Preparation method and application of ATG5 and DC-SIGN bimolecular condition knockout mouse model

Abstract

The invention relates to a preparation method and application of an ATG5 and DC-SIGN bimolecular condition knockout mouse model, and belongs to the field of gene engineering. A mouse model is knocked out under the bimolecular conditions of ATG5 and DC-SIGN by hybridizing an Atg5f / f CD11c Cre < + > mouse with a Cd209aflox / flox C57BL / 6JGp mouse, and a DC cell of the Atg5f / f Cd209af / f CD11c Cre < + >, and a DC cell of the Atg5f / f Cd209af / f CD11c Cre < + > is knocked out under the bimolecular conditions of the ATG5 and the DC-SIGN. An intraperitoneal injection plasmodium johnsonii infection model is established, plasmodium proliferation is observed, CD4 + T cell response is detected, and the DC function is verified in combination with an in-vitro co-culture experiment. The model enhances DC phagocytosis and antigen presentation capabilities, promotes plasmodium specific CD4 + T cell activation, significantly inhibits plasmodium infection, provides a new target for targeted DC-SIGN-based malaria immunotherapy, and can be used as an antimalarial drug screening tool.

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of genetic engineering, and relates to a preparation method and application of an ATG5 and DC-SIGN double-molecule conditional knockout mouse model. BACKGROUND

[0002] Malaria, as one of the three major infectious diseases in the world, has long been a serious threat to human health. In recent years, the emergence of artemisinin-resistant Plasmodium and resistant Anopheles mosquitoes has made the situation of malaria prevention and control even more severe. At present, it is urgent to develop new prevention and control measures to cope with this global health problem.

[0003] Malaria-specific CD4 + T cell response plays a key role in host against blood stage Plasmodium infection, mainly through the secretion of interferon (IFN) γ, enhancing the phagocytosis and killing of infected red blood cells (pRBCs) by macrophages. Dendritic cells (DCs) as the main antigen presenting cells of malaria-specific CD4 + T cells, its activation mechanism has not been fully clear.

[0004] In recent years, it has been found that autophagy-related proteins (ATGs) and autophagy and LC3-associated phagocytosis (LAP) mediated by them are involved in the process of DC antigen presentation and T cell activation, however, the role and mechanism of ATGs and autophagy and LAP mediated by them in host control of malaria infection are not clear. Previous studies have found that DCs lacking ATG5 promote malaria-specific CD4 + T cell response, using single-cell sequencing to find potential effector molecules-phagocytosis receptor DC-SIGN (gene name Cd209a ), however, the specific role and mechanism of DC-SIGN in anti-malaria immunity is still unknown. SUMMARY

[0005] In order to verify the specific role and mechanism of DC-SIGN in anti-malaria immunity, the inventors constructed a DC cell conditional knockout ATG5 and DC-SIGN double-molecule mouse malaria infection model, and found that DCs lacking ATG5 can enhance host immune protection against blood stage Plasmodium by promoting DC-SIGN-dependent phagocytosis and antigen presentation. In view of this, the purpose of the present application is to provide a method for constructing an ATG5 and DC-SIGN double-molecule conditional knockout mouse model, and the second purpose is the application of the ATG5 and DC-SIGN double-molecule conditional knockout mouse model in mouse malaria infection.

