A molecular marker combination for identifying radix isatidis and its application

Abstract

The present application relates to a kind of molecular marker combination of identifying isatis root rape celery and its application, the molecular marker combination is based on the T2T reference genome of newly assembled isatis indigotica Fort and the collinearity analysis of isatis indigotica Fort g chromosome and Brassica napus A, C subgenome development, can cover isatis indigotica Fort g chromosome key region (short arm, long arm and centromere), with strong specificity, comprehensive coverage, simple and fast operation, low cost and other advantages, can quickly and accurately identify the presence or absence of isatis indigotica Fort g chromosome in isatis root rape celery plant and its structural integrity in seedling stage, effectively solve the problems that existing identification method is complex, time efficiency is poor and accuracy is limited, to significantly improve and guarantee the production purity and efficiency of isatis root rape celery, and can be used for the authenticity identification of product, with wide application prospect and popularization value.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of oilseed rape molecular genetics and breeding, and particularly relates to a molecular marker combination for identifying a radix isatidis oilseed rape inflorescence and application thereof. BACKGROUND

[0002] The radix isatidis oilseed rape inflorescence is a Mg Brassica napus-radix isatidis monosomic addition line formed after continuous backcrossing of Brassica napus (2n = 38, AACC) and a somatic hybrid (2n = 52, AACCII) of radix isatidis (i.e., radix isatidis) (Kang Lei, et al. Utilization of Isatis indigotica Fort. to Create Virus-resistant Oilseed Rape and Novel Male Sterile / Restoration System. Chinese Journal of Oil Crop Sciences, 2018, 40(5): 674-678). The radix isatidis oilseed rape inflorescence is gray-green in color, crisp and tender in taste, and rich in various essential amino acids for the human body and has an antiviral effect similar to that of radix isatidis (CN113181229B), and is thus deeply loved by the public and has high market value.

[0003] Since the radix isatidis oilseed rape inflorescence is a Brassica napus-radix isatidis G monosomic addition line with a radix isatidis g chromosome attached to the Brassica napus genome, the chromosome is prone to loss, breakage or translocation during meiosis, resulting in plants with a missing radix isatidis g chromosome in the progeny. To ensure the commodity quality of the radix isatidis oilseed rape inflorescence (which usually requires a radix isatidis g chromosome retention rate of more than 80%), the radix isatidis g chromosome addition status of the radix isatidis oilseed rape inflorescence must be identified, and plants without the chromosome must be removed manually. Existing identification methods mainly rely on a single SSR marker developed in the early stage, but the reliability of a single marker is limited, and cytological identification (such as pollen mother cell chromosome observation) that is time-consuming and cumbersome is often required. In addition, cytological identification is usually performed at the present budding stage, resulting in high application costs. Furthermore, there is a phenomenon of using ordinary Brassica napus to impersonate the radix isatidis oilseed rape inflorescence on the market. Therefore, it is urgent to develop a molecular detection system that is simple to operate, low in cost and can quickly and accurately identify the presence and integrity of the radix isatidis g chromosome at an early growth stage (such as before transplanting), which is of great significance for ensuring the commodity quality of the radix isatidis oilseed rape inflorescence, improving production efficiency, protecting the rights and interests of breeders and maintaining market order. SUMMARY

[0004] The present application provides a molecular marker combination covering the key regions (short arm, long arm and centromere) of g chromosome of Isatis indigotica Fort and its application, aiming at the blank of the prior art. The marker combination is developed based on the newly assembled T2T reference genome of I. indigotica, and can quickly and accurately identify the presence or absence of g chromosome of I. indigotica and its structural integrity in I. indigotica oilseed rape plants at the seedling stage, effectively solving the problems of complex operation, poor timeliness and limited accuracy of existing identification methods, thereby significantly improving and guaranteeing the production purity and efficiency of I. indigotica oilseed rape, and can be used for identifying the authenticity of products.

[0005] The present application is realized by the following technical solutions:

[0006] A molecular marker combination for identifying g chromosome of I. indigotica in I. indigotica oilseed rape, which is developed based on the newly assembled T2T genome of I. indigotica, contains two markers located on the short arm of g chromosome of I. indigotica, four markers on the long arm and one marker on the centromere region, a total of seven molecular markers (named Mg1, Mg2,..., Mg6, Cen6.2 respectively). The molecular marker combination is obtained by the following steps:

