Application of OsCNL1 gene in enhancing brown planthopper resistance of rice

Abstract

The invention relates to application of an OsCNL1 gene in enhancing the resistance of rice to brown planthopper. Specifically, by deleting the function of the OsCNL1 gene in the rice, compared with a wild plant, the plant with the function deleted from the OsCNL1 gene can reduce the resistance of the rice to the brown planthopper, and specifically, the biomass and the amount of secreted honeydew of the brown planthopper are remarkably increased. The discovery of the new function of the rice OsCNL1 gene provides a new gene target and resource for improving brown planthopper resistance genetic breeding of rice.

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of genetic engineering, and particularly relates to OsCNL1 Application of genes in enhancing the resistance of rice to brown planthopper. BACKGROUND

[0002] Research has found that insect pests have become one of the key factors affecting the yield and quality of rice. To cope with the changing growth environment, plants have evolved a sophisticated secondary metabolite synthesis mechanism [1] . Among them, phenolamides widely participate in plant growth and development processes and plant-environment interactions, and play an important role in responding to and resisting stress [2] . As an important defensive secondary metabolite in rice, phenolamides play a multi-level protective role in resisting biological stress. Studies have shown that overexpression of genes responsible for synthesis of hydroxycinnamoyl tyramine and other aromatic phenolamide metabolic gene clusters can significantly accumulate such metabolites in rice, and exhibit stronger broad-spectrum resistance to bacterial leaf blight and rice blast, revealing that phenolamides function through direct antibacterial or enhanced defense response [3] . In addition, erucic acid amides in rice and other plants can inhibit the secretion of toxic proteins by specifically destroying the assembly of the type III secretion system (T3SS) of pathogenic bacteria, thereby resisting bacterial diseases such as bacterial leaf blight and tomato bacterial wilt [4] . The jasmonic acid signaling pathway regulates the biosynthesis of phenolamides (such as feruloyl tyramine) through a MYC2-JAMYB transcriptional cascade, directly inhibiting the survival and development of brown planthopper nymphs, while attracting their natural enemies, parasitic wasps, to achieve dual defense [5] . In addition, studies have found that brown planthopper-induced volatiles can inhibit Os4CL5 gene expression, reducing the accumulation of N-feruloyl putrescine, thereby weakening the resistance of rice, which inversely verifies the key role of phenolamides [6] . Therefore, further exploration of the metabolic pathway of phenolamides will provide new molecular targets for rice disease resistance breeding.

[0003] Recently, researchers have identified that peroxisome-localized cinnamic acid CoA ligases OsCNL1 and OsCNL2 are key enzymes in the biosynthesis of SA in rice, which can activate cinnamic acid to cinnamoyl CoA for peroxisomal beta-oxidation. Through beta-oxidation, cinnamoyl CoA is converted to benzoyl CoA in the peroxisome [7] . And these substances can all serve as acyl donors for the synthesis of phenolamides.

[0004] Rice planthoppers are widely distributed in China. Brown planthopper (Nilaparvata lugens) is the most harmful rice planthopper, which occurs in rice areas south of the Yangtze River every year, and is one of the most destructive biological stresses in rice production. Brown planthopper causes rice plant to wither, lodge and even die by directly sucking phloem sap, transmitting viral diseases (such as grassy stunt disease) and honeydew breeding sooty mold. Globally, brown planthopper causes rice yield loss of 10-30% per year, and more than 60% in outbreak years. When the nymph density exceeds 75 per hill, it can lead to complete yield loss [1] The damage mechanism of brown planthopper includes the following aspects [8–11] : (1) direct feeding leading to nutrient loss, reduced tillering and grain number per panicle; (2) activating jasmonic acid (JA) signaling pathway, inhibiting rice growth through MYC2-GA2ox module, and aggravating the "growth-defense" resource trade-off; (3) synergistic effect with climate stress (such as high temperature and elevated CO2), accelerating population proliferation and weakening rice resistance. In addition, the rapid evolution of brown planthopper resistance (such as resistance to neonicotinoid insecticides) further increases the difficulty of control. Therefore, it is of great scientific significance and application value to excavate the genes of rice itself against brown planthopper and provide new molecular targets for the directional breeding of brown planthopper-resistant rice. SUMMARY

