Application of soybean shade-tolerant gene GmPIF6c in soybean breeding

By overexpressing the GmPIF6c gene in soybean and utilizing In-Fusion seamless cloning and Agrobacterium-mediated transformation technology, the problem of excessive elongation caused by shading in densely planted and intercropped soybeans was solved, resulting in reduced plant height and petiole length, and improved lodging resistance and yield.

CN121380187APending Publication Date: 2026-01-23SICHUAN AGRI UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511942439.0
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-12-22
Publication Date
2026-01-23

AI Technical Summary

Technical Problem

Soybeans are susceptible to shading from canopy and taller crops in dense planting and intercropping, leading to a shading response, excessive elongation, increased petiole length, severe lodging, and reduced yield.

Method used

By overexpressing the GmPIF6c gene, its coding sequence was cloned into the pBF vector using the In-Fusion seamless cloning method. The GmPIF6c gene was then overexpressed in soybean using Agrobacterium-mediated transformation technology to regulate soybean growth and reduce plant height and petiole length under shade.

Benefits of technology

It significantly reduced the plant height and petiole length of soybeans under shade, improved lodging resistance, optimized plant structure, improved photosynthetic efficiency, and increased yield.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121380187A_ABST
    Figure CN121380187A_ABST
Patent Text Reader

Abstract

The invention relates to the technical field of agricultural biology, discloses an application of a soybean shade-tolerant gene GmPIF6c in soybean breeding, and is characterized in that the gene GmPIF6c which has a remarkable regulation effect on plant height, petiole and shade tolerance of soybeans is obtained through screening and verification. The plant height and the petiole length of the soybean under shading stress are remarkably reduced by overexpression of the gene in the soybean plant, and the shade tolerance of the soybean is remarkably improved. The soybean gene GmPIF6c is a gene for coding a protein with an amino acid sequence as shown in SEQ ID No. 1. The invention provides a new gene resource for creating dwarf, compact and shade-tolerant soybean plants.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The application relates to the field of agricultural biotechnology and the field of plant genetic engineering technology, in particular to application of a shade tolerance gene GmPIF6c in soybean breeding. BACKGROUND

[0002] Soybean (Glycine max (L.) Merr.) is an important food and oil crop, and is the main source of plant protein for people's daily life. With the continuous increase of global population, the demand for soybean is also rising, while the global arable land area is limited and faces many pressures, so how to improve soybean yield becomes a key problem. Dense planting and intercropping are important cultivation methods to improve soybean yield, however, in dense planting and intercropping cultivation, soybean is prone to be shaded by the canopy and high crops, and produces shade avoidance response, resulting in excessive elongation growth, increased petiole length, and thus serious lodging and significant yield reduction.

[0003] Shaded environment is mainly caused by low red light and low blue light factors, phytochromes (phys) are red and far-red light receptors, and red light converts phyB into an active far-red light absorbing form (pfr), and in the presence of Ca2 + The signal participates in the process of regulating phyB into the nucleus by calcium-dependent protein CPKs, and active phys can bind to phytochrome interacting factors (PIFs) and cause their phosphorylation and ubiquitination degradation to change the expression of downstream genes. As an intracellular signal "hub", PIFs are involved in environmental signal and hormone signal pathways, and regulate seed germination, light and dark morphogenesis, heat morphogenesis and shade avoidance response processes. Under shade stress, PIF can specifically bind to the promoters of auxin synthesis genes such as TAA1 and YUCCAs (YUCs) to drive their expression. In addition, PIF2 / PIL1 can bind to its own promoter under shade to negatively regulate its own expression, and PIF2 / PIL1 and PIF3 interact with each other to inhibit the rapid elongation growth of plants.

[0004] Reducing plant height and petiole length is of great significance to soybean production, mainly in improving lodging resistance, optimizing plant structure to adapt to high-density planting, improving photosynthetic efficiency and ultimately increasing yield, etc. Therefore, it is of great significance to tap excellent gene resources, reduce soybean plant height and petiole length under dense planting and intercropping, and improve the tolerance of soybean to shade stress, to improve soybean yield and quality.

[0005] The application provides application of a shade tolerance gene GmPIF6c in soybean breeding, and through overexpression of the gene coding sequence of GmPIF6c, the plant height and petiole length of soybean under shade can be significantly reduced. The application is realized through the following technical scheme:

[0006] The application of a shade-tolerant gene GmPIF6c in soybean breeding, the soybean gene GmPIF6c is a gene encoding the amino acid sequence shown in SEQ ID NO. 1. Further, the GmPIF6c nucleotide sequence is shown in SEQ ID NO. 2. The scheme includes the following steps:

[0007] Vector construction:

[0008] A. The nucleotide sequence of 1-1350 of the coding nucleotide sequence of the soybean GmPIF6c gene is amplified:

