Primer and probe for detecting bordetella pertussis through RPA-lateral flow immunochromatography and application
By designing specific primers and probes targeting the IS1663 family transposase gene of Bordetella pertussis, and combining them with rapid isothermal amplification via RPA and lateral flow immunochromatography, the problems of long detection time, high cost, and low sensitivity in pertussis diagnostic methods have been solved, enabling rapid, low-cost, and multi-scenario applicable early diagnosis.
Patent Information
- Application Number
- CN202511955988.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-23
- Publication Date
- 2026-01-23
AI Technical Summary
Existing diagnostic methods for pertussis suffer from problems such as long testing time, high cost, low sensitivity, and insufficient specificity, making it difficult to meet the rapid testing needs of resource-limited scenarios such as primary healthcare institutions and mobile clinics.
We designed specific primers and probes targeting the IS1663 family transposase genes of Bordetella pertussis, and combined them with RPA rapid isothermal amplification technology and lateral flow immunochromatography to achieve rapid, highly sensitive and highly specific detection.
It enables detection to be completed within 20 minutes at 37℃, with a detection limit as low as 102 copies/μL, making it suitable for early and convenient diagnosis in multiple scenarios. It reduces detection costs and operational barriers, making it suitable for primary healthcare institutions and resource-limited areas.
Smart Images

Figure CN121380392A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of medical testing technology, and in particular to primers, probes and applications for RPA-lateral flow immunochromatographic detection of Bordetella pertussis. Background Technology
[0002] Whooping cough is caused by Bordetella pertussis (Bacillus pertussis) Bordetella pertussis Bordetella pertussis (BP) is an acute respiratory infectious disease caused by bacteria. It is highly contagious, primarily transmitted through droplets, and has a high incidence rate among infants and young children. The disease progresses rapidly, posing a serious threat to human health. The incubation period is 1-2 weeks. In the early stage (catarrhal stage), symptoms are only mild cough. At this time, Bordetella pertussis has multiplied extensively on the tracheal and bronchial mucosa and is expelled with droplets, making this the most infectious stage. One to two weeks later, the disease enters the paroxysmal spasmodic cough stage (spastic cough stage). The toxins released by the bacteria cause cilia dysfunction in the mucosal epithelial cells, preventing the smooth expulsion of large amounts of viscous secretions. This continuous stimulation of mucosal receptors triggers strong spasmodic coughing, often accompanied by a distinctive high-pitched, whooping sound. The resulting mucus plugs can also block small bronchi, leading to severe symptoms such as atelectasis, dyspnea, and cyanosis. Four to six weeks after onset, the disease gradually enters the recovery stage, with the paroxysmal coughing symptoms lessening and the patient approaching full recovery.
[0003] Pertussis not only causes acute and dangerous symptoms such as suffocation and seizures, but also easily leads to a variety of serious complications, including pneumonia, pertussis encephalopathy, cardiovascular disorders, and malnutrition. It poses a significant threat to the lives and health of infants and young children, and is one of the key infectious diseases to be controlled in the global public health field. Timely and accurate early diagnosis is crucial for controlling the spread of pertussis and reducing the incidence of severe cases. However, currently used clinical diagnostic methods for pertussis have significant limitations and are insufficient to meet clinical needs.
[0004] Current mainstream clinical diagnostic methods mainly include bacterial culture and serological screening. Bacterial culture, the traditional "gold standard," requires isolating and culturing patient samples to obtain pure colonies of Bordetella pertussis. However, isolating and culturing this bacterium is difficult and time-consuming, making rapid diagnosis impossible and potentially delaying treatment and prevention. Serological screening assists diagnosis by detecting specific antibodies against Bordetella pertussis in the patient's body, but this method suffers from low sensitivity and insufficient specificity.
[0005] With the development of molecular biology technology, nucleic acid detection methods such as quantitative fluorescence PCR have been gradually applied to the detection of pertussis. Their sensitivity and specificity have been improved compared with traditional methods. However, these methods rely on sophisticated thermal cycling instruments, professional experimental operating environments and technical personnel, resulting in high detection costs. Moreover, the detection process is relatively complex and time-consuming, making it difficult to promote and apply them in resource-limited scenarios such as primary healthcare institutions and mobile clinics, and failing to meet the needs of rapid on-site testing.