[0005] On the basis of the prior art, the present application first found that the function loss of OsCNL1 gene can reduce the resistance of rice to brown planthopper, which is specifically manifested by the significant increase in the biomass and honeydew secretion of brown planthopper. On this basis, one object of the present application is to provide the application of OsCNL1 gene in improving the resistance of rice to brown planthopper. Another object is to provide a method for improving the resistance of rice to brown planthopper. Further, the present application also provides the application of OsCNL1 gene or its encoded protein in genetic breeding for improving the resistance of rice to brown planthopper.

[0006] In this regard, the technical solutions of the present application include but are not limited to the following: In one aspect, the present application provides the application of OsCNL1 gene in improving the resistance of rice to brown planthopper and / or genetic breeding for improving rice varieties, wherein the OsCNL1 gene encodes an amino acid sequence as shown in SEQ ID NO: 2.

[0007] In one aspect, the present application also provides the application of a recombinant vector containing OsCNL1 gene in improving the resistance of rice to brown planthopper and / or genetic breeding for improving rice varieties, wherein the OsCNL1 gene encodes an amino acid sequence as shown in SEQ ID NO: 2.

[0008] In one aspect, the present application also provides an application of a genetically engineered bacterium in improving the resistance of rice to Nilaparvata lugens and / or genetic breeding of rice varieties, wherein the genetically engineered bacterium comprises a recombinant vector comprising a gene encoding an amino acid sequence as shown in SEQ ID NO: 2. OsCNL1 In one aspect, the present application also provides an application of a genetically engineered bacterium in improving the resistance of rice to Nilaparvata lugens and / or genetic breeding of rice varieties, wherein the genetically engineered bacterium comprises a recombinant vector comprising a gene encoding an amino acid sequence as shown in SEQ ID NO: 2. OsCNL1 In one aspect, the present application also provides an application of a genetically engineered bacterium in improving the resistance of rice to Nilaparvata lugens and / or genetic breeding of rice varieties, wherein the genetically engineered bacterium comprises a recombinant vector comprising a gene encoding an amino acid sequence as shown in SEQ ID NO: 2.

[0009] In one aspect, the genetically engineered bacterium of the present application is a genetically engineered Agrobacterium.

[0010] In another aspect, the present application also provides a method for obtaining a rice plant with improved traits, comprising the following treatment steps: (1) using a genetically engineered bacterium to infect rice tissue; and (2) culturing the infected rice tissue into a rice plant; wherein the genetically engineered bacterium comprises a recombinant vector comprising a gene encoding an amino acid sequence as shown in SEQ ID NO: 2. OsCNL1 In one aspect, the present application also provides an application of a genetically engineered bacterium in improving the resistance of rice to Nilaparvata lugens and / or genetic breeding of rice varieties, wherein the genetically engineered bacterium comprises a recombinant vector comprising a gene encoding an amino acid sequence as shown in SEQ ID NO: 2. OsCNL1 In one aspect, the present application also provides an application of a genetically engineered bacterium in improving the resistance of rice to Nilaparvata lugens and / or genetic breeding of rice varieties, wherein the genetically engineered bacterium comprises a recombinant vector comprising a gene encoding an amino acid sequence as shown in SEQ ID NO: 2.

[0011] In one aspect, the improved trait of the present application is improved resistance to Nilaparvata lugens.

[0012] In one aspect, the present application includes overexpression of the gene in rice in the application and the method. OsCNL1 In one aspect, the present application includes overexpression of the gene in rice in the application and the method.

[0013] In another aspect, the present application also provides a method for improving the resistance of rice to Nilaparvata lugens, comprising overexpression of a gene encoding an amino acid sequence as shown in SEQ ID NO: 2. OsCNL1 In one aspect, the present application also provides an application of a genetically engineered bacterium in improving the resistance of rice to Nilaparvata lugens and / or genetic breeding of rice varieties, wherein the genetically engineered bacterium comprises a recombinant vector comprising a gene encoding an amino acid sequence as shown in SEQ ID NO: 2. OsCNL1 In one aspect, the present application also provides an application of a genetically engineered bacterium in improving the resistance of rice to Nilaparvata lugens and / or genetic breeding of rice varieties, wherein the genetically engineered bacterium comprises a recombinant vector comprising a gene encoding an amino acid sequence as shown in SEQ ID NO: 2.