[0009] Primer1 SEQ ID NO. 3: 5' - ATTTACGAACGATAGCCGGTACCATGGCTGCTGAGAAGATGCC - 3';

[0010] Primer2 SEQ ID NO. 4: 5' - GTAGTCCACCACTTTGTACAGTTGCTTTGTTGCATATTCAGC - 3';

[0011] B. The fragment is constructed into the pBF vector by In-Fusion seamless cloning to obtain the pBF-GmPIF6c-Flag recombinant plasmid;

[0012] C. The recombinant plasmid is transformed into E. coli DH5α, and the bacterial solution is spread on LB solid medium containing 50 μg / mL of kanamycin, and incubated at 37°C overnight. After positive clones are identified by colony PCR and enzyme digestion, a positive single colony is picked into LB liquid medium containing 50 μg / mL of kanamycin, and incubated at 37°C overnight. The plasmid is extracted using a kit and sequenced. The primers used for colony PCR identification are:

[0013] Primer3 SEQ ID NO. 5: 5' - CAAACGAATCTCAAGCAATC - 3';

[0014] Primer4 SEQ ID NO. 6: 5' - ACCTAGTCATTTGTCGTCATCGT - 3';

[0015] D. The enzyme digestion site is Bsp1407I, and the enzyme digestion system is: Nuclease-free water 16µL, 10 × Buffer Tango 2 µL, recombinant plasmid pBF-GmPIF6c-Flag 1 µL, Thermo Scientific Bsp1407I 1.0 µL, and the reaction is carried out at 37°C for 1 h.

[0016] E. After the recombinant plasmid sequencing is correct, the plasmid is transformed into Agrobacterium EHA105, the bacterial liquid is coated on the LB solid medium containing 50 μg / mL kanamycin and 25 μg / mL Rifampicin, and the bacterial liquid is cultured at 28°C for 2 days. After the colony PCR identification is positive, the positive single colony is picked to the LB liquid medium containing 50 μg / mL kanamycin and 25 μg / mL Rifampicin, and the bacteria are stored in the glycerol with a final concentration of 50% after being shaken at 28°C for 2 days.

[0017] Overexpression of soybean GmPIF6c gene in soybean:

[0018] A. Select soybean seeds that are round and full, uniform in size, and free of disease spots, and chlorinate for 16 h;

[0019] B. The Agrobacterium strain stored at -80°C is expanded to OD 650=0.8 - 1.0, and the bacteria are collected by centrifugation at 5000 rpm for 10 min, and the bacteria are resuspended in the infection medium to OD 650=0.6 - 0.8;

[0020] C. The soybean seeds soaked in sterile water for about 16 h are divided, the true leaves are removed, the cotyledon nodes are wounded, and the prepared explants are placed in the infection liquid for 30 min, and then cultured in the synergistic medium for 5 days;

[0021] D. The explants are inserted into the bud induction medium with the wound facing up and cultured for 4 weeks, and the medium is replaced every two weeks;

[0022] E. After removing the cotyledons of the bud induction material, the bud elongation medium is transferred, and cultured for 8 weeks. When the bud elongation is about 5 cm long, root induction is performed;

[0023] F. When the induced roots are about 1 cm long and the number reaches 2-3, they can be transferred to the soil for acclimation;

[0024] G. After the compound leaves of the acclimated seedlings are fully expanded, 0.1% BASTA solution is used to smear the leaves for herbicide resistance detection;

[0025] H. According to the full-length coding nucleotide sequence of the soybean GmPIF6c gene, which contains 1350 base pairs, the encoded amino acid consists of 443 amino acids, and the molecular weight is 49161 Da. RT-qPCR is used to detect the overexpression of GmPIF6c gene in the transformed seedlings with herbicide resistance.

[0026] Phenotypic identification of soybean GmPIF6c gene overexpression material under shade:

[0027] A. Soybean seeds were planted in nutrient soil, keeping the control (Wild type) and GmPIF6c gene overexpression material (GmPIF6c - OE) planting depth consistent, germinated in the dark;

[0028] B. Soybean shade treatment: immediately after seed germination, transfer to normal light (WL) and shade (Shade) conditions to grow to V2 stage, observe and count the change of main stem length. As shown in Figure 1 Under shade, the plant height and petiole length of soybean GmPIF6c gene overexpression material (GmPIF6c - OE Line 12, Line 16) were significantly lower than the control.