[0006] Therefore, the current clinic urgently needs a simple operation, rapid detection, high sensitivity, strong specificity and cost controllable Bordetella pertussis detection technology to realize the early accurate diagnosis of pertussis, provide strong support for timely treatment and transmission prevention of the disease, make up for the shortcomings of the existing detection methods, and meet the detection needs in different medical scenes. SUMMARY
[0007] The technical problem to be solved by the present application is to provide a primer, a probe and an application for RPA-lateral flow immunochromatographic detection of Bordetella pertussis, which designs specific primers and probes for Bordetella pertussis IS110-like element IS1663 family transposase genes, combines the advantages of rapid isothermal amplification technology of RPA (recombinase polymerase amplification) and visual detection of lateral flow immunochromatography, realizes rapid, high sensitivity and high specificity detection of Bordetella pertussis, and is suitable for early and convenient diagnosis in multiple scenes without complex instruments and professional operation.
[0008] The present application solves the above technical problems by adopting the following technical solutions: A primer for RPA-lateral flow immunochromatographic detection of Bordetella pertussis, comprising a specific primer pair designed for Bordetella pertussis IS1663 family transposase genes; the sequence of the specific primer pair is as follows: NAT-F: AACAAACAAACAAACA / iSpC12 / CCTACGGGTCTGTATCACGAGCAAGCGGC; NAT-R: GTGATCGAGAATTAGC / iSpC12 / CGTAGCTGTCGAGCGCATCATTTTTGGAG.
[0009] As one of the preferred modes of the present application, the primer is specifically designed for the conserved region of Bordetella pertussis IS1663 family transposase genes, and the sequence of the conserved region is referenced to GenBank accession number CP046995.1, It has been verified that this region is highly stable in Bordetella pertussis, and the corresponding sequence of homologous bacteria such as parapertussis Bordetella and Bordetella holmesii is significantly different, ensuring the specificity of primer binding.
[0010] As one of the preferred modes of the present application, in the specific primer pair, the 5' end of the forward primer NAT-F contains the NAT sequence "AACAAACAAACAAACA", and the 5' end of the reverse primer NAT-R contains the NAT sequence "GTGATCGAGAATTAGC"; the NAT sequence and the corresponding basic primer sequence are designed with a C12 spacer, i.e. iSpC12, to prevent the primer from forming a dimer.
[0011] A RPA-lateral flow immunochromatographic detection probe for Bordetella pertussis, comprising a gold nanoparticle binding probe, a quality control line capture probe, and a Bordetella pertussis IS1663 capture probe, and the sequences are as follows: Gold nanoparticle binding probe: TGTTTGTTTGTTTGTTTTTTTT-SH; Quality control line capture probe: AACAAACAAACAAACA-Biotin; Bordetella pertussis IS1663 capture probe: GCTAATTCTCGATCACTTTTTT-Biotin.
[0012] As one of the preferred modes of the application, the gold nanoparticle binding probe is modified by thiol and has color developing ability after coupling with gold nanoparticles, specifically binds to the amplification product and flows with the chromatography liquid; the quality control line capture probe is used to capture the gold nanoparticle binding probe that does not bind to the amplification product; and the Bordetella pertussis IS1663 capture probe is a detection line specific probe that specifically binds to the amplification product and makes the detection line develop color.
[0013] The application of the above-mentioned primer and probe in the preparation of a Bordetella pertussis detection product.
[0014] A Bordetella pertussis detection kit, comprising: The above-mentioned primer; The above-mentioned probe; A lateral flow immunochromatographic strip; RPA amplification reagents; An amplification product loading chromatographic strip detection system.
[0015] As one of the preferred modes of the application, the composition of the lateral flow immunochromatographic strip comprises a sample pad, a gold label pad, an NC membrane, a water absorption pad, and a bottom plate; wherein the sample pad is used to load the sample, the gold label pad is used to store the AuNP-RP conjugate, the NC membrane is used to fix the detection line and the quality control line, the water absorption pad is used to collect the aqueous phase and provide driving force for the flow of the reaction solution along the test strip, and the bottom plate is used as a bottom liner to assemble the above-mentioned four modules (sample pad, gold label pad, NC membrane, and water absorption pad).
[0016] A method for RPA-lateral flow immunochromatographic detection of Bordetella pertussis for non-diagnostic purposes, using the above-mentioned kit, and the method is as follows: (1) Using the DNA of the sample to be tested as a template, an RPA amplification system is formed by using the primer and RPA amplification reagents, and RPA amplification is performed; (2) The probe is fixed to the lateral flow immunochromatographic strip; (3) The amplified product is combined with the loading buffer, and whether it is Bordetella pertussis positive is determined by the detection result of the detection system of the chromatographic strip loaded with the amplified product.
