Application of a wheat specific subfamily gene TaHsfC3-4 in salt tolerance improvement of wheat

Abstract

The application belongs to the technical field of genetic engineering, and particularly relates to application of a TaHsfC3-4 gene in salt tolerance improvement of wheat. The gene TaHsfC3-4 has a registration number of OQ680124.1, and plays a significant role in regulating salt tolerance of wheat. By using a CRISPR / Cas9 gene editing technology, the wheat gene TaHsfC3-4 is knocked out to obtain a homozygous mutant. After salt stress treatment, the phenotype and physiological indexes of the TaHsfC3-4 gene knockout mutant are better than those of a wild type Fielder. Specifically, after salt stress treatment, the mutant has less dry leaves, good growth, and lower relative conductivity and malondialdehyde content of leaves, indicating that the leaf cell membrane antioxidant capacity of the wheat TaHsfC3-4 gene mutant is improved, the cell membrane integrity is better, and the salt tolerance of the mutant is enhanced. The application provides a new method for rapidly creating a salt-tolerant new wheat variety.

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering technology, specifically involving the application of the TaHsfC3-4 gene in improving the salt tolerance of wheat. Background Technology

[0002] The efficient utilization of saline-alkali land is of great strategic significance for promoting food security and sustainable agricultural development in my country. Wheat is an important food crop in my country, ranking second in both planting area and yield nationwide. However, wheat is a non-halophytic plant, and the prerequisite for planting it in saline-alkali land is to cultivate varieties with good salt tolerance. Discovering wheat's salt-tolerant genes and using modern bio-breeding techniques to improve the salt tolerance of superior wheat varieties, accelerating the realization of the scientific goal of "planting the right crop for the right land," is crucial for the efficient utilization of saline-alkali land, ensuring food security, and the sustainable development of future agricultural production. Summary of the Invention

[0003] The purpose of this invention is to provide the application of the TaHsfC3-4 gene in improving the salt tolerance of wheat. TaHsfC3-4 negatively regulates salt tolerance in wheat, providing a new gene resource for wheat salt tolerance breeding using genetic engineering technology.

[0004] The present invention adopts the following technical solution:

[0005] This invention provides the application of the TaHsfC3-4 gene in improving wheat salt stress tolerance, and the accession number of the TaHsfC3-4 gene is OQ680124.1.

[0006] This invention improves the salt stress resistance of wheat by inhibiting or knocking out the expression of the TaHsfC3-4 gene.

[0007] As a preferred embodiment, the application obtains wheat varieties with improved salt tolerance by constructing biomaterials associated with the inhibition of the TaHsfC3-4 gene.

[0008] In some embodiments of the present invention, the biological material does not include reproductive material.

[0009] In some embodiments of the present invention, the biomaterial includes nucleic acid molecules, carriers, and cells.

[0010] In some embodiments of the present invention, the nucleic acid molecule includes microRNA, siRNA, shRNA, dsRNA, sgRNA and / or antisense oligonucleotides that inhibit the function of TaHsfC3-4.

[0011] In some embodiments of the present invention, the sequence of the sgRNA is shown in SEQ ID NO: 1 and SEQ ID NO: 2.

[0012] In some embodiments of the present invention, the sgRNA is used in conjunction with a CRISPR / Cas9 vector to achieve gene knockout.

[0013] In some embodiments of the present invention, the CRISPR / Cas9 vector further includes an expression vector containing the sgRNA, and may also include Cas9 protein or an expression vector for expressing Cas9 protein.

[0014] In some embodiments of the present invention, the carrier includes, but is not limited to, other carriers commonly used in the art such as Cas9.

[0015] In some embodiments of the present invention, the cells include at least one of *Escherichia coli* and *Agrobacterium*. *Escherichia coli* is a commonly used host cell in the art for constructing vectors and plasmids, while *Agrobacterium* is a common tool in the art for delivering DNA molecules to plants.

[0016] This invention also provides a method for breeding wheat varieties with improved salt tolerance, comprising the step of reducing the expression level and / or activity of the TaHsfC3-4 gene in wheat. In some embodiments of this invention, the wheat variety includes the characteristic of increased salt tolerance relative to a reference level, wherein the reference level is the level of the wild type.

[0017] In some embodiments of the present invention, the step of reducing the expression level and / or activity of the TaHsfC3-4 gene in wheat involves introducing the biological material described in this invention, which is associated with inhibiting the TaHsfC3-4 gene, into wheat tissues or wheat cells. In some embodiments of the present invention, the introduction method includes using at least one of Ti plasmids, Ri plasmids, plant virus vectors, microinjection, and electroporation.

