Method for improving cracking resistance of rape pods based on BnNST2 gene editing and KASP molecular marker and application

By using BnNST2 gene editing and KASP molecular markers, combined with the CRISPR-Cas system and high-throughput phenotypic detection, we achieved efficient breeding of rapeseed pod crack resistance, solving the problems of low efficiency and uncertain results in traditional breeding methods, and realizing a significant improvement and trait aggregation in crack resistance.

CN121380182APending Publication Date: 2026-01-23OIL CROPS RES INST CHINESE ACAD OF AGRI SCI
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511954613.3
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-12-23
Publication Date
2026-01-23

AI Technical Summary

Technical Problem

Existing technologies make it difficult to efficiently breed rapeseed varieties resistant to angular cracking. Traditional QTL mapping has a weak effect on rapeseed and is highly dependent on the environment. The effects of single-gene editing and its potential negative impact on yield are unclear.

Method used

By using BnNST2 gene editing and KASP molecular markers, loss-of-function allelic variants were introduced, and precise editing was performed using the CRISPR-Cas system. High-throughput phenotypic detection and selection models were then used to achieve efficient breeding of the crack-angle resistance trait.

Benefits of technology

It significantly improves the crack resistance of rapeseed pods, reduces yield loss, improves breeding efficiency and selection accuracy, and combines other excellent traits such as high oleic acid content, disease resistance and yield potential.

✦ Generated by Eureka AI based on patent content.
Patent Text Reader

Abstract

The invention belongs to the technical field of gene engineering, and particularly relates to a method for improving rape pod cracking resistance based on BnNST2 gene editing and a KASP molecular marker and application. The invention provides an application of a brassica BnNST2 gene in improving crack resistance of rape silique. The application is realized by introducing or creating function loss allelic variation of the BnNST2 gene. The function loss allelic variation is obtained by any one of the following modes: identifying and screening single base C deletion variation which naturally exists in rape germplasm and is positioned at the 199th site of the gene by utilizing a KASP molecular marker; by utilizing a genome editing system, introducing a frame-shift mutation or an early termination codon into the gene coding region; a base editor or a primer editor is utilized to introduce point mutation at a key site of the gene so as to terminate translation in advance. According to the invention, on the basis of the specific and large-effect functional gene BnNST2 and key allelic variation thereof, the infinitesimal effect and uncertainty of traditional QTL positioning are avoided.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering technology, and in particular relates to a method and application for improving the crack resistance of rapeseed pods based on BnNST2 gene editing and KASP molecular markers. Background Technology

[0002] As one of the world's most important oilseed crops, rapeseed suffers yield losses during mechanized harvesting primarily due to the cracking of its pods (commonly known as "split pods"). Premature cracking of the pods at maturity not only leads to direct seed detachment (field loss rates can reach 10%-50%), but the germination of scattered seeds also creates weeds and increases management costs. To reduce losses, farmers are often forced to harvest early, but this results in insufficient seed maturity, decreased oil content, and reduced quality. Therefore, developing pod-resistant rapeseed varieties is crucial for achieving high and stable yields and full mechanization.

[0003] Silique dehiscence is a complex physiological process involving abscission zone development, cell wall lignification, hydrolytic enzyme activity, and hormonal regulation. Although studies on the model plant Arabidopsis thaliana have identified several key genes regulating silique dehiscence, such as IND and ALC, providing a reference for rapeseed research, translating this knowledge into effective breeding tools remains a challenge. Traditional quantitative trait loci (QTL) mapping in rapeseed has revealed that many silique dehiscence resistance loci are minimally effective and highly susceptible to environmental influences, making them difficult to directly apply to high-efficiency breeding. While there are reports of using gene editing technology to knock out homologous genes such as BnaIND and BnaALC to partially improve silique dehiscence resistance, the effects of single gene editing and its potential negative impact on yield still require systematic evaluation.

[0004] Therefore, discovering and utilizing key genes that have major effects and no significant negative effects on yield traits, and developing efficient and precise molecular breeding technologies, is the core issue that urgently needs to be addressed in current horn-resistant breeding. Summary of the Invention

[0005] The main objective of this invention is to provide a method and application for improving the crack resistance of rapeseed pods based on BnNST2 gene editing and KASP molecular markers, so as to overcome the shortcomings of the prior art.