[0017] As one of the preferred modes of the application, the RPA amplification system is used for amplifying the IS1663 family transposase gene of Bordetella pertussis, and the specific composition is: 1.0 μL of primer each, 29.4 μL of A buffer, 2.5 μL of B buffer, 5.1 μL of DNA template, and 0.7 μL of ddH2O; and the amplification condition is: 37℃ constant temperature for 20 minutes.
[0018] As one of the preferred modes of the application, the detection system of the amplified product loading chromatographic strip is used for making the detection line and the quality control line of the lateral flow immunochromatographic strip develop color after the RPA amplified product is combined with the loading buffer, and the specific composition is: 1 μL of RPA amplified product and 49 μL of loading buffer.
[0019] As one of the preferred modes of the application, the loading buffer is a PBS solution.
[0020] Compared with the prior art, the application has the following advantages: (1) Precise target design, double protection of specificity and accuracy The primer and the probe of the application are designed for the IS110-like element IS1663 family transposase conserved gene specific to Bordetella pertussis, and the gene sequence has clear differences from homologous bacteria such as Bordetella holmesii and Bordetella parapertussis, so that precise differentiation can be achieved and cross reaction can be avoided; at the same time, the primer innovatively introduces a unique design, the 5' end of the forward primer contains the NAT sequence "AACAAACAAACAAACA", the 5' end of the reverse primer contains the NAT sequence "GTGATCGAGAATTAGC", and the iSpC12 interval is arranged between the NAT sequence and the basic primer, which can effectively prevent the primer from forming a dimer, significantly improve the specificity of the target gene combination, and ensure the accuracy of amplification and detection.
[0021] (2) High detection sensitivity, meeting the needs of early diagnosis The detection limit of the application is as low as 10 2 Copies / μL, which is basically the same as the detection sensitivity of the finished product fluorescent quantitative PCR kit on the market, and can effectively detect low load Bordetella pertussis in the early stage (catarrhal stage), so as to gain key time for early intervention and transmission prevention and control of the disease, and reduce the risk of severe illness and complications.
[0022] (3) Fast detection speed, no need for complex equipment support The fusion RPA isothermal amplification technology and the advantages of the lateral flow immunochromatography, the RPA amplification can be completed in 20 minutes under the constant temperature condition of 37 DEG C, and the subsequent chromatography color detection only needs 5 minutes, the whole detection process takes 20-30 minutes, which is much faster than the traditional bacterial culture (several days) and the conventional PCR detection (1-2 hours) ; without the complex devices such as precise thermal cycler instrument and gel electrophoresis equipment, the detection can be carried out only in a simple constant temperature environment, and the dependence on professional laboratory conditions is completely eliminated, and the scene of on-site rapid screening is adapted.
[0023] (4) simple and intuitive operation, reduces the application threshold The detection process of the application is simplified into three steps of 'nucleic acid extraction, RPA amplification and chromatography color development', without professional molecular biology operation skills, and can be used after simple training, which greatly reduces the labor cost and operation threshold; the results can be directly judged by the color development of the detection line (T line) and the quality control line (C line) of the lateral flow immunochromatography strip, and the positive, negative and invalid results can be directly observed, without relying on instrument data analysis, avoiding human interpretation error, and greatly improving the diagnosis efficiency and convenience.
[0024] (5) controllable detection cost, wide application scenarios The single sample detection cost of the application is only about 20 yuan, without high instrument investment, and the price is lower than that of similar detection products in the market, which greatly reduces the medical detection burden; compatible with various sample types such as body fluid samples and bacterial cultures, the application can be widely used in primary medical institutions, mobile clinics, family medical care and other scenarios, especially in remote areas with limited resources, which effectively improves the medical diagnosis level in these areas. BRIEF DESCRIPTION OF DRAWINGS
[0025] Figure 1 is the agarose gel electrophoresis verification of the RPA amplification product in example 1 (in the figure, M is 500bp DNA Marker, and lanes 1-5 are the technical repeated amplification results using the primer of the application) ; Figure 2 is the technical principle diagram of RPA-lateral flow immunochromatography detection of Bordetella pertussis in experimental example 1; Figure 3 is the lateral flow nucleic acid chromatography strip result of different Bordetella pertussis nucleic acid positive patients in the verification example.
