmid extraction, finally obtained the recombinant plasmid Nluc-Up-Down-pYT354 ( Figure 1 (For plasmid mapping).

[0029] The primers used are as follows: Primer sequence 5'-3' Up-F GGGAACAAAAGCTGGAGCTCGGTGGAGCACCTATGT Up- R TCGTATGAGGGCTCTTTTTGTTAATTTG Down-F ACGAGGATCCTGTCGACGGGCCTCTGTAATAAT Down- R TAGGGCGAATTGGGTACCGGAACCCCTGCTCAA Pro-nluc-F AGAGCCCTCATACGAGGATCCCTTGCCACATTTGGTG Pro-nluc- RTTATTACAGAGCCCGTCGACCTTACGCCAGAATGCG Check-F ACAATACCAATCAGGCAG Check-R CTTATGGCATTCTGCCAA The PCR amplification conditions in steps (1), (3) and (4) are the same: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, 55℃ annealing for 40 s, 72℃ extension for 60 s, 30 cycles; final extension at 72℃ for 10 min; and incubation at 16℃.

[0030] The enzyme digestion systems in steps (2) and (4) are as follows: Enzyme digestion system volume 10×Quick Cut buffer 3 μL 1 μg of plasmid 1 μL of restriction endonuclease Add ddH2O to 30 μL; Enzyme digestion reaction conditions: 37℃ for 30 min.

[0031] The seamless cloning linkage system in steps (2) and (4) is as follows: Connecting system volume 2×MultiF Seamless Assembly Mix 10μL Linearized carrier 0.03 pmol Fragment 0.06 pmol Add ddH2O to 20 μL; Recombination reaction conditions: Recombination at 50℃ for 30 min.

[0032] 2. Construction of Nluc reporter strains (1) Take the plasmid Up-Down-Nluc-pYT354 obtained in step 1 (4) E. coli S17-1 λpir was used as the donor bacterium, and Elizabethan mil was used as the donor bacterium FL160902 for conjugation experiments.

[0033] (2) Incubate the donor and recipient bacteria overnight to the logarithmic phase.

[0034] (3) Mix the donor bacteria and recipient bacteria at a volume ratio of 2:1: Take 1 mL of donor bacteria and 0.5 mL of recipient bacteria into a 2 mL sterile centrifuge tube, centrifuge at 5000 r / min for 5 min, discard the supernatant, add 100 μL BHI liquid medium to resuspend the bacteria, drop the well mixed bacterial solution onto a BHI plate covered with a nitrocellulose membrane, and incubate at 37℃ for 24 h.

[0035] (4) Wash the bacterial growth off the membrane with BHI liquid medium, spread it onto a BHI plate containing 50 μg / mL erythromycin, and incubate at 37°C for 48 h. Single colonies from the plate are then subcultured on BHI liquid medium and spread onto a BHI plate containing 10% sucrose, and incubated at 37°C for 48 h. Single colonies from the sucrose plate are then used for PCR verification. Figure 2 As shown, using nluc Gene primer Pro- nluc PCR amplification was performed using -F / R, and the Nluc-labeled strain yielded a 583bp amplification product, while the wild-type strain did not. nluc PCR amplification was performed using external primers check-F / R. The amplification product obtained from the Nluc-labeled strain differed from that of the wild-type strain by approximately 500 bp. The sequencing results of the PCR products were all correct.

[0036] 3. Growth performance of Nluc report strains Under incubation conditions at 37°C, the OD values ​​of the Nluc reporter strain and the wild-type strain FL160902 were continuously measured for 24 h. 600 Values ​​and plot growth curves. For example... Figure 3 As shown, all Nluc reporter strains entered the logarithmic growth phase at around 6 h and the stationary growth phase at around 18 h, and the growth rate of Nluc reporter strains was not significantly different from that of wild strains.

[0037] 4. Luminescent properties of Nluc reporter strains The Nluc reporter strain was cultured overnight to the logarithmic growth phase, diluted with PBS, and prepared into 1×10⁻⁶ cells / day. 2 1×10 3 1×10 4 1×10 5Bacterial suspensions at different CFU / ml concentrations were prepared. 50 μL of each bacterial suspension was mixed with 50 μL of substrate and added to a black opaque 96-well plate. Luminescence images and signals were acquired using a small animal in vivo optical imaging system. Figure 4 As shown, the luminescence intensity of the Nluc reporter strain is linearly correlated with the bacterial count, and the in vitro detection sensitivity of the reporter strain can reach 100 CFU.