[0006] To achieve the aforementioned objectives, the technical solution adopted by this invention includes: According to a first aspect of the present invention, an application of the Brassica genus BnNST2 gene in improving the crack resistance of rapeseed pods is provided, wherein the application is achieved by introducing or creating a loss-of-function allelic variant of the BnNST2 gene; the loss-of-function allelic variant is obtained by any of the following methods: Using a KASP molecular marker, a naturally occurring single-base C deletion variant located at position 199 of the gene in rapeseed germplasm was identified and screened. Using a genome editing system, frameshift mutations or premature stop codons are introduced into the coding region of the gene; Using a base editor or primer editor, point mutations can be introduced at key sites in the gene to terminate translation prematurely.

[0007] According to a second aspect of the present invention, a KASP molecular marker for detecting loss-of-function allelic variants of the BnNST2 gene is provided, the KASP molecular marker comprising a combination of oligonucleotide primers capable of specifically distinguishing the presence or absence of the C base at position 199 of the gene, the sequences of the primer combination being shown in SEQ ID NO.1 to SEQ ID NO.3.

[0008] According to a third aspect of the present invention, a CRISPR-Cas system recombinant nucleic acid construct for editing the Brassica genus BnNST2 gene is provided, the construct comprising: The nucleotide sequence encoding a Cas effector protein, wherein the Cas effector protein is selected from Cas9, Cas12a, or a variant thereof having nuclease activity; At least one guide RNA coding sequence targeting the coding region of the BnNST2 gene; The target sequence of the guide RNA includes the region covered by the sequences shown in SEQ ID NO.4 to SEQ ID NO.7.

[0009] Furthermore, the construct contains two or more guide RNA coding sequences that target different sites of the BnNST2 gene or simultaneously target the BnNST2 gene and its functionally redundant homologous genes, in order to achieve efficient editing of multiple gene sites.

[0010] Furthermore, the Cas effector protein is an adenine base editor or a cytosine base editor, used to introduce site-directed base substitutions in the BnNST2 gene that are independent of DNA double-strand breaks, in order to create loss-of-function allelic variants.

[0011] According to a fourth aspect of the present invention, a method for creating angular-resistant rapeseed germplasm is provided, comprising the following steps: The recombinant nucleic acid construct described in any one of the above methods, or the ribonucleoprotein complex obtained by transcription and translation from the recombinant nucleic acid construct, is introduced into rapeseed recipient cells via Agrobacterium-mediated transformation, gene gun method, or efficient transformation method based on WUSCHEL gene-promoted regeneration. Transgenic plants or edited plants are obtained from the regeneration of the recipient cells; Using the KASP molecular marker and / or sequencing technology, individuals with loss-of-function homozygous or biallelic mutations in the BnNST2 gene were screened and identified from the plants.

[0012] According to a fifth aspect of the present invention, a molecular breeding method for rapeseed pod-cracking resistance combined with high-throughput phenotypic detection is provided, comprising the following steps: Using the KASP molecular markers described above, the breeding population was genotyped, and individual plants carrying resistance allelic variations were screened. For the selected individual plants or their derived progeny, a high-throughput non-destructive test of the silique crack resistance index was performed using an automated phenotyping platform; Based on the association analysis of genotype and high-throughput phenotypic data, a precise selection model was established to accelerate the fixation and improvement of crack-resistant traits.

[0013] According to a sixth aspect of the present invention, a method for synergistic improvement of multiple traits of rapeseed, including polymerizing crack resistance and other excellent traits, is provided, comprising: The BnNST2 loss-of-function mutant created by the method described above was used as the parental donor for the keratin resistance trait. Foreground selection is performed using the aforementioned KASP molecular markers, while background selection or aggregation selection is performed using molecular markers linked to other target traits. The other target traits are selected from: increasing oleic acid content by editing the BnaFAD2 gene, enhancing disease resistance by editing the BnaWRKY70 or BnaRLK902 gene, regulating flowering time by editing the BnaTFL1 gene, and increasing yield potential by editing the BnEOD3 or BnCLV3 gene.

[0014] According to a seventh aspect of the present invention, an application of a high-throughput gene editing and validation platform for the large-scale creation of rapeseed mutants is provided, wherein the BnNST2 gene is used as a target gene and is incorporated into a CRISPR sgRNA library containing multiple genes targeting different agronomic traits. The platform enables the one-time transformation of rapeseed materials to create a large-scale mutant library including the BnNST2 gene editing event. Using the KASP molecular marker and high-throughput phenotyping technology described above, editing events that significantly improve crack resistance can be rapidly screened and identified from the mutant library, and their association with other traits can be evaluated.

[0015] According to an eighth aspect of the present invention, an application is provided for rapeseed edited plant cells, plant tissues or propagation materials directly obtained by the method in the breeding of angular-resistant rapeseed varieties, wherein the edited plant cells, plant tissues or propagation materials contain a loss-of-function mutation of the BnNST2 gene, and the loss-of-function mutation does not contain exogenous transgenic components.