[0026] Figure 4 is the lateral flow immunochromatography strip result of sensitivity detection in experimental example 2 (in the figure, 10 6 , 10 5 , 10 4 , 10 3 , 10 2 , 10 respectively represent the standard DNA concentration of Bordetella pertussis, Copies / μL, and NC represents negative control) ; Figure 5 Results of the lateral flow immunochromatographic strip specifically detected in Example 3 (in the figure, 1 is a Bordetella pertussis positive control: T line and C line double color development; 2-14 are results of other common respiratory pathogens: only C line color development). DETAILED DESCRIPTION
[0027] The following examples of the present application are described in detail, which are implemented on the premise of the technical solutions of the present application, and detailed implementation and specific operation processes are given, but the protection scope of the present application is not limited to the following examples. At the same time, the reagents and experimental methods used in the following examples and experimental examples are conventional reagents or methods in the art, which are not described in detail.
[0028] The primer and probe sequences involved in the following examples and experimental examples are shown in Table 1.
[0029] Table 1, primer and probe sequences
[0030] Example 1 The primer of the RPA-lateral flow immunochromatographic detection of Bordetella pertussis in this example includes a specific primer pair designed for the conserved gene of Bordetella pertussis IS1663 family transposase; The specific primer pair is designed for the conserved region of Bordetella pertussis IS1663 family transposase gene, including a forward primer NAT-F and a reverse primer NAT-R, and the sequences are shown in Table 1.
[0031] Example 2 The probe of the RPA-lateral flow immunochromatographic detection of Bordetella pertussis in this example includes a gold nanoparticle binding probe (RP), a quality control line capture probe (CCP), and a Bordetella pertussis IS1663 capture probe (CP), and the sequences are shown in Table 1.
[0032] Among them, the gold nanoparticle binding probe is modified by thiol and coupled with gold nanoparticles to have color development ability, specifically binds with the amplification product, and flows with the chromatography liquid; the quality control line capture probe is used to capture the gold nanoparticle binding probe that does not bind with the amplification product; the Bordetella pertussis IS1663 capture probe is a detection line specific probe that specifically binds with the amplification product and makes the detection line color development.
[0033] Example 3 The Bordetella pertussis detection kit in this example is based on the RPA-lateral flow immunochromatographic technology, which includes the following components: primer (Example 1), probe (Example 2), lateral flow immunochromatographic strip, RPA amplification reagent, and detection system for loading the amplification product into the chromatographic strip.
[0034] In this embodiment, the composition of the lateral flow immunochromatographic strip includes a sample pad, a gold label pad, an NC membrane, a water absorption pad, and a bottom plate. Among them, the sample pad is used to load the sample, the gold label pad is used to store the AuNP-RP conjugate, the NC membrane is used to fix the detection line and the quality control line, the water absorption pad is used to collect the aqueous phase and provide driving force for the flow of the reaction solution along the test strip; the bottom plate serves as a bottom liner for assembling the above four modules (sample pad, gold label pad, NC membrane, and water absorption pad).
[0035] The primer and the RPA amplification reagent constitute an RPA amplification system for amplifying the conserved gene of the IS1663 family transposase gene of Bordetella pertussis, and the system is composed of each primer, A buffer, B buffer, DNA template, and ddH2O. The A buffer and the B buffer are both from Amply Future Company, RNA constant-temperature rapid amplification kit (basic type).
[0036] The probe is fixed to the lateral flow immunochromatographic strip and then hybridizes with the amplification product.
[0037] The detection system of the amplification product loaded on the chromatographic strip is used for color development after the RPA amplification product hybridizes with the probe on the lateral flow immunochromatographic strip, and the system is composed of the RPA amplification product and the loading buffer (PBS solution).
[0038] Embodiment 4 The method for detecting Bordetella pertussis by RPA-lateral flow immunochromatography for non-diagnostic purposes in this embodiment uses the kit of the above-mentioned embodiment 3, and the method is as follows: I. Design and screening of primers and probes All genome sequences of Bordetella pertussis were downloaded from Genebank, and the difference regions of various pathogen genomes were found through multiple alignment. The stable conserved region of the published Bordetella pertussis genome sequence was used as the target sequence for detection, and multiple sets of specific detection primers and probes were designed and synthesized according to the target sequence. The genome DNA of positive and negative controls of Bordetella pertussis samples was detected by using the designed multiple sets of primers and probes, and through repeated experiments, the primer and probe combination with the best sensitivity, specificity, and repeatability was screened out.