[0038] Example 2: Application of Elizabethan mil, expressing Nluc luciferase, obtained in Example 1, in an amphibian infection model: (1) The Nluc reporter strain obtained in Example 1 was cultured overnight to the logarithmic growth phase, and the bacterial solution was washed 3 times with sterile PBS; (2) Using an albino Xenopus laevis infection model, 10 mg of the drug was injected intraperitoneally. 7 CFU Nluc reporter strain suspension was used for in vivo imaging monitoring on days 1, 3, 5, and 7 post-infection. Each Xenopus received an intraperitoneal injection of 40 μL and a brain injection of 20 μL of substrate before imaging. After 15 minutes of fluid circulation, the animal was anesthetized with 0.1% MS222 for 10 minutes, followed by ventral imaging using a small animal in vivo optical imaging system. In vivo imaging results showed ( Figure 5 The Nluc reporter strain mainly colonized the abdominal cavity and brain region of Xenopus laevis. Its bioluminescent signal intensity showed a significant increasing trend with the extension of infection time, indicating that the strain has the ability to continuously proliferate in the host and can cross the blood-brain barrier to infect brain tissue.

[0039] Comparative Example 1: Differences in the effects of different plasmid selections in step 1 of Example 1: Recombinant plasmids were constructed using Escherichia coli expression vectors PET-30a, PET-32a, PGEX-4T-1, PGEX-5X-1, Escherichia coli cloning vector pACYC184, and Riemerella anatipestifer shuttle expression vector PLMF03, respectively. None of the constructed recombinant plasmids could be transformed into Elizabethan mil.

[0040] Comparative Example 2: Differences in the effects of different methods of transforming recombinant plasmids into Elizabethan bacilli The recombinant plasmid Nluc-Up-Down-pYT354 was transformed into Elizabethan mil using conventional electroporation, but the transformation was unsuccessful.

[0041] Comparative Example 3: Changes in bonding transfer conditions (other settings are the same as in Example 1) 1. Ratio of donor bacteria to recipient bacteria Donor and recipient bacteria were cultured overnight in BHI liquid medium to the logarithmic growth phase (OD). 600(≈1.0), mixed at volume ratios of 1:1, 2:1, 3:1, and 4:1. The mixed bacterial suspensions were centrifuged at 5,000 × g for 5 min, the supernatant was discarded, and the suspension was resuspended in 100 μL of BHI. The suspension was evenly spread on BHI plates covered with a nitrocellulose membrane and incubated at 37°C for 24 h. The bacterial colony was scraped, washed with BHI, and spread on BHI plates containing 50 μg / mL erythromycin, followed by spreading on BHI plates containing 10% sucrose to screen for conjugates. Conjugates were obtained in all ratios, with the highest conjugation efficiency observed at a donor:recipient ratio of 2:1.

[0042] 2. Engagement time The bacterial culture was mixed at the optimal ratio (2:1) and spread onto BHI plates covered with a film. After incubation at 37°C for 4 h, 12 h, and 24 h, conjugates were screened. The conjugation efficiency of the 24 h incubation group was significantly higher than that of the other groups.

[0043] In summary, this invention establishes a method for constructing Elizabethan mil expressed with Nluc luciferase. This Nluc-labeled strain is suitable for real-time dynamic tracing in amphibian live animal models, providing an important research tool for in-depth analysis of the infection dynamics and pathogenic mechanisms of Elizabethan mil, and has significant application value.

[0044] It should be noted that the above embodiments do not limit the present invention in any way, and all technical solutions obtained by equivalent substitution or equivalent transformation fall within the protection scope of the present invention.