[0006] To achieve the above objectives, the present invention provides the following technical solution: This invention provides a method for preparing an ATG5 and DC-SIGN bimolecular conditional knockout mouse model, the steps of which are as follows: S1: Building Atg5 f / f CD11c Cre + mice and Cd209a flox / flox Mice; S2: Using the Cre-loxP recombinase system, the loxP (locus of X (cross)-overinP1) sequence is first targeted and inserted. Cd209a The exon4-exon6 sites were identified, and then the tissue-specific recombinase Cre (cyclization recombinase) was used to recognize and excise their sequences. Adults were selected. Atg5 f / f CD11c Cre + mice and Cd209a flox / flox Mice were mated to produce heterozygous offspring, which were then mated into adult offspring to breed... Atg5 f / f Cd209a f / f CD11c Cre + Mice; S3: Yes Atg5 f / f Cd209a f / f CD11c Cre + The mice were genotyped to obtain the ATG5 and DC-SIGN bimolecular conditional knockout mouse models. Preferably, in the method for preparing the ATG5 and DC-SIGN bimolecular conditional knockout mouse model, the gene identification primer sequence is as follows: Atg5 flox / flox (Strain number: B6.129S-Atg5) <tm1myok>Mouse PCR identification primer sequence: ATG5 exon3-1: GAATATGAAGGCACACCCCTGAAATG (SEQ ID NO: 1) ATG5 check 2: ACAACGTCGAGCACAGCTGCGCAAGG (SEQ ID NO: 2) ATG5 short 2: GTACTGCATAATGGTTTAACTCTTGC (SEQ ID NO: 3) WT: 350bp; Homozygote: 700bp; Cd209a flox / flox Mouse PCR identification primer sequence of C57BL / 6JGp (Strain No. T019412): T019412-F1: CATCCCAAGCACTGCATAAAACT (SEQ ID NO: 4) T019412-R1: CTGGGCCAAGAAAATATAGTCACTG (SEQ ID NO: 5) WT: 325bp; Targeted: 427bp; CD11c-Cre Mouse PCR identification primer sequence of (Strain No. B6.Cg-Tg(Itgax-cre)1-1Reiz / J): CD11c-F: ACTTGGCAGCTGTCTCCAAG (SEQ ID NO: 6) CD11c-R: GCGAACATCTTCAGGTTCTG (SEQ ID NO: 7) TG: 313bp Further application of the ATG5 and DC-SIGN double-molecule conditional knockout mouse model in establishing a Plasmodium infection model; Preferably, the Plasmodium yoelli is injected intraperitoneally; P.y 17XNL to infect the ATG5 and DC-SIGN double-molecule conditional knockout mouse; Preferably, the Plasmodium yoelli is injected intraperitoneally; P.y 17XNL in an amount of 1 x 10 4 Preferably, the Plasmodium yoelli is injected intraperitoneally; Further application of the ATG5 and DC-SIGN double-molecule conditional knockout mouse model in studying the mechanism of immunotherapy for malaria; Preferably, the steps are as follows: (a) establishing a Plasmodium infection model by intraperitoneally injecting Plasmodium yoelli P.y 17XNL infect the mice; (b) detecting the proliferation of Plasmodium and the level of CD4 + T cell response in the infected mice; (c) based on the detection results, evaluating the effect of promoting DC-SIGN expression on enhancing CD4 + T cell response and inhibiting Plasmodium infection, for guiding the development of immunotherapy strategies for malaria; Preferably, the ATG5 and DC-SIGN double-molecule conditional knockout mouse model is applied in screening of anti-malaria treatment targets.

[0007] The beneficial effects of the present application are: The present application discloses the relationship between promoting DC-SIGN expression of DC cells and enhancing CD4 + T cell response, and explores its role in immunotherapy of malaria, thereby providing new strategies and theoretical basis for prevention and treatment of malaria.

[0008] 1. Key immune mechanisms are disclosed: It is confirmed that DCs lacking ATG5 promote Plasmodium-specific CD4 + T cell secretion of IFN-γ by up-regulating DC-SIGN-mediated phagocytosis of pRBCs and antigen presentation ability, and it is clear that DC-SIGN is a key effector molecule connecting autophagy (ATG5) and CD4 + T cell activation.

[0009] 2. New treatment targets are provided: It is confirmed that inducing DC-SIGN expression can enhance anti-malaria immune protection (such as inhibiting Plasmodium proliferation), thereby providing a theoretical basis for developing immunotherapy targeting DC-SIGN (such as agonist drugs). 3. Application value of the model: The double-molecule conditional knockout mouse model can be used as a tool for screening anti-malaria drug targets (such as in vitro co-culture system to verify the regulatory effect of drugs on DC-SIGN). It provides a new target (DC-SIGN) for immunotherapy of malaria, and promotes the development of treatment strategies (such as drugs or gene therapy) for enhancing DC-SIGN expression.

[0010] Other advantages, objects, and features of the present application will be in part apparent and in part pointed out hereinafter. The objects and other advantages of the present application can be achieved and obtained by means of the following description. BRIEF DESCRIPTION OF DRAWINGS

[0011] In order to make the purpose, technical scheme and advantages of the present application more clear, the preferred detailed description of the present application will be given below in combination with the drawings, in which: Figure 1 For Atg5 f / f Cd209a f / f CD11c Cre + Genotype identification of mice, verification of DC-SIGN knockout efficiency, A is CD11c Cre + Mice, ATG5 flox / flox and Cd209a flox / flox PCR electrophoresis results of mouse genotypes, B is a circle gate flow chart of flow cytometry detection of DC cells, C is flow cytometry detection Atg5 f / f Cd209a f / f CD11c Cre + and Atg5 f / f CD11c Cre + DC-SIGN expression peak chart of mouse DC and average fluorescence intensity statistical chart.