[0039] Finally, the conserved region of the IS1663 family transposase gene of Bordetella pertussis (the sequence of the conserved region is referred to as GenBank accession number CP046995.1) was used as the target sequence for detection to design and synthesize specific detection primers (embodiment 1) and probes (embodiment 2), which were entrusted to Shanghai Biosune Biotech Co., Ltd. for synthesis.
[0040] II. Nucleic acid extraction Nucleic acid extraction was performed on nasopharyngeal swab samples suspected of pertussis infection using a commercial fluorescent PCR kit (Eflgen, Shenzhen, China) according to the manufacturer's instructions. Specifically, 1 mL of sterile 0.9% (w / v) sodium chloride solution was added to the test tube containing the swab. The test tube was vigorously vortexed to elute the microbial material, and the swab head was pressed against the test tube wall before discarding the swab. The entire eluate was transferred to a 1.5 mL microcentrifuge tube and centrifuged at 12000 x g for 5 minutes. The supernatant was carefully aspirated, leaving about 10 μL of residual liquid with the precipitate. Then 51 μL of DNA extraction solution provided by the kit was added. After thorough vortex mixing, heating at 100°C for 10 minutes, cooling to room temperature, and centrifugation at 12000 x g for 5 minutes, the resulting supernatant was collected as the template DNA.
[0041] III. RPA amplification An RPA amplification system was composed of primers and RPA amplification reagents using the sample DNA to be tested as a template, and RPA amplification was performed. RPA amplification system: 1.0 μL of primer each, 29.4 μL of A buffer, 2.5 μL of B buffer, 5.1 μL of DNA template, and 0.7 μL of ddH2O; amplification conditions: 37°C constant temperature for 20 minutes.
[0042] The obtained product was characterized by 3.5% agarose gel electrophoresis.
[0043] IV. Preparation of loading buffer The loading buffer was prepared using a PBS solution.
[0044] V. Preparation of lateral flow immunochromatographic strips 1. Preparation of gold nanoparticles (AuNPs): Take a 250 mL conical flask, soak it in freshly prepared aqua regia, and then clean it with ultrapure water. Dry and reserve for use. Add 120 mL of chloroauric acid solution (0.01%, w / v) to the treated conical flask and heat to boiling. Under vigorous stirring, quickly add 1.5 mL of trisodium citrate solution (1%, w / v). Continue to heat and stir until the solution color stabilizes, then continue heating for 15 min. After cooling at room temperature, supplement with ultrapure water to 100 mL and store at 4°C. 2. Preparation of gold-probe conjugate (AuNP-RP): Concentration of AuNPs: Add 1 mL of AuNPs solution to a 1.5 mL clean centrifuge tube, centrifuge at 8000 r / min for 15 min, remove the supernatant, and resuspend the precipitate with 100 μL of ultrapure water. Probe activation: 50 μΐ of thiol-modified recognition probe (RP probe, 10 μιηοΙ / L), 5 μΐ of acetic acid buffer (0.5 mol / L, pH 5.2) and 10 μΐ of TCEP solution (1 mmol / L) were added into a clean glass bottle, and incubated at room temperature for 1 h in the dark. Probe coupling: 500 μΐ of concentrated AuNPs were added into the above glass bottle, and reacted at room temperature for 6 h or overnight. System stabilization: 25 μΐ of Tween-20 (1%, v / v) was added, and incubated at room temperature for 10 min. Salt aging: 2 mol / L NaCl was added in three times with 1 h interval, so that the final concentration of NaCl in the system reached 0.3 mol / L, and the reaction was continued at room temperature for 12 h. Washing and resuspension: centrifugation was performed at 8000 r / min for 15 min, the supernatant was removed, and the precipitate was washed with Tris-HCl buffer (10 mmol / L, pH 7.4) for three times. The precipitate was resuspended with 500 μΐ of resuspension solution (1 mmol / L Tris-HCl, 5% BSA, 0.25% Tween-20, and 10% sucrose, pH 8.0).