[0045] SEQ ID NO.1 Nluc The gene insertion site is 70 bases between positions 782215 and 782285 in the genome of Elizabethan mil strain FL160902. AGGATATATCCACATAACAAATTAACAAAAAGAGCCCTCATACGA (knock-in site)GGGCTCTGTAATAATTCGGGATTTA SEQ ID NO.2 promoter sequence, 114 bases TTGCCAATTTGGTGTTTTTGTAGGTTTTTTTTAACATTTGATTTTGTATTTAAAAAATTTGGTGTTACTTTTGCTTGTAATTAACTAAATTGTAATTAAAAAAATTAAGTA SEQ ID NO.3 nluc Sequence, 516 bases ATGGTCTTCACACTCGAAGATTTCGTTGGGGACTGGCGACAGACAGCCGGCTACAACCTGGACCAAGTCCTTGAACAGGGAGGTGTGTCCAGTTTGTTTCAGAATCTCGGGGTGTCCGTAACTCCGATCCAAAGGATTGTCCTGAGCGGTGAAAATGGGCTGAAGATCGACATCCATGTCATCATCCCGTATGAAGGTCTGAGCGGCGACCAAATGGGCCAGATCGAAAAAATTTTTAAGGTGGTGTACCCTGTGGATGATCATCACTTTAAGGTGATCCTGCACTATGGCACACTGGTAATCGACGGGGTTACGCCGAACATGATCGACTATTTCGGACGGCCGTATGAAGGCATCGCCGTGTTCGACGGCAAAAAGATCACTGTAACAGGGACCCTGTGGAACGGCAACAAAATTATCGACGAGCGCCTGATCAACCCCGACGGCTCCCTGCTGTTCCGAGTAACCATCAACGGAGTGACCGGCTGGCGGCTGTGCGAACGCATTCTGGCGTAA SEQ ID NO.4 pYT354 plasmid sequence, 7,762 bases

Claims

1. A method of constructing a Myroides odorilimus expressing Nluc luciferase, characterized in that, The method comprises the following steps: 1) constructing a recombinant plasmid Up-Down-Nluc-pYT354 based on plasmid pYT354; 2) introducing the recombinant plasmid Up-Down-Nluc-pYT354 obtained in step 1) into Elizabethkingia miricola strain by conjugation transfer, and integrating the Nluc luciferase gene into the genome of the strain by homologous recombination technology to obtain Elizabethkingia miricola expressing Nluc luciferase.

2. The construction method of claim 1, wherein, Step 1) of the method comprises: 1.1) determining the knock-in site of Elizabethkingia miricola in the genomic sequence, designing primers for PCR amplification, and obtaining the upstream homologous arm and downstream homologous arm fragments of the knock-in site, respectively; 1.2) double digesting the suicide plasmid pYT354 according to the multiple cloning sites of the plasmid pYT354, and connecting the upstream homologous arm and downstream homologous arm fragments obtained in step 1.1) to the linearized vector pYT354 by seamless cloning to construct the gene knock-in plasmid Up-Down-pYT354; 1.3) Using plasmid Nluc-PUC-SP as template, use nluc Promoter- nluc fusion fragment is obtained by gene primer PCR amplification;​ 1.4) Double enzyme digestion of the gene knock-in plasmid obtained in step 1.2), and the promoter- 1.5) Ligation of the double enzyme digestion fragments obtained in step 1.4) to the gene knock-in plasmid Up-Down-pYT354, and recombination reaction to obtain a recombinant plasmid Up-Down-Nluc-pYT354; transformation of the competent cells with the recombinant plasmid to obtain a strain containing the recombinant plasmid. nluc 1.4) Double enzyme digestion of the gene knock-in plasmid obtained in step 1.2), and the promoter- 1.5) Ligation of the double enzyme digestion fragments obtained in step 1.4) to the gene knock-in plasmid Up-Down-pYT354, and recombination reaction to obtain a recombinant plasmid Up-Down-Nluc-pYT354; transformation of the 3. The construction method of claim 2, wherein, Step 1) of the method comprises: 1.1) using the fragment between the FE632_RS03525 gene and the FE632_RS03526 gene of Elizabethkingia miricola FL160902 as the knock-in site, and using Up-F / R and Down-F / R for PCR amplification, respectively, to obtain the upstream homologous arm and downstream homologous arm fragments of the knock-in site, respectively; 1.2) double digesting the suicide plasmid pYT354 according to the multiple cloning sites of the plasmid pYT354, and connecting the upstream homologous arm and downstream homologous arm fragments obtained in step 1.1) to the linearized vector pYT354 by seamless cloning to construct the gene knock-in plasmid Up-Down-pYT354; 1.3) Using plasmid Nluc-PUC-SP as template, use nluc Promoter- fusion fragment is obtained by PCR amplification with gene primers nluc fusion fragment; 1.4) The gene knock-in plasmid Up-Down-pYT354 obtained from SalI and BamHI double digestion step 1.2) is then inserted into the promoter- nluc The fusion fragment was seamlessly cloned into the gene knock-in plasmid Up-Down-pYT354, and the ligation product was transformed into competent cells. E. coli S17-1λpir was plated on BHI plates containing 100 μg / mL ampicillin and incubated at 37°C for 16 h; positive clones were screened, and the positive clones were used... nluc PCR identification using internal primers revealed that the gene contained the recombinant plasmid Up-Down-Nluc-pYT354. E. coli The S17-1λpir strain was used to extract plasmids to obtain the recombinant plasmid Up-Down-Nluc-pYT354.