[0029] Beneficial effects: the application discloses application of shade-resistant gene GmPIF6c in soybean breeding, through amplification of 1-1350 nucleotides of the coding nucleotide sequence of soybean GmPIF6c gene, and recombination of the vector by using In-Fusion seamless cloning method, the full-length nucleotide coding sequence of the soybean GmPIF6c gene is cloned into the pBF vector; the herbicide resistance of the transformation receptor is screened by the resistance of the grass ammonium phosphonium marker gene, and the expression of the soybean GmPIF6c gene is detected by qRT-PCR, so that the positive seedlings can be accurately and quickly detected. The soybean GmPIF6c gene and the coded protein thereof have a significant inhibitory effect on the main stem length of soybean under shade, the results are accurate and reliable, the regulation method is simple, convenient, formulaizable, and easy to popularize and apply. BRIEF DESCRIPTION OF DRAWINGS

[0030] Figure 1 The phenotype graph and data statistical graph of the control (Wild type) and GmPIF6c overexpression soybean material (GmPIF6c - OE Line 12, Line 16) under shade. DETAILED DESCRIPTION

[0031] In order to facilitate understanding of the content of the present application, the technical solutions of the present application will be further described below in combination with specific embodiments, but the present application is not limited thereto. The experimental materials and chemicals used in the following examples are commercially available from conventional biochemical reagent stores, unless otherwise specified. The determination of the vector in the following examples is determined by conventional sequencing company sequencing.

[0032] Example 1 Construction of Recombinant Plasmid

[0033] A. The coding nucleotide sequence of soybean GmPIF6c (Gene ID Glyma.10G138800) gene downloaded from the Phytozome website (https: / / phytozome-next.jgi.doe.gov / ) is shown as SEQ ID NO. 1, and the primers are designed as follows:

[0034] Primer1 SEQ ID NO. 3: 5' - ATTTACGAACGATAGCCGGTACCATGGCTGCTGAGAAGATGCC - 3';

[0035] Primer2 SEQ ID NO. 4: 3' - GTAGTCCACCACTTTGTACAGTTGCTTTGTTGCATATTCAGC - 3';

[0036] B. RNA of soybean Williams 82 was extracted and reverse transcribed into cDNA as a template, and the RNA extraction and reverse transcription were performed using the total RNA extraction kit for polysaccharide and polyphenol plants (FOREGENE, RE-05024) and the degenomic first-strand cDNA synthesis premix system Master Premix (FOREGENE, RT-01032), respectively; the GmPIF6c nucleotide sequence shown in SEQ ID NO. 2 was amplified by PCR using the above primers, and the amplification was performed using the high-enzyme Phanta Flash Master Mix (Vazyme #P510), and the reaction system was as follows: 20 μl ddH2O; 25 μl 2 × Phanta Flash Master Mix; 2 μl Primer1; 2 μl Primer2; 1 μl Williams82 cDNA template. The PCR reaction program was as follows: 98℃ pre-denaturation for 1 min; 98℃ denaturation for 10 s, 58℃ annealing for 30 s, 72℃ extension for 1 min 30 s, 32 cycles; 72℃ extension for 10 min; 4℃ storage.

[0037] C. The size of the amplified GmPIF6c fragment was 1350 bp, and the PCR product was purified.

[0038] D. The vector pBF was double digested with restriction endonucleases BSP1407Ⅰand KpnⅠ, and the linearized vector was recovered.

[0039] E. The PCR product and the linearized pBF were recombined using the recombination kit ClonExpress II One Step Cloning Kit.

[0040] F. After the recombination reaction is completed, the recombination reaction product is transformed into E. coli DH5a competent cells (TSC-C14), and the operation is performed according to the instructions. After 37℃ overnight culture, a plurality of single colonies are obtained.

[0041] G. Each single colony is used as a template for PCR amplification detection. First, the single colony is resuspended with 20 μl ddH2O and treated at 95℃. The colony PCR system is as follows: 20 μl ddH2O; 25 μl 2 × Taq Master Mix; 2 μl Primer3; 2 μl Primer4; 1 μl bacterial liquid template. The reaction program is as follows: 98℃ pre-denaturation for 1 min; 98℃ denaturation for 10 s, 58℃ annealing for 30 s, 72℃ extension for 6 min, 32 cycles; 72℃ extension for 10 min; 4℃ storage.

[0042] The colony identification primers are as follows:

[0043] Primer3 SEQ ID NO.5: 5’ - ‘CAAACGAATCTCAAGCAATC - 3’;

[0044] Primer4 SEQ ID NO.6: 5’ - ‘ACCTAGTCATTTGTCGTCATCGT - 3’;

[0045] H. The correct colony is identified and sent to the company for sequencing comparison. The sequencing results are compared with the original sequence to determine the correct colony. The correct colony is transferred to a liquid LB medium containing 50 μg / mL kanamycin, and cultured at 180 rpm and 37℃ overnight. The plasmid pBF-GmPIF6c-FLAG is extracted for subsequent experiments.