[0045] 3. The size of the lateral flow immunochromatographic strip (LFS) was 3 mm x 60 mm, which was composed of five modules, and the preparation method was as follows: The sample pad (purchased from Shanghai Jieyi Biological Technology Co., Ltd.) was used for loading the sample. In order to improve the water absorption and surface activity of the sample pad, and avoid the influence of complex matrix on the detection result, the sample pad was soaked in sample pad treatment solution (0.05 mol / L Tris-HCl, 0.15 mol / L NaCl, 0.25% triton-100, pH 8.0) for 2 h after cutting, and was dried at 30°C for standby. The gold label pad (purchased from Shanghai Jet Ning Biological Technology Co., Ltd.) was used for storing AuNP-RP conjugate. In order to improve the carrying capacity of the gold label pad and ensure the dispersibility of the AuNP-RP conjugate, the gold label pad was soaked in gold label pad treatment solution (10 mmol / L PB, 5% sucrose, 1% trehalose, 0.3% Tween-20, 0.25% PEG 20000, pH 7.4) for 2 h after cutting, and was dried at 30°C. Then 6 μΐ of AuNP-RP conjugate was added dropwise on the dried gold label pad, and was dried at 30°C for standby. The NC membrane (purchased from Sartorius) is used to fix the detection (T) line and the quality control (C) line. Among them, the biotinylated capture probe (CP probe) is fixed on the T line of the test strip. The biotinylated control probe (CCP probe) is fixed on the C line. In addition, before spraying the membrane, all biotinylated capture probes need to be pre-bound with streptavidin, specifically: add 2.5 μL of biotinylated capture probe (100 μmol / L), 2.5 μL of streptavidin (5 mg / mL) and 15 μL of 1xPBS in a PCR tube, incubate at room temperature for 1 h. Set the spraying speed of the membrane sprayer to 0.5 μL / cm, after spraying the membrane, dry the NC membrane in a 30°C oven and store it. The water absorption pad (purchased from Shanghai Jey Biological Technology Co., Ltd.) is used to collect the aqueous phase and provide driving force for the flow of the reaction solution along the test strip. The bottom plate (purchased from Shanghai Jey Biological Technology Co., Ltd.) is used as a bottom liner to assemble the aforementioned four modules, with adjacent modules overlapping by 2 mm (the sample pad overlaps the gold pad by 2 mm, the gold pad overlaps the NC membrane by 2 mm, and the NC membrane overlaps the water absorption pad by 2 mm), ensuring smooth flow of the liquid. Six, hybridization of amplification products and capture probes on lateral flow immunochromatography strip, color development Mix 1 μL of amplification product with 49 μL of PBS to make a uniform mixture, then add the above mixture to the sample pad of the prepared lateral flow immunochromatography strip, and observe the color development of the test strip after 5 min of reaction. The result can be judged by naked eye.
[0046] Example 5 The method of this example for non-diagnostic purposes to detect Bordetella pertussis by RPA-lateral flow immunochromatography is basically the same as that of Example 4, the main difference being that in the nucleic acid extraction, the sample to be tested is a bacterial culture. Specifically, the microbial lysis solution direct PCR kit (Bao Biological Engineering (Beijing) Co., Ltd., China) is used to extract nucleic acid from the bacterial culture, as follows: Take the cultured colonies, use a sterile cotton swab to pick up a single colony, and transfer it to a centrifuge tube containing 50 μL of microbial lysis solution; vortex for 1 min to fully resuspend the colony in the lysis solution; incubate the centrifuge tube in a 80°C constant temperature environment for 15 min to achieve bacterial cell wall lysis and nucleic acid release; centrifuge at 2000 x g for 30 s to precipitate the lysis residue; collect the supernatant as the template DNA.
[0047] Experimental Example 1 This experimental example is used to verify the feasibility of the above method, and to realize nucleic acid extraction, RPA amplification, lateral flow immunochromatography strip detection, color development combined with clinical sample detection, including the following specific steps: I. Design and selection of primers and probes The same as in Example 4.
[0048] Nucleic acid from positive samples of Bordetella pertussis was amplified using the primers selected in the final screening (Example 1) via RPA amplification, and then verified by 3.5% agarose gel electrophoresis. The results are as follows. Figure 1 As shown, each lane exhibited clear, single amplified bands with a length that perfectly matched the target fragment (approximately 140 bp), and no primer dimers or non-specific bands interfered. This result demonstrates that the primers designed in this invention can stably and specifically amplify the target sequence in multiple independent amplification experiments, fully verifying the amplification stability and specificity of the primers.
[0049] I. Nucleic Acid Extraction Following the method described in Example 4, nucleic acid samples were extracted from different Bordetella pertussis-positive patients as template DNA for subsequent testing. All known positive nucleic acid samples used were obtained from the Clinical Molecular Biology Laboratory of the First Affiliated Hospital of Anhui Medical University (Hefei, China).
[0050] III. RPA Amplification Same as Example 4, the amplification system and conditions are the same.
[0051] IV. Preparation of Sample Loading Buffer Same as Example 4.
[0052] V. Preparation of Lateral Flow Immunochromatographic Strips Same as Example 4.