[0016] Compared with the prior art, the advantages of the present invention include: 1) The present invention has a clear target and significant effect. Based on the well-defined and highly effective functional gene BnNST2 and its key allelic variants, the present invention avoids the low effectiveness and uncertainty of traditional QTL mapping.

[0017] 2) The tools of this invention are precise and efficient. The KASP marker developed in this invention is accurate, has high throughput, and low cost. The designed CRISPR editing system has strong targeting and can utilize new technologies such as base editing to achieve safer and more precise editing.

[0018] 3) The breeding process of this invention is intelligent. This invention combines genotyping, high-throughput phenotype and selection model to realize data-driven precision breeding against split horn traits, which greatly improves selection efficiency and accuracy.

[0019] 4) The present invention has great potential for trait aggregation. The multi-trait synergistic improvement method provided by the present invention can organically combine the key mechanical harvesting trait of crack angle with other important agronomic traits such as oil quality, disease resistance, and yield composition, and create new germplasm with excellent comprehensive traits. Detailed Implementation

[0020] In view of the shortcomings of the prior art, the inventors of this invention, through long-term research and extensive practice, have proposed the technical solution of this invention. The following will further explain and illustrate this technical solution, its implementation process, and its principles.

[0021] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0022] Unless otherwise specified, the experimental methods used in the following embodiments are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials used in the following embodiments are commercially available.

[0023] This invention provides an application of the Brassica genus BnNST2 gene in improving the crack resistance of rapeseed pods, wherein the application is achieved by introducing or creating a loss-of-function allelic variant of the BnNST2 gene; the loss-of-function allelic variant is obtained through any of the following methods: Using a KASP molecular marker, a naturally occurring single-base C deletion variant located at position 199 of the gene in rapeseed germplasm was identified and screened. Using a genome editing system, frameshift mutations or premature stop codons are introduced into the coding region of the gene; Using a base editor or primer editor, point mutations can be introduced at key sites in the gene to terminate translation prematurely.

[0024] In the early stages of this invention, genome-wide association analysis identified a major-effect site in Brassica napus that contributes 32% to the cleavage index, with its peak value located near the BnNST2 gene. Further research revealed a crucial single nucleotide variant at position 199 after the start codon of this gene: cytosine (C) in easily cleavable materials, but absent (-) at this site in cleavage-resistant materials. This C base deletion leads to a frameshift, causing premature translation termination and resulting in a truncated, loss-of-function protein. This discovery provides a novel target for developing precise molecular breeding tools and strategies.

[0025] To better understand the technical solution of the present invention, the following detailed discussion is provided in conjunction with specific embodiments.

[0026] Example 1: Discovery of key allelic variants in the BnNST2 gene and development of KASP molecular markers 1. Materials and Methods: Natural populations of 128 genetically diverse Brassica napus accessions were collected, and the silique crack resistance index (SRI) was investigated under multiple environmental conditions. Genomic DNA was extracted from each accession and subjected to whole-genome resequencing or microarray analysis.

[0027] 2. Association analysis: Genome-wide association analysis (GWAS) was performed using software such as Tassel.

[0028] 3. Allelic variant identification: Resequencing and haplotype analysis of materials within the associated region revealed a functional variant at position 199 after the start codon of the BnNST2 gene: a "C" in the easily cleaved haplotype and a "-" (deletion) in the cleavage-resistant haplotype. This deletion caused subsequent reading frame shifts and premature appearance of the stop codon.

[0029] 4. KASP Marker Design and Validation: KASP marker primers were designed for this C / - variant (sequences are shown in SEQ ID NO. 1-3). The natural population was genotyped using the standard KASP reaction system and procedure.

[0030] GAAGGTGACCAAAGTTCATGCTTGGAACAACCCCC (SEQ ID NO.1) GAAGGTGGAGTCAACGGATTGGAACAACCCCA (SEQ ID NO.2) CGTCCGGTTGCTTTCCAG (SEQ ID NO.3) Example 2: Creating new germplasm resistant to horn splitting by editing the BnNST2 gene using the CRISPR-Cas9 system 1. Vector Construction: Using commonly used plant CRISPR vectors such as pKSE401 as the backbone, two sgRNAs targeting the exons of the BnNST2 gene (with the sequence of the easily splitting material R2 as a reference, SEQ ID NO.1) were designed and synthesized based on the coding region sequence of the BnNST2 gene. The target sequence is contained within the regions shown in SEQ ID NO.4-7. The sgRNA expression cassettes were constructed into the vector using methods such as Golden Gate cloning.