[0012] Figure 2 For the role of DC-SIGN in host anti-erythrocytic Plasmodium infection, A is the infection of Plasmodium yoelii P.y 17XNL of Atg5 f / f CD11c Cre + , Atg5 f / f Cd209a f / f CD11c Cre + and Atg5 f / f CD11c Cre - Plasmodium proliferation chart in mice, B is a circle gate flow chart of flow cytometry detection of Plasmodium-specific CD4 + T (CD4 + CD11a hi CD49d hi IFN-γ + ) cells secreting IFN-γ in the spleen of mice, C is P.y 17XNL the number of CD4 Atg5 f / f CD11c Cre + , Atg5 f / f Cd209a f / f CD11c Cre + Mice and Atg5 f / f CD11c Cre - Spleen malaria-specific CD4 + T (CD4 + CD11a hi CD49d hi IFN-γ + Percentage of IFN-γ secreting cells of spleen malaria-specific CD4 + T cells. E is the mean fluorescence intensity of IFN-γ secreting malaria-specific CD4 + T cells.

[0013] Figure 3 To determine the specific molecular mechanism of DC-SIGN in regulating malaria-specific CD4 + T cell responses. A is the flow cytometric detection of malaria-specific CD4 P.y 17XNL T cells on day 6. Atg5 f / f CD11c Cre + , Atg5 f / f Cd209a f / f CD11c Cre + and Atg5 f / f CD11c Cre - Percentage of pRBCs phagocytosed by spleen DCs in vitro of mice. B is the flow cytometric detection of malaria-specific CD4 P.y 17XNL T cells on day 0, 3 and 6. Atg5 f / f CD11c Cre + , Atg5 f / f Cd209a f / f CD11c Cre + and Atg5 f / f CD11c Cre - Percentage of pRBCs phagocytosed by spleen DCs in vitro of mice. C is the flow cytometric detection of malaria-specific CD4 P.y 17XNL T cells on day 0, 3 and 6. Atg5 f / f CD11c Cre + , Atg5 f / f Cd209a f / f CD11c Cre + and Atg5 f / f CD11c Cre - Percentage of CD4 + T cells secreting IFN-γ after in vitro co-culture of mouse splenic DCs with CD4 + T cells. D is infected P. yoelii. P.y 17XNL Percentage of CD4 Atg5 f / f CD11c Cre + , Atg5 f / f Cd209a f / f CD11c Cre + and Atg5 f / f CD11c Cre - Percentage of CD4 + T cells secreting IFN-γ after in vitro co-culture of mouse splenic DCs with CD4 DETAILED DESCRIPTION

[0014] Other advantages and embodiments of the present application will be apparent to those skilled in the art from the foregoing disclosure and the accompanying drawings. The present application can be practiced by other specific embodiments without departing from the spirit thereof. The disclosure is presented for illustrative purposes and should not be considered restrictive. Embodiments disclosed herein can be combined with one another in any manner without departing from the spirit of the present application. It is therefore intended that the present application not be limited to the specifically disclosed embodiments, but rather that it include all alternatives falling within the scope of, and the equivalents of, the appended claims.

[0015] The accompanying drawings are included to provide a further understanding of the application, and are incorporated in and constitute a part of this specification. The drawings illustrate embodiments of the application and, together with the description, serve to explain the principles of the application. In the drawings:

[0016] The same or similar reference numerals in the drawings of the embodiments of the present application correspond to the same or similar components; in the description of the present application, it is understood that if the terms "upper", "lower", "left", "right", "front", "back" and the like indicate the orientation or positional relationship, it is based on the orientation or positional relationship shown in the drawings, and is only for the convenience of describing the present application and simplifying the description, and does not indicate or imply that the device or element referred to must have a particular orientation, be constructed and operated in a particular orientation, therefore the terms describing the positional relationship in the drawings are only used for exemplary illustration, and cannot be understood as a limitation on the present application, for those skilled in the art, the specific meaning of the above terms can be understood according to the specific circumstances.