[0053] VI. The amplified products are hybridized with the capture probes on the lateral flow immunochromatographic strips, and then subjected to color development. Same as Example 4.
[0054] The technical principle of the RPA-lateral flow immunochromatographic assay of this invention is as follows: Figure 2 As shown, the core process consists of two steps: First, using the DNA of the sample to be tested as a template, specific primer pairs containing the NAT sequence and the C12 spacer region are used to amplify the conserved region of the Bordetella pertussis IS1663 family transposase gene at a constant temperature of 37℃, ensuring the specificity and efficiency of the amplification. Then, the amplification product is mixed with the loading buffer and added to the lateral flow immunochromatographic strip. The amplification product of the positive sample will bind to the gold nanoparticle-recognition probe (RP) conjugate on the gold label pad. When it flows to the detection line (T line), it binds to the Bordetella pertussis IS1663 capture probe (CP), causing the T line to color. The unbound conjugate binds to the control line (C line) and the control line capture probe (CCP), causing the C line to color. The negative sample only shows the C line color because there is no target sequence amplification. The combination of T and C line color development can achieve rapid and visual detection of Bordetella pertussis.
[0055] In this experimental case, the final lateral flow immunochromatographic strip results of different Bordetella pertussis-positive patients are as follows: Figure 3As shown in Table 1 and Figure 3 As a result, it can be determined that the patient is a positive patient of Bordetella pertussis.
[0056] Experimental Example 2 This experimental example is used to verify the detection sensitivity of the detection method of the application, and the steps are as follows: I. Preparation of target DNA Take the standard DNA solution of Bordetella pertussis, measure the concentration by a nucleic acid quantifier, and then perform gradient dilution with sterile ddH2O to prepare a series of standard samples with concentrations of 10 6 , 10 5 , 10 4 , 10 3 , 10 2 , 10 copies / μL, respectively.
[0057] II. RPA amplification Take each concentration standard sample as a template, perform amplification according to the RPA amplification system and conditions of Example 4 (37°C constant temperature amplification for 20 minutes), set three repeated holes for each concentration, and set sterile ddH2O as a negative control (NC).
[0058] III. Side-flow immunochromatographic detection After amplification, mix the amplification product with the sample buffer according to the method of Example 4, add it to the side-flow immunochromatographic strip, and observe the color development result after 5 minutes of room temperature reaction.
[0059] IV. Result determination Take "color development of both the detection line (T line) and the quality control line (C line)" as the positive determination standard, and record the lowest positive detection concentration. The results are shown in Table 2. Figure 4
[0060] The results show that the lowest detection limit of the detection method of the application for Bordetella pertussis standard DNA is 10 2 copies / μL, indicating that the sensitivity of the method meets the early low-load sample detection requirements of the clinic.
[0061] Experimental Example 3 This experimental example is used to verify the detection specificity of the detection method of the application, and the steps are as follows: I. Preparation of test samples Select the positive nucleic acid sample of the common respiratory pathogen (influenza A virus, influenza B virus, respiratory syncytial virus, Haemophilus influenzae, Mycoplasma pneumoniae, Streptococcus pneumoniae, Staphylococcus aureus) and homologous bacteria (parapertussis and Bordetella holmesii), and set the positive sample of pertussis Bordetella as a positive control, and sterile ddH2O as a negative control. All samples are from the clinical molecular biology laboratory of the First Affiliated Hospital of Anhui Medical University (Hefei, China) and are directly used for subsequent detection.
[0062] II. RPA amplification According to the RPA amplification system and conditions of Example 4, each test sample is used as a template for amplification.
[0063] III. Lateral flow immunochromatographic detection After amplification, chromatographic color detection is performed according to the method of Example 4, and the color development of the T line and C line of each sample is observed.
[0064] IV. Result determination The results are shown in Table 1. Figure 5 As shown in Table 1, only the detection line (T line) and the quality control line (C line) of the positive control of pertussis Bordetella are colored, and the rest of the test samples and the negative control only the quality control line (C line) is colored, and the detection line (T line) is not colored.
[0065] The results show that the detection method of the present application is only specific to pertussis Bordetella, and has no cross reaction with other respiratory pathogens and homologous bacteria, and has good specificity.