[0046] Example 2 Agrobacterium-mediated soybean transformation

[0047] The correct plant expression vector pBF-GmPIF6c-FLAG constructed in step example 1 is transformed into Agrobacterium EHA105 competent cells (TSC-A03) according to the instructions. The competent cells are coated on 50 μg / mL kanamycin and 25 μg / mL rifampicin LB solid medium, and cultured at 28℃ for 2 days. After colony PCR identification of positive clones, the strain is stored in a final concentration of 50% glycerol. The colony PCR reaction system and reaction program are the same as described above. The steps of Agrobacterium-mediated soybean transformation are as follows:

[0048] A. Select plump, full, uniform, and no disease spot soybean seeds, put them into a dry dish, and sterilize them with 100 mL 84 disinfectant and 5 mL HC1 liquid mixed to produce chlorine gas for 16 h;

[0049] B. Agrobacterium activation: Agrobacterium strain stored at -80°C was added to liquid YEP medium containing 50 pg / mL kanamycin and 25 pg / mL Rifampicin at a concentration of 1 : 200, and expanded at 28°C at 220 rpm to OD650= 0.8 - 1.0;

[0050] B. Preparation of infection solution: collect bacterial precipitate at 3500 rpm for 10 min, then resuspend with infection medium for standby.

[0051] C. Select healthy seeds, divide cotyledons, remove main buds, and make wounds at cotyledon nodes. Place the treated explants in the infection solution for 30 min, then place them in the co-culture medium for 5 days.

[0052] D. After 5 days of co-culture, insert the explant wound upwards into the bud induction medium and place it in the incubator for 4 weeks, replacing the medium every two weeks.

[0053] E. Transfer the explants after four weeks of bud induction to the bud elongation medium, and culture for 8 weeks at this stage. When the buds elongate to more than 3 cm, perform root induction, and induce 3-5 roots for domestication.

[0054] F. After the new compound leaves of the domesticated seedlings are fully expanded, smear the leaves with glyphosate solution to detect whether they have herbicide resistance. Perform PCR and qPCR detection on the leaves with resistance. The PCR identification primers are Primer 3 and Primer 4, and the qPCR primers are as follows:

[0055] Primer 5 SEQ ID NO.7: 5’ – ACATCAACCTGGCGGAAAACCC - 3’;

[0056] Primer 6 SEQ ID NO.8: 5’ – TGGCTAGTGGGGAAGGGAAACC - 3’;

[0057] Example 3 Phenotypic identification of GmPIF6c overexpression material under shade

[0058] A. Soybean germination and planting: wrap the seeds with a damp cloth, germinate at 25°C for two days, then select the uniform seedlings and transplant them into nutrient soil to continue growing under white light (WL) until the seedlings break through the soil.

[0059] B. Soybean Shading Treatment: After seedlings emerge from the soil, they are placed under normal light (WL) and shaded conditions (ShadeStress) until stage V3. Changes in plant height and petiole length are then observed and statistically analyzed. For example... Figure 1 As shown, under shade, the plant height and petiole length of the GmPIF6c overexpression material 35S::GmPIF6c-FLAG were significantly lower than those of the control.

[0060] Furthermore, overexpression of the GmPIF6c gene can be applied to crops such as corn and potatoes to achieve high yields per unit area through reasonable dense planting and intercropping.

[0061] The above are merely preferred embodiments of the present invention. The scope of protection of the present invention is not limited to the embodiments shown herein. All technical solutions falling within the scope of the present invention's concept are within the scope of protection of the present invention. It should be noted that for those skilled in the art, any modifications and refinements made without departing from the principles of the present invention should also be considered within the scope of protection of the present invention.

Claims

1. Application of a shade tolerance gene GmPIF6c in reducing soybean plant height, petiole length and improving soybean shade tolerance.

2. The method of claim 1, wherein, The amino acid sequence of the GmPIF6c gene is shown as SEQ ID NO.

1.

3. The method of claim 1, wherein, The coding nucleotide sequence of the gene is shown as SEQ ID NO.

2.

4. The method of claim 1, wherein, The full-length nucleotide sequence of the gene is shown as SEQ ID NO.

9.

5. The method of claim 1, wherein, The plant height and petiole length of soybean under shade are reduced by overexpressing the GmPIF6c gene.

6. The use according to claim 5, characterized in that, A soybean transgenic material with overexpression of GmPIF6c is constructed.

7. The use according to claim 6, of the overexpression vector of the GmPIF6c gene, characterized by, It comprises the GmPIF6c gene in claim 3.

8. The use according to claim 6, wherein the overexpression vector of the GmPIF 6c gene is characterized by, The overexpression vector takes pBF vector as a backbone, and the GmPIF6c gene is constructed between Kpn I and BSP1407 I sites.

9. The overexpression vector of claim 6, wherein, The GmPIF6c gene is obtained by amplification using a soybean cDNA as a template and the primers shown as SEQ ID NO. 3 and SEQ ID NO.

4.

10. The use according to claim 6, characterized in that, The GmPIF6c is transferred into soybean by an Agrobacterium-mediated method, and transgenic plants are screened.