[0017] The materials and reagents used in the embodiments of the present application are as follows: (1) Materials The Plasmodium yoelii (P. yoelii) was a long-term breeding and preservation strain in the Department of Pathogenic Biology, Basic Medical College, Army Medical University of the People's Liberation Army. P.yoelii 17XNL

[0018] Atg5 f / f CD11c Cre + and Atg5 f / f CD11c Cre - The mice were previously constructed in the Department of Pathogenic Biology, Basic Medical College, Army Medical University of the People's Liberation Army. Cd209a flox / flox The C57BL / 6JGp mice (strain number: T019412) were purchased from GemPharmatech, Jiangsu, Atg5 f / f Cd209a f / f CD11c Cre + are Atg5 f / f CD11c Cre + The mice and Cd209a flox / flox were obtained by crossing C57BL / 6JGp, and the PbT-II and PbT-I transgenic mice were provided by Professors William R. Heath and Daniel Fernandez-Ruiz of the University of Melbourne, Victoria, Australia. All mice were raised in a specific pathogen-free environment and used at 6-8 weeks of age.

[0019] (2) Reagents ​Mouse genotyping reagents: DL1000×DNA Marker, DL2000×DNA Marker were purchased from TaKaRa (Japan); GenGreen nucleic acid dye was purchased from Dingguochangsheng (Beijing, China); Green Taq Mix was purchased from Novogene (Nanjing, China); 0.05M NaOH was purchased from Wako (Japan); 1M pH8.0 tris-HCl was purchased from Beyotime (China); 50×TAE was purchased from Sangon (Shanghai, China); Agarose powder was purchased from Invitrogen (USA); Primer lyophilized powder was purchased from Sangon (Shanghai, China).

[0020] Flow cytometry reagents: anti-CD11c (N418), anti-CD209a (MMD3), anti-CD4 (GK1.5), anti-CD11a (M17 / 4), anti-CD49d (R1-2), anti-IFN-γ (XMG1.2), anti-TCR Vα2 (B20.1), anti-TCR Vβ12 (MR11-1), anti-TCR Vα8.3 (B21.14), anti-TCR Vβ10 (B21.5), anti-I-A / I-E (M5 / 114.15.2), and anti-mouse CD16 / CD32 (Clone 93) were purchased from BioLegend (USA); LIVE / DEAD™ Fixable Near IR (780) Viability kit for 633nm excitation was purchased from Invitrogen (USA); Leukocyte Activation Cocktai with BD GolgiPlug and Cytofix / Cytoperm™ Fixation / Permeabilization Kit were purchased from BD Biosciences (USA).

[0021] In vitro co-culture reagents: RPMI 1640 medium and Fetal Bovine Serum (FBS) were purchased from Hyclone, USA; Sodium Pyruvate, Non-Essential Amino Acids (NEAA), GlutaMAX were purchased from Gibco, USA; 2-Mercaptoethanol was purchased from Sigma-Aldrich, USA; Penicillin-Streptomycin-Gentamicin Solution was purchased from Beyotime, Shanghai; CFSE Cell Proliferation Kit was purchased from Invitrogen, USA; PercollTM was purchased from Cytiva, USA; CD11c MicroBeads UltraPure, CD4 + T Cell Isolation Kit, autoMACS® Running Buffer and LS column were purchased from Miltenyi Biotec, Germany; 96-well plates were purchased from corning, USA.

[0022] (3) Instruments Mainly including PCR instrument and gel imaging instrument of Bio-Rad, USA, electrophoresis power supply of Liyi, Beijing, China, incubator of Thermo Forma, USA, and CANTO II flow cytometer of BD, USA.

[0023] Example 1 (I) Construction of ATG5 and DC-SIGN double molecular conditional knockout mice On the basis of DC deletion ATG5 conditional knockout (ATG5fl / fl;Clec9a-Cre) mice, Atg5 f / f CD11c Cre + On the basis of DC deletion ATG5 conditional knockout (ATG5fl / fl;Clec9a-Cre) mice, Cd209a exon4-exon6 sites of the gene, and then use tissue-specific recombinase Cre (cyclization recombinase) to recognize and remove it. By Atg5 f / f CD11c Cre + Mice were crossed with Cd209a flox / flox DC conditional knockout ATG5 mice were successfully obtained by crossing mice, and Atg5 f / f Cd209a f / f CD11c Cre + Genotyping of mice.