[0014] In one aspect, the present application also provides a method for obtaining a rice plant with reduced resistance to Nilaparvata lugens, characterized by deleting the function of a gene or reducing the expression of a gene. OsCNL1 In one aspect, the present application also provides a method for obtaining a rice plant with reduced resistance to Nilaparvata lugens, characterized by deleting the function of a gene or reducing the expression of a gene. OsCNL1 In addition to the above, the rice plant with reduced resistance to Nilaparvata lugens can be used as a sensitive indicator material for evaluating the population dynamics and pathogenic variation of Nilaparvata lugens, or studying the interaction between insect pests and other stress, thereby providing a reference for integrated pest management and breeding strategies under the background of climate change. Oryza. Sativa In one aspect, the coding sequence of the gene of the present application is shown in SEQ ID NO: 1.

[0015] In yet another aspect, the present application also provides application of the OsCNL1 protein in improving resistance of rice to brown planthopper and / or genetic breeding of rice varieties, wherein the amino acid sequence of the OsCNL1 protein is shown as SEQ ID NO: 2.

[0016] In one aspect, the improved variety of the present application is improved resistance to brown planthopper.

[0017] In one aspect, the rice of the present application is japonica rice variety Zhonghua 11 (Oryza sativa L. ssp. Japonica var. japonica). japonica L. spp. Zhonghua11 , var. OsCNL1 ).

[0018] In the present application, OsCNL1 the nucleotide sequence of the protein coding region of the gene is shown as SEQ ID NO: 1, OsCNL1 the amino acid sequence of the protein encoded by the gene is shown as SEQ ID NO: 2, in particular: SEQ ID NO: 1: SEQ ID NO: 2: MEQLPKRPANYVPLSPVGFLPRANAVYGDRTSVIYGRVRFTWSQTYARCRRLASSLLSLGVRNHDVVSVLAPNVPAMYEMHFAVPMAGAVLNTINTRLDARAVAGILRHSEAKVFFVDYQYVRLASDALQIVADEGRHVPLVAVIDDIDVPTGVRLGELEYEGLVARGDPAAELPSLADEWDAVTLNYTSGTTSAPKGVVYSHRGAYLSTMSLLMSWVVGDEPVYLWTLPMFHCNGWTFTWGMAARGGVNVCIRDARAADIYRAIARHGVTHLCCAPVVFNILLEGGEAAAKQLAAPVHVLTGGAPPPAALLERVERIGFRVTHAYGLTEATGPALACEWRAQWDRLPLPERARLKSRQGVSVLSLADADVKDAKTMARVPRDGKTVGEIVLRGSSIMKGYLNNPEANSDAFKGEWFLTGDVGVVHADGYIEIKDRSKDVIISGGENICSKEVEEVLFQHPAVADAAVVAMPHPHWGETPCAFVVARDKAAGVCEDDVVAFCRKHMARFMVPKKVVVYDAIPRNGNGKVEKNLLREAAKKLAPAAVPAQKTKVKTTTTTVGGRRGEHPVAHVMAVSRL Compared with the prior art, the present application at least includes the following beneficial effects: The present application discloses a new use of the gene in reducing the resistance of rice to brown planthopper by deleting the gene in the plant of Oryza sativa L. Figure 1 The present application discloses a new use of the gene in reducing the resistance of rice to brown planthopper by deleting the gene in the plant of Oryza sativa L. BRIEF DESCRIPTION OF DRAWINGS

[0019] OsCNL1 The expression levels of the gene in rice treated with methyl jasmonate or brown planthopper are shown in FIG. 1. OsCNL1 The expression levels of the gene in rice treated with methyl jasmonate or brown planthopper are shown in FIG. 1. OsCNL1 The expression levels of the gene in rice treated with methyl jasmonate or brown planthopper are shown in FIG. 1. Figure 2 The expression levels of the gene in rice treated with methyl jasmonate or brown planthopper are shown in FIG. 1.