[0018] In some embodiments of the present invention, the step of reducing the expression level and / or activity of TaHsfC3-4 protein in wheat specifically includes:

[0019] (1) Design the target sequence sgRNA of the TaHsfC3-4 gene and construct a CRISPR / Cas9 vector for wheat TaHsfC3-4 gene editing;

[0020] (2) Transform the CRISPR / Cas9 vector described in step (1) into Agrobacterium competent cells to obtain Agrobacterium containing the CRISPR / Cas9 vector;

[0021] (3) Infect Fielder embryos with the Agrobacterium infection solution obtained in step (2), obtain seedlings again through tissue culture, and screen for stable genetic mutant lines with wheat TaHsfC3-4 gene mutation, no exogenous Cas9 protein, and target sequence variation.

[0022] In some embodiments of the present invention, the carrier is pWMB110-Cas9;

[0023] In some embodiments of the present invention, the host cell is Agrobacterium C58C1;

[0024] In some embodiments of the present invention, the wheat variety is Fielder.

[0025] The beneficial effects of this invention are: This invention is the first to discover the application of the TaHsfC3-4 gene in regulating the salt tolerance trait of wheat. By inhibiting and knocking out the expression of the TaHsfC3-4 gene in wheat, the salt tolerance of wheat can be significantly improved, providing a simple and effective technical means for rapidly creating new salt-tolerant wheat lines. Attached Figure Description

[0026] Figure 1 This is a schematic diagram illustrating the mutation patterns of the TaHsfC3-4 gene.

[0027] Figure 2 Phenotypic diagrams of wild-type and TaHsfC3-4 mutant wheat under normal and salt stress conditions;

[0028] Figure 3 Germination rates of wild-type and TaHsfC3-4 mutant wheat under normal and salt stress conditions;

[0029] Figure 4 The relative electrical conductivity and malondialdehyde content of leaves of wild-type and TaHsfC3-4 mutant wheat. Detailed Implementation

[0030] The following will describe the concept and technical effects of the present invention clearly and completely with reference to embodiments, so as to fully understand the purpose, features and effects of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, not all embodiments. Other embodiments obtained by those skilled in the art based on the embodiments of the present invention without creative effort are all within the scope of protection of the present invention.

[0031] Example 1: Design of TaHsfC3-4 knockout target sgRNA1 and sgRNA2

[0032] The TaHsfC3-4 sequence was retrieved using the Ensembl plants database. Sequences containing the PAM domain of NGG were selected from its conserved regions, and two of them were chosen as target sites. The target site sequences were 20 bp in length and were named sgRNA1 and sgRNA2, respectively. The sgRNA1 sequence is shown in SEQ ID NO.1 and the sgRNA2 sequence is shown in SEQ ID NO.2.

[0033] Example 2: Construction and Identification of the CRISPR / Cas9-TaHsfC3-4 Vector

[0034] The target primers for constructing the TaHsfC3-4 gene editing vector were as follows: the sgRNA1 target primer TaHsfC3-4-gR1-F sequence is shown in SEQ ID NO.3, and the TaHsfC3-4-gR1-R sequence is shown in SEQ ID NO.4; the sgRNA2 target primer TaHsfC3-4-gR2-F sequence is shown in SEQ ID NO.5, and the TaHsfC3-4-gR2-R sequence is shown in SEQ ID NO.6.

[0035] Using TaU3 as a template, four primers—UF, gR-R, TaHsfC3-4-gR1-F, and TaHsfC3-4-gR1-R—were added to the first reaction for PCR amplification of the sgRNA1 target. In the second reaction, four primers—UF, gR-R, TaHsfC3-4-gR2-F, and TaHsfC3-4-gR2-R—were added to amplify the sgRNA2 target. The PCR program was set as follows: Stage 1: 95℃, 5 min; Stage 2 (35 cycles): 95℃, 30 sec; 60℃, 30 sec; 72℃, 1 min; Stage 3: Storage at 4℃. The UF sequence is shown in SEQ ID NO. 7, and the gR-R sequence is shown in SEQ ID NO. 8.

[0036] Using the PCR product from the above steps as a template, a second round of PCR amplification was performed using primers ZWHind-UF and ZWHindR, which contain restriction enzyme sites. The PCR amplification products were detected by agarose gel electrophoresis, and the gel was excised and purified. The ZWHind-UF sequence is shown in SEQ ID NO.9, and the ZWHindR sequence is shown in SEQ ID NO.10.

[0037] The vector backbone pWMB110-Cas9 was linearized by restriction endonuclease HindIII, and the vector was detected by agarose gel electrophoresis and purified using a DNA purification and concentration kit.

[0038] The second-round PCR product and the digested vector DNA were ligated using In-Fusion ligase and then transformed into competent E. coli cells.

[0039] Colony PCR identification was performed. Colonies with band sizes matching the target product were selected, and the colonies were shaken and sequenced. Clones with correct sequencing results were re-propagated, plasmids were extracted, and transformed into C58C1 Agrobacterium competent cells. Positive clones were selected and sent to the Chinese Academy of Agricultural Sciences for genetic transformation. The recipient was the wheat variety Fielder.