[0024] (II) Genotyping of mice Cut 2mm of mouse tail, and use 180µL 0.05M NaOH to lyse the tissue sample, and boil in 100℃ water bath for 10min, Add 20µL 1M tris-HCl and mix well to get DNA solution. Dissolve and dilute the primer lyophilized powder according to the instruction in advance. Add 10µL Green Taq Mix, 0.8µL / primer, 1µL DNA solution to each sample, and add 20µL high-pressure sterile water to make up the volume. Set the PCR instrument program value according to the recommended value of Green Taq enzyme. After the PCR program is completed, add 10µL / sample to the slot of 1% agarose gel, and select the reference (DL2000 x DNA Marker). Set the electrophoresis to run for about 30min, and then put the agarose gel into the gel imager, ATG5 flox / flox Mutated type (MT) is 700bp, and WT is 350bp. CD11c-Cre MT is 313 bp, and WT is no band. Cd209a flox / flox Mutated type (MT) is 427bp, and WT is 325bp.

[0025] Atg5 flox / flox (Strain number: B6.129S-Atg5 <tm1myok>Mouse PCR identification primer sequences: ATG5 exon3-1 GAATATGAAGGCACACCCCTGAAATG (SEQ ID NO: 1) ATG5 check 2 ACAACGTCGAGCACAGCTGCGCAAGG (SEQ ID NO: 2) ATG5 short 2 GTACTGCATAATGGTTTAACTCTTGC (SEQ ID NO: 3) WT: 350bp; Homozygote: 700bp; Cd209a flox / flox Mouse PCR identification primer sequences of C57BL / 6JGp (Strain No.: T019412): T019412-F1 CATCCCAAGCACTGCATAAAACT (SEQ ID NO: 4) T019412-R1 CTGGGCCAAGAAAATATAGTCACTG (SEQ ID NO: 5) WT: 325bp; Targeted: 427bp; CD11c-Cre Mouse PCR identification primer sequences of (Strain No.: B6.Cg-Tg(Itgax-cre)1-1Reiz / J): CD11c-F ACTTGGCAGCTGTCTCCAAG (SEQ ID NO: 6) CD11c-R GCGAACATCTTCAGGTTCTG (SEQ ID NO: 7) TG: 313bp.

[0026] (III) Flow verification of DC-bar knock-out DC-SIGN efficiency Take the mouse spleen, prepare the lymphocyte suspension. Take 2x10 6 The lymphocytes were added into 1.5 mL centrifuge tubes, and washed with flow buffer (PBS + 1% BSA). 100 μL of flow buffer was added to each tube sample for resuspension, and 2 μL of anti-CD16 / CD32 blocking solution was added, and incubated at 4°C for 10 min. After incubation, the flow buffer was washed. 100 μL of flow buffer was used for resuspension, 1 μL of PE-anti-mouse-CD209a, FITC-anti-mouse MHCII, APC-anti-mouse CD11c and corresponding isotype control antibodies, and 0.4 μL of LIVE / DEAD™ were added, and incubated at 4°C in the dark for 40-50 min. After incubation, the flow buffer was washed. 250 μL of flow buffer was used for resuspension, mixed by blowing, transferred to flow sample tubes, and detected on a flow cytometer.

[0027] Example 2 (I) Establishment of a Plasmodium infection model Plasmodium: Plasmodium yoelii (17XNL) Plasmodium yoelii , P.y 17XNL ), which was provided by the long-term routine passage of the laboratory.

[0028] Plasmodium infection: 1 x 10 4 per 200 μL was injected intraperitoneally into mice. Tail blood was taken from the mice for blood smears, and parasitemia was observed every other day.