[0031] ATATATGGTCTCGATTGGAACAACCCCCAAAACGATGTT (SEQ ID NO.4) ATATATGGTCTCGAAACGAATCCGACTGTGGTGCTCA (SEQ ID NO.5) TGGAACAACCCCCAAAACGATGTTTTAGAGCTAGAAATAGC (SEQ ID NO.6) AACGAATCCGACTGTGGTGCTCAATTTCTAGCTCTAAAAC (SEQ ID NO.7) 2. Genetic transformation: The recombinant vector was transformed into Agrobacterium GV3101 and used to infect the hypocotyls of the easily angular-split rapeseed variety 'R2'. After hygromycin resistance screening, callus induction, and plant regeneration, T0 generation transgenic plants were obtained.

[0032] 3. Mutant identification: DNA was extracted from leaves of T0 generation plants, and PCR amplification and sequencing were performed using target flanking primers (such as SEQ ID NO. 8-9).

[0033] CCGGGATTCGATTGGGGA (SEQ ID NO.8)GCGTTTGATCGATCTCGGGC (SEQ ID NO.9) 4. Phenotypic identification: Homozygous mutants of the T1 or T2 generation were planted under the same conditions as the wild-type 'R2' control.

[0034] Example 3: Crack-resistant breeding using KASP marker-assisted selection and high-throughput phenotypes 1. Parental selection and hybridization: The male parent is a material carrying the BnNST2 resistance allele (- / -), and the female parent is a popular variety with excellent overall traits but prone to pod splitting. The F1 generation is obtained by hybridization.

[0035] 2. Molecular marker-assisted selection: DNA was extracted from individual leaves in the F2 segregating population, and high-throughput genotyping was performed using the KASP marker developed in Example 1. Homozygous resistant individuals with genotype - / - were rapidly screened.

[0036] 3. High-throughput phenotypic validation: For the selected candidate plants, non-destructive and quantitative detection of silique crack resistance is carried out using an automated phenotyping platform (such as a mechanical shaking device equipped with a camera) to obtain high-throughput phenotypic data.

[0037] 4. Model-Assisted Decision Making: By performing correlation analysis between genotype data and high-throughput phenotypic data, a genotype-phenotype prediction model for the keratin resistance trait is established. This model can be used for more accurate early selection and screening of superior strains in subsequent generations (such as F3 families), significantly shortening the breeding cycle.

[0038] Example 4: Multigene editing of polymeric crack resistance and high oleic acid traits 1. Construction of multi-target vectors: On the same CRISPR-Cas9 or base editor vector, assemble two sgRNA expression cassettes: one targeting the BnNST2 gene (same as in Example 2), and the other targeting the BnaFAD2 gene that controls lipid desaturation (design the target to cause it to lose its function in order to increase oleic acid content).

[0039] 2. Transformation and Screening: The constructed multi-target vector was transformed into rapeseed to obtain edited plants. Lines with loss-of-function homozygous or biallelic mutations in both the BnNST2 and BnaFAD2 genes were screened by target site sequencing.

[0040] 3. Trait Identification: The double-gene-edited lines were subjected to silique crack resistance tests and gas chromatography analysis of grain fatty acid composition. The results showed that, compared with the wild type, the edited lines exhibited significantly improved silique crack resistance and a highly significant increase in grain oleic acid content, successfully achieving simultaneous improvement of two important traits.

[0041] Example 5: Obtaining Editing Materials Without Exogenous Genetic Modifications and Their Applications 1. Isolation and purification: The T0 generation edited plants obtained in Examples 2 or 4 were self-crossed, and the T1 generation was detected by PCR to detect exogenous transgenic components such as Cas9 / sgRNA and the editing status of target genes.

[0042] 2. Screening for non-transgenic edited lines: Lines with homozygous mutations at the target gene site but no longer containing the exogenous CRISPR-Cas9 expression cassette are selected. These plants exhibit only a small-scale sequence change at the target site in their genome and do not contain any exogenous genes.

[0043] 3. Breeding applications: Such edited materials can be directly used as superior germplasm resources for resistance to angular breakage (or aggregation of other traits) for conventional hybridization breeding with other varieties. Their superior traits can be inherited according to Mendel's laws and are not subject to the strict restrictions of transgenic regulations, which facilitates variety approval and promotion.

[0044] The above descriptions are merely some embodiments of the present invention. It should be noted that those skilled in the art can make other modifications and improvements without departing from the inventive concept of the present invention, and these all fall within the protection scope of the present invention.