[0020] oscnl1 The expression levels of the gene in rice treated with methyl jasmonate or brown planthopper are shown in FIG. 1. oscnl1 The detection results of the mutant against brown planthopper are shown in FIG. 2.OsCNL1 (A) Mutation site information of mutants, with inserted or deleted bases marked in water-red; (B) Weight gain statistics of brown planthoppers after feeding on leaves; (C) Honeydew secretion statistics of brown planthoppers after feeding; using t A significance analysis was performed, and ** indicates that the significance was determined. P Value < 0.01, * indicates P Value < 0.05. Detailed Implementation

[0021] The following examples are provided to better understand the present invention, but are not intended to limit the invention. Unless otherwise specified, the experimental methods used in the following examples are conventional methods. Unless otherwise specified, the experimental materials used in the following examples were purchased from conventional biochemical reagent manufacturers.

[0022] Example 1 OsCNL1 Responding to biological stress Two groups of rice were cultured under identical conditions for 30 days. In one group (experimental group), 100 mM methyl jasmonate (MeJA) solution was added to the nutrient solution to simulate biotic stress, with a final concentration of 100 μM. In the other group (control group), the corresponding volume of anhydrous ethanol was added to the nutrient solution as a control. Leaves from both the experimental and control groups were sampled at 0.5 h, 1 h, 3 h, 8 h, and 24 h after MeJA treatment. The levels of methyl jasmonate (MeJA) in the rice leaves were detected by quantitative real-time PCR. OsCNL1 The expression level was found in rice leaves. Nilaparvata lugens The expression level of the substance was continuously upregulated after 3 hours of treatment, and then rapidly decreased after 3 hours of treatment.

[0023] Further use of brown planthoppers ( OsCNL1 Brown planthoppers (BPH) were used to infect rice. The specific procedure was as follows: In the experimental group, rice plants were placed in a glass cage with a diameter of 4 cm, a height of 8 cm, and 24 small holes with a diameter of 0.8 mm. Fifteen fertilized adult female planthoppers were placed in this glass cage for rearing. Plants in empty glass cages served as the control group. The outermost two leaf sheaths directly damaged by the brown planthopper were collected at designated time points.

[0024] turn out, Figure 1 The expression level of [the substance] continued to be upregulated after infection. OsCNL1 B). The above results show that, OsCNL1 It can respond instantaneously to biological stress in rice and respond continuously to brown planthopper infestation.

[0025] Example 2 Construction OsCNL1 Rice plants with gene function loss A system was built using the CRISPR / Cas9 system provided by Liu Yaoguang's team at South China Agricultural University. E. coliZhonghua 11 (ZH11) background. The method is briefly described as follows: 1) Enter the target gene sequence into the target primer design website (http: / / skl.scau.edu.cn / targetdesign / ), and select the target sequence (TGGCTGTACACCACGCCCTT) as the gene editing site. In the primer design interface, use Method 2 to add a linker to the target sequence, and design the gRT1: TGGCTGTACACCACGCCCTTgttttagagctagaaat and OsU3T1: AAGGGCGTGGTGTACAGCCATgccacggatcatctgc primers to generate the gRT1 and OsU3T1 primers for amplifying the target gene expression cassette.

[0026] 2) Use the pYLsgRNA-OsU3 vector as the template, and use the primers U-F: CTCCGTTTTACCTGTGGAATCG and OsU3T1 to amplify the promoter and target sequence fusion expression fragment (product 1); use the primers gRT1 and gR-R: CGGAGGAAAATTCCATCCAC to amplify the target sequence and gRNA scaffold fusion expression fragment (product 2).

[0027] 3) Mix the above product 1 and product 2 as the template, and use the primers Pps-GGL: TTCAGAggtctcTctcgACTAGTATGGAATCGGCAGCAAAGG and Pgs-GGR: AGCGTGggtctcGaccgACGCGTATCCATCCACTCCAAGCTC to amplify the U3-target-gRNA expression cassette.