[0029] (II) Detection of CD4 + T cell function The spleens of infected and uninfected mice were taken, and lymphocyte suspensions were prepared. 2 x 10 6 Leukocyte Activation Cocktail, 37°C incubator for 4 hours. After incubation, collect cells into 1.5 mL centrifuge tube, centrifuge to remove supernatant. Add 100 μL flow buffer for resuspension, add 2 μL anti-CD16 / CD32 blocking solution, 4°C incubate for 10 min. After incubation, wash with flow buffer. Resuspend with 100 μL flow buffer, add 1 μL PE / Cyanine7-anti-mouse CD4, PerCP / Cy5.5-anti-mouse CD11a, FITC-anti-mouse CD49d, APC-anti-mouse CD8a and corresponding isotype antibody, 0.4 μL LIVE / DEAD™, 4°C incubate in dark for 40-50 min. After incubation, wash with flow buffer, add 250 μL Cytofix / Cytoperm fixation and permeabilization solution to each tube, mix well, 4°C incubate in dark for 20-30 min. After incubation, wash with 1 x Perm / Wash Buffer prepared in advance and resuspend with 100 μL, add 1 μL PE anti-mouse IFN-γ and isotype antibody, 4°C incubate in dark for 40 min. After incubation, wash with flow buffer. Resuspend with 250 μL flow buffer, mix well by blowing, transfer to flow sample tube, and detect on flow cytometer.

[0030] Example 3 (I) In vitro co-culture of DC cells and pRBCs Select mice with parasitemia of about 40% for heart blood collection, add heparin for anticoagulation, centrifuge to remove supernatant. Resuspend the red blood cell pellet with 1 mL PBS, then slowly add to 5 mL 72% Percoll gradient centrifugation solution prepared in advance, centrifuge at room temperature at 1600 rpm for 20 min. Take the middle layer of the separation solution, which is pRBCs, wash the residual percoll centrifugation solution with 6-8 mL PBS. Resuspend the cell pellet with 1 mL PBS, add 1 μL CFSE fluorescent dye, incubate at room temperature for 5 min, add 1 mL complete medium to terminate labeling. Use the American Tianyan MACS CD11c MicroBeads mouse Kit to sort DC. Take 1 x 10 8 cells, add 400ul buffer and 100ul Biotin-Antibody Cocktail, incubate at 4℃ for 5 minutes. Directly add 300ul buffer and 200ul Anti-Biotin MicroBeads, incubate at 4℃ for 10 minutes. After incubation, add 8mL buffer for washing. Add 1000ul buffer for resuspension. Place the magnetic head and sorting column (LS column) correctly, add 3mL buffer for column moistening. After the liquid flows out, add the cell suspension, and after the cell suspension flows out, add 3mL Buffer to rinse the column, and collect 4ml of the outflowing liquid, which is the CD4

[0031] (ii) DC and CD4 + T cell co-culture: According to the above method, pRBCs and spleen DC cells were isolated and resuspended in 1ml complete medium. The separated DC and pRBCs were mixed at a ratio of 1:10 and added to a 96-well round-bottom culture dish, and incubated at 37℃ for 1h. During incubation, CD4 + T cells were sorted using the Miltenyi CD4 + T Cell Isolation Kit. Take 1x10 8 lymphocytes, add 400ul buffer and 100ul Biotin-Antibody Cocktail, incubate at 4℃ for 5 minutes. Directly add 300ul buffer and 200ul Anti-Biotin MicroBeads, incubate at 4℃ for 10 minutes. After incubation, add 8mL buffer for washing. Add 1000ul buffer for resuspension. Place the magnetic head and sorting column (LS column) correctly, add 3mL buffer for column moistening. After the liquid flows out, add the cell suspension, and after the cell suspension flows out, add 3mL Buffer to rinse the column, and collect 4ml of the outflowing liquid, which is the CD4 + T cells. After incubation of DCs and pRBCs, excess pRBCs were removed with erythrocyte lysis buffer, and DCs were resuspended in 1 ml of complete culture medium. Then, DCs were incubated with CD4+. + T cells were mixed at a 1:10 ratio and added to 96-well round-bottom culture dishes, and co-cultured at 37°C for 48 hours. Four hours before the end of the culture, 2 μL of Leukocyte Activation Cocktail was added, and the mixture was incubated at 37°C for 4 hours. After the culture was complete, cells were collected and CD4 counts were performed as described previously. + T secretion of IFN-γ.