Claims

1. The application of the Brassica genus BnNST2 gene in improving the crack resistance of rapeseed pods, characterized in that, The application is achieved by introducing or creating a loss-of-function allele of the BnNST2 gene; the loss-of-function allele is obtained through any of the following methods: Using a KASP molecular marker, a naturally occurring single-base C deletion variant located at position 199 of the gene in rapeseed germplasm was identified and screened. Using a genome editing system, frameshift mutations or premature stop codons are introduced into the coding region of the gene; Using a base editor or primer editor, point mutations can be introduced at key sites in the gene to terminate translation prematurely.

2. A KASP molecular marker for detecting loss-of-function allelic variants of the BnNST2 gene as described in claim 1, characterized in that, The KASP molecular marker comprises an oligonucleotide primer combination capable of specifically distinguishing the presence or absence of the C base at position 199 of the gene, the sequences of which are shown in SEQ ID NO.1 to SEQ ID NO.

3.

3. A CRISPR-Cas recombinant nucleic acid construct for editing the Brassica genus BnNST2 gene, characterized in that, The construct includes: The nucleotide sequence encoding a Cas effector protein, wherein the Cas effector protein is selected from Cas9, Cas12a, or a variant thereof having nuclease activity; At least one guide RNA coding sequence targeting the coding region of the BnNST2 gene; The target sequence of the guide RNA includes the region covered by the sequences shown in SEQ ID NO.4 to SEQ ID NO.

7.

4. The recombinant nucleic acid construct according to claim 3, characterized in that, The construct contains two or more guide RNA coding sequences that target different sites of the BnNST2 gene or simultaneously target the BnNST2 gene and its functionally redundant homologous genes, in order to achieve efficient editing of multiple gene sites.

5. The recombinant nucleic acid construct according to claim 3, characterized in that, The Cas effector protein is an adenine base editor or a cytosine base editor, used to introduce site-directed base substitutions in the BnNST2 gene that are independent of DNA double-strand breaks, in order to create loss-of-function allelic variants.

6. A method for creating angularly cracked rapeseed germplasm, characterized in that, Includes the following steps: The recombinant nucleic acid construct according to any one of claims 3 to 5, or the ribonucleoprotein complex obtained by transcription and translation from the recombinant nucleic acid construct, is introduced into rapeseed recipient cells by Agrobacterium-mediated transformation, gene gun transformation, or efficient transformation method based on WUSCHEL gene to promote regeneration. Transgenic plants or edited plants are obtained from the regeneration of the recipient cells; Using the KASP molecular marker and / or sequencing technology as described in claim 2, individuals with loss-of-function homozygous or biallelic mutations in the BnNST2 gene are screened and identified from the plant.

7. A molecular breeding method for rapeseed pod-cracking resistance combined with high-throughput phenotypic detection, characterized in that, Includes the following steps: Using the KASP molecular marker as described in claim 2, the breeding population is genotyped, and individual plants carrying resistance allelic variations are screened. For the selected individual plants or their derived progeny, a high-throughput non-destructive test of the silique crack resistance index was performed using an automated phenotyping platform; Based on the association analysis of genotype and high-throughput phenotypic data, a precise selection model was established to accelerate the fixation and improvement of crack-resistant traits.

8. A method for synergistic improvement of multiple traits of rapeseed, including polymerizable anti-cracking properties and other desirable traits, characterized in that, include: The BnNST2 loss-of-function mutant created by the method described in claim 6 was used as the parental donor for the horn-resistant trait. Foreground selection is performed using the KASP molecular markers as described in claim 2, while background selection or aggregation selection is performed using molecular markers linked to other target traits; The other target traits are selected from: increasing oleic acid content by editing the BnaFAD2 gene, enhancing disease resistance by editing the BnaWRKY70 or BnaRLK902 gene, regulating flowering time by editing the BnaTFL1 gene, and increasing yield potential by editing the BnEOD3 or BnCLV3 gene.

9. An application of a high-throughput gene editing and validation platform for the large-scale creation of rapeseed mutants, characterized in that, The BnNST2 gene described in claim 1 was used as the target gene and included in a CRISPR sgRNA library containing multiple genes targeting different agronomic traits. The platform enables the one-time transformation of rapeseed materials to create a large-scale mutant library including the BnNST2 gene editing event. Using the KASP molecular marker and high-throughput phenotyping technology described in claim 2, editing events that significantly improve crack resistance can be rapidly screened and identified from the mutant library, and their association with other traits can be evaluated.

10. The application of rapeseed edited plant cells, plant tissues, or propagation materials directly obtained by the method of claim 6 or 9 in the breeding of angularly resistant rapeseed varieties, characterized in that, The edited plant cells, plant tissues, or propagation materials contain a loss-of-function mutation of the BnNST2 gene, and the loss-of-function mutation does not contain any exogenous transgenic components.