4. The construction method of claim 2, wherein, The enzyme digestion system used in steps 1.2) and 1.4) is: Enzyme digestion system Volume 10×Quick Cut buffer 3 μL Plasmid 1 μg Restriction endonuclease 1 μL ddH2O to 30 μL Enzyme digestion reaction conditions: 37°C for 30 min; The ligation system used in steps 1.2) and 1.4) is: Ligation system Volume 2×MultiF Seamless Assembly Mix 10 μL Linearized vector 0.03 pmol Fragment 0.06 pmol ddH2O to 20 μL Recombination reaction conditions: 50°C for 30 min.

5. The construction method according to claim 3 or 4, characterized in that, Step 2) of the method comprises: 2.1) The recombinant plasmid Up-Down-Nluc-pYT354 obtained in step 1) is transformed into E. coli JM1092.1 E. coli S17-1 λpir as donor bacteria, Elizabeth bacteria FL160902 as donor bacteria, and conjugation transfer was carried out; 2.2) culturing the donor bacteria and the recipient bacteria to the logarithmic phase overnight; 2.3) mixing the donor bacteria and the recipient bacteria at a volume ratio of 2:1 and dropping them on BHI plates with nitrocellulose membranes, and culturing at 37°C for 24 h; 2.4) The bacterial biofilm on the membrane was eluted with BHI liquid medium, and then coated on BHI containing 50 μg / mL erythromycin and incubated at 37°C for 48 h. Single colonies on the plate were picked and subcultured in BHI liquid medium, and then coated on BHI containing 10% sucrose and incubated at 37°C for 48 h. Single colonies on the sucrose plate were picked and verified by PCR to obtain the Elizabethkingia miricola expressing Nluc luciferase.

6. The construction method of claim 5, wherein, The PCR verification described in step 2.4) specifically involves: using... nluc Gene primer Pro- nluc PCR amplification was performed using -F / R, and the Nluc-labeled strain yielded a 583bp amplification product, while the wild-type strain did not. nluc PCR amplification was performed using external primers check-F / R. The amplification product obtained from the Nluc-labeled strain differed from that of the wild-type strain by 500 bp.

7. The construction method of claim 6, wherein, The primer sequences used in the method are as follows: Primer Sequence 5'-3' Up-F GGGAACAAAAGCTGGAGCTCGGTGGAGCACCTATGT Up-R TCGTATGAGGGCTCTTTTTGTTAATTTG Down-F ACGAGGATCCTGTCGACGGGCTCTGTAATAAT Down-R TAGGGCGAATTGGGTACCGGAACCCCTGCTCAA Pro-nluc-F AGAGCCCTCATACGAGGATCCTTGCCACATTTGGTG Pro-nluc-R TTATTACAGAGCCCGTCGACCTTACGCCAGAATGCG Check-F ACAATACCAATCAGGCAG Check-R CTTATGGCATTCTGCCAA.

8. Application of the Elizabethkingia miricola expressing Nluc luciferase in real-time dynamic tracing in amphibians.

9. Use according to claim 8, characterized in that, The steps include: (1) The Elizabethkingia miricola expressing Nluc luciferase was cultured overnight to the logarithmic growth phase, washed with sterile PBS for 3 times, and then obtained a bacterial suspension; (2) The albino line of Xenopus laevis was injected intraperitoneally with bacterial suspension at a concentration of 10 7 CFU, and the control group was injected with the same volume of PBS; (3) The live optical imaging analysis of the African clawed frog was performed on day 1, 3, 5 and 7 after infection, respectively.

Images