[0032] (III) Results Analysis (1) Construction Atg5 f / f Cd209a f / f CD11c Cre + mice Figure 1 for Atg5 f / f Cd209a f / f CD11c Cre + Genotyping of mice to verify DC-SIGN knockout efficiency, A is CD11c Cre + mice, ATG5 flox / flox as well as Cd209a flox / flox PCR electrophoresis results of mouse genotypes, B is the flow cytometry gating flowchart for DC detection, and C is the flow cytometry detection... Atg5 f / f Cd209a f / f CD11c Cre + and Atg5 f / f CD11c Cre + Peak diagram of DC-SIGN expression in mouse DCs and statistical graph of average fluorescence intensity. The results showed that... Atg5 f / f Cd209a f / f CD11c Cre + The mouse genotype is Atg5 flox / flox , Cd209a flox / flox as well as CD11c Cre + Simultaneously, flow cytometry was used to detect the expression level of DC-SIGN in DCs. Atg5 f / f Cd209a f / f CD11c Cre + Mice were comparable to the isotype control, while Atg5 f / f CD11c Cre + DCs from mice (DC-SIGN non-knockout) expressing DC-SIGN were significantly higher than isotype control and knockout mice, indicating that the DC conditional knockout ATG5 and DC-SIGN double molecule has been successfully constructed Atg5 f / f Cd209a f / f CD11c Cre + ) mice.

[0033] (2) DC cell deletion of DC-SIGN significantly inhibits host anti-red blood cell stage Plasmodium infection Figure 2 To explore the role of DC cell DC-SIGN in host anti-red blood cell stage Plasmodium infection, A is infected with Plasmodium yoelli P.y 17XNL Atg5 f / f CD11c Cre + , Atg5 f / f Cd209a f / f CD11c Cre + and Atg5 f / f CD11c Cre - The graph of the change of parasitemia in mice, B flow cytometry detection of spleen Plasmodium-specific CD4 + T (CD4 + CD11a hi CD49d hi IFN-γ + ) cells in mice, C is the 14th day after infection with Plasmodium yoelli P.y 17XNL Atg5 f / f CD11c Cre + , Atg5 f / f Cd209a f / f CD11c Cre + Mice and Atg5 f / f CD11c Cre - spleen Plasmodium-specific CD4 + ​​T (CD4 + CD11a hi CD49d hi IFN-γ + Percentage of IFN-γ secreting T cells, D is malaria-specific CD4 + T cells secreting IFN-γ, E is the average fluorescence intensity of malaria-specific CD4 + T cells secreting IFN-γ. It was found that, Atg5 f / f CD11c Cre + The parasitemia of the mice was significantly lower than that of the control group, while Atg5 f / f Cd209a f / f CD11c Cre + The parasitemia of the mice was much higher than Atg5 f / f CD11c Cre + Mice (as shown in Figure A). At the same time, 14 days after infection Figure 2 Atg5 f / f Cd209a f / f CD11c Cre + The percentage, number and ability of IFN-γ secretion of malaria-specific CD4 + T cells of the mice were significantly reduced to the level of the control mice (as shown in Figures C, D and E), indicating that the DCs lacking ATG5 enhance CD4+ T cell responses and inhibit the growth of malaria in the host by up-regulating DC-SIGN. Figure 2

[0034] (3) Promoting DC-SIGN-mediated phagocytosis and antigen presentation can enhance the activation of malaria-specific CD4 + T cells To further explore the specific mechanism of DC-SIGN enhancing malaria-specific CD4 + T cell responses. DC-SIGN in mice is a type II transmembrane C-type lectin, which is an important phagocytic receptor on the surface of DCs. Therefore, the present application promotes DC-SIGN-mediated phagocytosis and antigen presentation by Atg5 f / f CD11c Cre + , Atg5 f / f Cd209a f / f CD11c Cre + and Atg5 ​​ f / f CD11c Cre - Splenic DCs and CFSE-labeled pRBCs in mice infected on days 0, 3, and 6; DCs and CD4+ + T cells were co-cultured in vitro, and the percentage of pRBCs phagocytosed by dendritic cells (DCs) and CD4 count were detected by flow cytometry. + The percentage of IFN-γ secreted by T cells and the concentration of IFN-γ in the culture supernatant were measured. The results showed that, compared to control mice, Atg5 f / f CD11c Cre + The proportion of pRBCs phagocytosed by DCs in mice was higher, while Atg5 f / f Cd209a f / f CD11c Cre + The percentage of red blood cells phagocytosed by DCs in mice was significantly reduced (e.g. Figure 3 (As shown in Figures A and B); Meanwhile, compared to the control group, CD4... + T cells and Atg5 f / f CD11c Cre + After co-culturing mouse DC cells, CD4 + The frequency of IFN-γ secretion by T cells and the level of IFN-γ in the culture medium were significantly increased, while... Atg5 f / f Cd209a f / f CD11c Cre + After incubation with DCs in mice, the frequency of IFN-γ secretion and the level of IFN-γ in the culture medium were significantly reduced (e.g., Figure 3 (As shown in C and D). In summary, ATG5-deficient DCs promote Plasmodium-specific CD4 upregulation by upregulating DC-SIGN-mediated phagocytosis and antigen presentation. + T cell response.