[0028] 4) Mix 20-70 ng of the U3-target-gRNA expression cassette with 40-60 ng of the pYLCRISPR / Cas9Pubi-H plasmid, and use BsaI enzyme (New England Biolabs, Beijing, China) to perform enzyme digestion at 37°C for 15 minutes. After enzyme digestion, add 1.5 μl of 10 × DNA ligase buffer and 35 U of T4 ligase (New England Biolabs, Beijing, China), and perform 15 cycles of temperature cycling enzyme digestion and ligation, with a cycle program of 37°C for 5 min; 10°C for 5 min, and 20°C for 5 min.

[0029] 5) Transform the temperature cycling enzyme digestion and ligation product into Escherichia coli (Invitrogen, Beijing, China) DH5α competent cells, and coat it on an LB solid plate (containing 50 mg / L kanamycin) at 37°C for 12-16 h, until single colonies are grown. oscnl1-mu1 )

[0030] 6) After picking the monoclonal shake flask, use FastPure Plasmid Mini Kit (Norgen, Nanjing, China) to extract the plasmid, and send the extracted plasmid to Hangzhou Yikang Biotechnology Co., Ltd. for Sanger sequencing.

[0031] 7) The correct sequencing plasmid was sent to Wuhan Buryang Biotechnology Co., Ltd. for rice genetic transformation experiment. The transformed rice background was ZH11.

[0032] 8) After obtaining the transgenic rice seedlings, use PCR and Sanger sequencing technology to identify mutant plants.

[0033] Through sequencing identification, two mutant materials of strains were obtained, respectively oscnl1-mu2 and oscnl1-mu1 . OsCNL1 oscnl1-mu2 add 1 base; OsCNL1 Figure 2 deletion of 31 bases ( OsCNL1 A). The deletion or addition of the above bases leads to a frameshift mutation of the encoded protein.

[0034] Example 3 oscnl1 Loss of gene function reduces the resistance of rice to rice planthopper For brown planthopper treatment, in the body weight gain determination experiment, wild type and oscnl1 mutant plants with consistent growth were selected at the 4-leaf stage, and one small bag was placed at the base of each rice stem, with 3 brown planthopper female adults that had been starved for 2h and had been eclosed for 24h in each bag. After 48h, the brown planthopper female adults were removed, and the body weight of the brown planthopper was recorded using a precision analytical balance. Body weight gain = post-experiment insect weight - pre-experiment insect weight. In the honeydew amount determination experiment, wild type and oscnl1 mutant plants with consistent growth were selected at the 4-leaf stage, and 2 honeydew bags were attached to the first or second leaf sheath of the main stem of each rice plant, with 1 brown planthopper female adult that had been starved for 2h and had been eclosed for 24h in each bag. After 48h, the honeydew bags were removed, and the amount of honeydew secreted by the brown planthopper was recorded using a precision analytical balance. Honeydew amount = post-experiment bag weight - pre-experiment bag weight.

[0035] Using oscnl1 mutant to detect brown planthopper showed that after feeding on Figure 2 mutant, the brown planthopper had more biomass growth ( Figure 2 B) and honeydew secretion amount ( OsCNL1 C) than the wild type, indicating that the loss of function of ​ reduces the resistance of rice to brown planthopper.