[0040] Example 3: Identification of TaHsfC3-4 knockout wheat lines

[0041] Genomic DNA was extracted from leaves of T0 generation transgenic plants using a DNA extraction kit (Kangwei Century Biotechnology Co., Ltd.). Primers were designed for PCR-RE detection of gene sequences at each target site. The detection primer sequences are as follows: F: GGCGCCGGCGGCATGGAGTGCTCA, R: TGGCCACCGGCACGTCGCTGAAA

[0042] PCR amplification products corresponding to the edited plants identified by PCR-RE were selected and sent to a biotechnology company for sequencing. The editing type was analyzed based on the sequencing results, and different types of edited plants were statistically analyzed. Homozygous mutant materials were retained, and finally, three homozygous mutants were obtained, denoted as M-28, M-30, and M-33. The mutation type of the TaHsfC3-4 gene is as follows: Figure 1 As shown.

[0043] Example 4 Salt tolerance analysis of TaHsfC3-4 gene knockout lines

[0044] Phenotypic differences between wild-type and TaHsfC3-4 mutant wheat under normal and salt stress conditions

[0045] Under normal culture conditions, there was no difference in growth between the wild type and the TaHsfC3-4 mutant. After salt stress treatment, the three TaHsfC3-4 mutants showed significantly better growth than the wild type, with more green leaves and fewer dry leaves. This indicates that the salt tolerance of wheat lines mutated by TaHsfC3-4 is significantly enhanced. Figure 2 ).

[0046] Under salt stress, the TaHsfC3-4 mutant wheat exhibits enhanced germination rate.

[0047] Seeds were disinfected with 10% H2O2 for 10 min, rinsed repeatedly with distilled water to remove residues, and then placed on filter paper for cultivation in the dark at 25℃. The normal treatment group was watered with distilled water, while the salt stress group was watered with 1.2% NaCl solution. Germination was recorded daily. Results showed that under normal cultivation conditions, there was no difference in germination rate between wild-type and mutant lines. Under salt stress treatment, the germination rate of all three lines of the TaHsfC3-4 mutant was significantly higher than that of wild-type wheat, and the TaHsfC3-4 mutant exhibited enhanced salt tolerance during germination. Figure 3 ).

[0048] Under salt stress, the relative electrical conductivity and malondialdehyde content in leaves of TaHsfC3-4 mutant wheat decreased.

[0049] Wheat seedlings used for physiological index determination were cultured in a substrate of vermiculite:nutrient soil (1:1 ratio). When the seedlings reached the one-leaf, one-heart stage, the salt stress group was irrigated with a 200 mM NaCl solution. After three weeks of treatment, leaves were collected to measure relative conductivity and malondialdehyde (MDA) content. Under normal culture conditions, there were no significant differences in leaf relative conductivity and MDA content between the wild-type Fielder and TaHsfC3-4 mutant systems. After salt stress treatment, the leaf relative conductivity and MDA content of the three TaHsfC3-4 mutant systems were significantly lower than those of the wild-type wheat. Figure 4 This indicates that under salt stress, the mutant wheat leaves exhibit less electrolyte leakage, enhanced cell membrane antioxidant capacity, and better cell membrane integrity, thus the TaHsfC3-4 mutant demonstrates better salt tolerance.

Claims

1. Application of knockout of wheat-specific subfamily gene TaHsfC3-4 in improving wheat salt tolerance; the nucleotide sequence registration number of the TaHsfC3-4 gene is: OQ680124.

1.

2. Application of biomaterials associated with TaHsfC3-4 gene knockout in wheat breeding; The nucleotide sequence registration number of the TaHsfC3-4 gene is: OQ680124.1; The application is to construct biological materials related to the knockout of the TaHsfC3-4 gene to obtain wheat varieties with improved salt tolerance; The biological materials do not include reproductive materials; The biomaterials include nucleic acid molecules, carriers, and cells; The nucleic acid molecule includes an sgRNA that inhibits the function of TaHsfC3-4; the sequence of the sgRNA is shown in SEQ ID NO.1 and SEQ ID NO.2; The vector includes a CRISPR / Cas9 vector; The cells include at least one of Escherichia coli and Agrobacterium.

3. A method for breeding highly salt-tolerant wheat varieties, comprising the step of reducing the expression level and / or activity of the TaHsfC3-4 gene in wheat; The wheat variety possesses the following characteristics: increased salt tolerance compared to the recipient wild-type wheat; The step of reducing the expression level and / or activity of the TaHsfC3-4 gene in wheat involves introducing the biomaterial associated with the knockout of the TaHsfC3-4 gene as described in claim 2 into wheat tissue or wheat cells.

4. The method according to claim 3, characterized in that: The method of introduction includes either microinjection or electroporation.

Images