[0035] The above results indicate that the absence of ATG5 in DC cells can promote malaria parasite-specific CD4 expression by upregulating phagocytosis and antigen presentation mediated by the phagocytic receptor DC-SIGN. + T cell activation, thereby controlling the infection of malaria parasites in the host.

[0036] In summary, this invention, using a mouse malaria infection model as a platform, provides a method to promote enhanced CD4 expression of DC-SIGN in dendritic cells. + The role of T-cell responses in immunotherapy for malaria. Knocking out ATG5 in dendritic cells (DCs) upregulates DC-SIGN-dependent phagocytosis and antigen presentation, and enhances Plasmodium-specific CD4+. + T cell response, and then control the infection of malaria parasites in the host. It provides a potential therapeutic target for the immunotherapy of malaria, and is expected to promote the research and development of new anti-malaria drugs or treatment methods.

[0037] Finally, it should be pointed out that the above examples are only used to illustrate the technical solutions of the present application and are not limiting. Although the present application has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technical solutions of the present application can be modified or replaced by equivalents without departing from the purpose and scope of the technical solutions, and they should be covered in the scope of the claims of the present application.

Claims

1. A method for preparing an ATG5 and DC-SIGN double-molecule conditional knockout mouse model, characterized in that: S1 : construction Atg5 f / f CD11c Cre + mice and Cd209a flox / flox mice; S2: Using Cre-loxP recombinase system, first target loxP (locus of X (cross) -over in P1) sequence into exon4-exon6 site of the gene, then use tissue-specific recombinase Cre (cyclization recombinase) to recognize and remove the sequence. Select adult Cd209a Atg5 f / f CD11c Cre + mice and Cd209a flox / flox mice for mating, and obtain offspring Atg5 flox / - Cd209a flox / - CD11c Cre + , heterozygous mice), and mate the offspring after adulthood to breed Atg5 f / f Cd209a f / f CD11c Cre + mice;​ S3: To Atg5 f / f Cd209a f / f CD11c Cre + The mice are genotyped to obtain the ATG5 and DC-SIGN double molecular conditional knockout mouse model.

2. The method for preparing the ATG5 and DC-SIGN bimolecular conditional knockout mouse model according to claim 1, characterized in that: The Atg5 flox / flox The primer sequences for mouse PCR identification are shown in SEQ ID NO: 1- SEQ ID NO:

3. The Cd209a flox / flox The PCR identification primer sequences for C57BL / 6JGp mice are shown in SEQ ID NO: 4 and SEQ ID NO: 5: The CD11c Cre Mouse PCR identification primer sequences are shown in SEQ ID NO: 6 and SEQ ID NO:

7.

3. Application of the ATG5 and DC-SIGN double-molecule conditional knockout mouse model in a Plasmodium infection model.

4. The application according to claim 3, characterized in that: By intraperitoneal injection of Plasmodium yoelii P.y 17XNL Infection of ATG5 and DC-SIGN double molecule conditional knockout mice.

5. Use according to claim 4, characterized in that: The injection of plasmodium yoelii P.y 17XNL The number of 1 x 10 4 Individuals.

6. Application of the ATG5 and DC-SIGN double-molecule conditional knockout mouse model in research on the mechanism of malaria immunotherapy.

7. The application according to claim 6, characterized in that: (a) establishing a Plasmodium infection model by intraperitoneal injection of Plasmodium yoelii P.y 17XNL into the mice; (b) detecting the level of malaria parasite proliferation and CD4 + T cell response in the mouse; (c) based on the results of the detection, assessing the effect of promoting DC-SIGN expression on enhancing CD4 + T cell responses and inhibiting Plasmodium infection for guiding the development of malaria immunotherapy strategies.

8. Application of the ATG5 and DC-SIGN double-molecule conditional knockout mouse model in screening of anti-malaria treatment targets.

Images