[0036] References ​​[1] Dong NQ, Lin HX. Contribution of phenylpropanoid metabolism to plant development and plant-environment interactions[J]. Journal of Integrative Plant Biology, 2021, 63(1): 180-209. [2] Widhalm JR, Dudareva N. A Familiar Ring to It: Biosynthesis of Plant Benzoic Acids[J]. Molecular Plant, 2015, 8(1): 83-97. [3] Xue R, Gao N, Chen J et al. Hydroxycinnamic acid amides in rice: biosynthesis, distribution, function, and implication for crop development[J]. Frontiers in Plant Science, 2025, 16. [4] Miao P, Wang H, Wang W et al. A widespread plant defense compound disarms bacterial type III injectisome assembly[J]. Science, 2025, 387(6737): eads0377. [5] Liu M, Li H, Chen Y, et al. The MYC2-JAMYB transcriptional cascade regulates rice resistance to brown planthoppers[J]. New Phytologist, 2025, 246(4): 1834-1847. [6] Yao C, Zhao X, Hu X, et al. Planthopper-induced volatiles suppress rice plant defense by targeting Os4CL5-dependent phenolamide biosynthesis[J]. Current Biology, 2025, 35(14): 3440-3450.e4. [7] Wang Y, Jin G, Song S, Jin Y, Wang X, Yang S, Shen X, Gan Y, Wang Y, Li R, Liu JX, Hu J, Pan R. A peroxisomal cinnamate:CoA ligase-dependent phytohormone metabolic cascade in submerged rice germination. Dev Cell. 2024 Jun 3;59(11):1363-1378.e4. doi: 10.1016 / j.devcel.2024.03.023. Epub 2024 Apr 4. PMID: 38579719. [8] Yele Y, Chander S, Suroshe SS, et al. Physiological and demographic responses of Nilaparvata lugens to combined climate stressors: CO2, temperature, and ozone[J]. Frontiers in Plant Science, 2025, 16:1518361. [9] Jin G, Qi J, Zu H, et al. Jasmonate-mediated gibberellin catabolism constrains growth during herbivore attack in rice[J]. The Plant Cell, 2023, 35(10): 3828-3844.

[10] Cao D, Ping Y, Lin Y, et al. Synergistic Response Mechanisms in Rice Seedlings Exposed to Brown Planthopper Infestation and High-Temperature Stress [J]. Plants (Basel, Switzerland), 2025, 14(11): 1644.

[11] Tao Z, Zhu L, Li H, et al. ACL1-ROC4 / 5 complex reveals a common mechanism in rice response to brown planthopper infestation and drought [J]. Nature Communications, 2024, 15(1): 8107.

[12] Ma X, Liu YG. CRISPR / Cas9-based multiplex genome editing in monocot and dicot plants [J]. Current Protocols in Molecular Biology, 2016, 115: 31.6.1-31.6.21.

Claims

1. OsCNL1 The application of genes in genetic breeding for improving rice resistance to brown planthoppers and / or rice variety improvement is characterized by, The above OsCNL1 The gene encodes the amino acid sequence shown in SEQ ID NO:

2.

2. Contains OsCNL1 The application of gene recombinant vectors in genetic breeding for improving rice resistance to brown planthoppers and / or rice variety improvement is characterized by, The OsCNL1 The gene encodes the amino acid sequence shown in SEQ ID NO:

2.

3. The application of a genetically engineered bacterium in improving rice resistance to brown planthoppers and / or in the genetic breeding of rice varieties, characterized in that, The genetically engineered bacteria contain rice. OsCNL1 Recombinant vectors of genes, the OsCNL1 The gene encodes the amino acid sequence shown in SEQ ID NO:

2.

4. A method for obtaining rice plants with improved traits, characterized in that, It includes the following processing steps: (1) Infecting rice tissues with genetically engineered bacteria; and (2) Infected rice tissues were cultured into rice plants; The genetically engineered bacteria contain OsCNL1 Recombinant vectors of genes, the OsCNL1 The gene encodes the amino acid sequence shown in SEQ ID NO:

2.

5. The method according to claim 4, characterized in that, The improved trait is enhanced resistance to brown planthoppers.

6. The application according to any one of claims 1-3 or the method according to claim 4 or 5, characterized in that, Overexpression of the above in rice OsCNL1 Gene.

7. A method for improving the resistance of rice to brown planthopper, characterized in that, The method includes: overexpression OsCNL1 Genes, the ones mentioned OsCNL1 The gene encodes the amino acid sequence shown in SEQ ID NO:

2.

8. A method for obtaining model rice plants with reduced resistance to brown planthoppers, lacking... OsCNL1 Gene function may be reduced OsCNL1 Gene expression, the OsCNL1 The gene encodes the amino acid sequence shown in SEQ ID NO:

2.

9. The application according to any one of claims 1-3 or the method according to claims 4, 5, 7 or 8, characterized in that, The OsCNL1 The coding sequence of the gene is shown in SEQ ID NO:

1.

10. The application of OsCNL1 protein in improving rice resistance to brown planthopper and / or in genetic breeding for rice variety improvement, wherein the amino acid sequence of the OsCNL1 protein is shown in SEQ ID NO: 2.

Images