[0066] In summary, the present application uses RPA-lateral flow immunochromatographic strip technology to rapidly detect pertussis Bordetella, has high sensitivity and specificity, and the detection limit is as low as 10 2 Copies / μL, which is basically the same as the market product fluorescent quantitative PCR kit, greatly meets the clinical demand; at the same time, the entire detection process of the present application only needs 20~30min, and does not need large and complex instruments, has low cost, and can realize rapid bedside detection in multiple scenes. In addition, the integrated technology of the present application can realize early detection of pathogenic bacteria, which is crucial for clinical situations that need to respond quickly; and the technology is easy to operate, even a person with minimum training can perform instant detection, which increases its applicability in different medical environments; RPA-lateral flow immunochromatographic strip technology does not require a large amount of reagents and materials, and can realize mass production; in addition, the technology does not require special instruments and training, which makes it economically feasible and can be quickly expanded to large-scale applications, even in remote areas with limited resources.
[0067] The above merely describes preferred embodiments of the present application, and is not used to limit the present application, any modification, equivalent replacement and improvement within the spirit and principle of the present application should be included in the protection scope of the present application.
Claims
1. A primer for RPA-lateral flow immunochromatographic detection of Bordetella pertussis, characterized in that, This includes specific primer pairs designed for the IS1663 family transposase genes of Bordetella pertussis; the sequences of the specific primer pairs are as follows: NAT-F:AACAAACAAACAAACA / iSpC12 / CCTACGGGTCTGTATCACGAGCAAGCGGC; NAT-R: GTGATCGAGAATTAGC / iSpC12 / CGTAGCTGTCGAGCGCATCATTTTTGGAG.
2. The primer according to claim 1, characterized in that, In the specific primer pair, the 5' end of the forward primer NAT-F contains the NAT sequence "AACAAACAAACAAACA", and the 5' end of the reverse primer NAT-R contains the NAT sequence "GTGATCGAGAATTAGC". A C12 spacer region, i.e., iSpC12, is designed between the NAT sequence and its corresponding base primer sequence to prevent the primers from forming dimers.
3. A probe for RPA-lateral flow immunochromatographic detection of Bordetella pertussis, characterized in that, The probes include gold nanoparticle binding probes, control line capture probes, and Bordetella pertussis IS1663 capture probes, with the following sequences: Gold nanoparticles bound to probe: TGTTTGTTTGTTTGTTTTTTTT-SH; Quality control line capture probe: AACAAACAAACAAACA-Biotin; Bordetella pertussis IS1663 capture probe: GCTAATTCTCGATCACTTTTTT-Biotin.
4. The probe according to claim 3, characterized in that, The gold nanoparticle-binding probe is modified with thiol groups, and after coupling with the gold nanoparticles, it has color development ability, specifically binds to the amplification product, and flows with the chromatography solvent; the quality control line capture probe is used to capture gold nanoparticle-binding probes that have not bound to the amplification product; the Bordetella pertussis IS1663 capture probe is a detection line-specific probe that binds complementaryly to the amplification product and makes the detection line color.
5. The use of a primer as described in any one of claims 1 to 2, or a probe as described in any one of claims 3 to 4, in the preparation of a Bordetella pertussis detection product.
6. A kit for detecting Bordetella pertussis, characterized in that, Include: The primers as described in any one of claims 1 to 2; The probe according to any one of claims 3 to 4; Lateral flow immunochromatographic strips; RPA amplification reagents; Detection system for amplified product loading chromatography strips.
7. A method for non-diagnostic RPA-lateral flow immunochromatographic detection of Bordetella pertussis, characterized in that, Using the kit described in claim 6, the method is as follows: (1) Using the DNA of the sample to be tested as a template, the primers and RPA amplification reagents are used to form an RPA amplification system for RPA amplification; (2) Fix the probe onto the side-flow immunochromatographic strip; (3) The amplification product is combined with the loading buffer, and the detection results of the detection system of the amplification product loading chromatography strip are used to determine whether it is positive for Bordetella pertussis.
8. The method according to claim 7, characterized in that, The RPA amplification system was used to amplify the transposase gene of Bordetella pertussis IS1663 family. The specific composition was as follows: 1.0 μL of each primer, 29.4 μL of A buffer, 2.5 μL of B buffer, 5.1 μL of DNA template, and 0.7 μL of ddH2O. The amplification conditions were: amplification at 37℃ for 20 minutes.
9. The method according to claim 7, characterized in that, The detection system of the amplification product loading chromatography strip is used to make the detection line and control line of the lateral flow immunochromatographic strip colored after the RPA amplification product is combined with the loading buffer. The specific composition is: 1 μL of RPA amplification product and 49 μL of loading buffer.
10. The method according to claim 7, characterized in that, The loading buffer is a PBS solution.