[0007] (1) Isatis indigotica T2T genome assembly: Using PacBio HiFi technology for Isatis indigotica genome sequencing, a total of 33.59 Gb (~113.92x) of sequencing data was obtained, and four versions of Contig draft were generated using Hifiasm (0.25.0) (Cheng et al., 2021), Canu (v2.2) (Koren et al., 2017), Verkko (v0.1.13) and LJA (v0.2) four kinds of genome assembly software. After comparison, the hap2 draft assembled by Hifiasm was selected as the skeleton for fine mapping. The genome size of this draft is 290.68 Mb, and the Contig N50 is 33.61 Mb. Using the published Hi-C data of Isatis indigotica genome, 280 Mb of sequence was successfully anchored to 7 chromosomes, and finally a genome draft containing only 8 gaps was obtained. Subsequently, using the method of TGS-GapCloser (Xu et al., 2020) and manual completion, the four versions of Contig draft were compared with the chromosome-level genome, and finally a chromosome-level genome containing only 2 gaps (located at Iin2:10.44 Mb and Iin2:11.28 Mb) was obtained, with a size of 294.82 Mb, Contig N50 of 41.81 Mb, and LAI (Longest Alignment Block Intervals) of 13.33. All centromere regions (2.71-6.83 Mb) and all telomere regions except Iin2 were assembled. Among them, the g chromosome of Isatis indigotica corresponds to the chromosome Iin2 in the assembly.

[0008] (2) Molecular marker design site screening: The assembled g chromosome (Iin2) of Isatis indigotica and the A and C subgenomes of Brassica napus reference genome (zs11l.v0) were subjected to collinearity analysis, respectively. In the gene regions of the short arm and long arm of the g chromosome, sites with stable insertion / deletion (InDel) polymorphism between I. indigotica and B. napus were screened. Finally, Iin2: 4173133 - 4174847 and Iin2: 8577487 - 8579584 regions located in the short arm, and Iin2: 22578121 - 22579540, Iin2: 26683083 - 26685147, Iin2: 31675141 - 31676805 and Iin2: 38304318 - 38306206 regions located in the long arm were selected as target sites for the development of g chromosome arm-specific molecular markers, and the specific target site sequences are shown in Table 1. Meanwhile, a centromere repeat sequence monomer with a length of 148 bp and specific to I. indigotica was screened in the centromere region of the g chromosome of I. indigotica, which was used to develop a centromere-specific marker. The 7 regions (2 in the short arm, 4 in the long arm, and 1 in the centromere) are reasonably distributed on the g chromosome, covering the key functional regions, and can effectively evaluate the presence and structural integrity of the chromosome.

[0009] (3) Molecular marker design and naming: For the 6 chromosome arm InDel regions screened in step (2), PCR amplification-based codominant molecular marker primer pairs were designed. The markers are named Mg1 (short arm), Mg2 (short arm), Mg3 (long arm), Mg4 (long arm), Mg5 (long arm) and Mg6 (long arm) according to their physical positions on the g chromosome (from the short arm telomere to the long arm telomere). The nucleotide sequences of the forward primers (F) and reverse primers (R) corresponding to each marker are shown in Table 2 and the sequence listing SEQ ID NO: 1-12. The centromere repeat sequence monomer specific to I. indigotica was analyzed, and primer pairs for PCR amplification molecular marker Cen6.2 were designed at both ends, which can clearly distinguish I. indigotica and B. napus chromosomes.

[0010] (4) Identification method of B. napus x I. indigotica g chromosome: The identification is performed using the combination of the molecular markers, comprising the following steps:

[0011] a) extracting genomic DNA from the plant sample of the B. napus x I. indigotica to be tested;

[0012] b) using the DNA of the sample to be tested as a template, 7 pairs of primers designed in step (3) are subjected to PCR amplification, respectively;

[0013] c) agarose gel electrophoresis analysis of the PCR products;

[0014] d) result interpretation:

[0015] The amplification results of the original parent Brassica napus variety Huashuang No. 3 (as a negative control) and Isatis indigotica (as a positive control) are used as a benchmark;

[0016] For short arm (Mg1, Mg2) and long arm (Mg3 - Mg6) markers: when a marker simultaneously amplifies two clear bands in the sample to be tested, one consistent with Brassica napus control and the other consistent with Isatis indigotica specific band, the marker is determined to be positive; if only the band consistent with Brassica napus control is amplified or no band is amplified, it is determined to be negative;

[0017] For centromere marker (Cen6.2): plant centromeres are usually composed of high-density satellite repeats, with interspersed long terminal repeat-retrotransposons (LTR), which results in the number of repeat units in the amplification band of Isatis indigotica and Brassica napus being inconsistent, so the amplification band presents a typical satellite DNA "ladder-like" or "diffuse tailing" feature. At the same time, the repeat sequence of Isatis indigotica g chromosome is specific compared with Brassica napus, so the marker cannot amplify a band in Brassica napus. Therefore, when the sample to be tested amplifies a band with "ladder-like" or "diffuse tailing" characteristics consistent with the Isatis indigotica control, the marker is determined to be positive; if it is consistent with the Brassica napus control and cannot amplify a band, it is determined to be negative;

[0018] e) Comprehensive determination: if all 7 molecular markers of the sample to be tested show positive results, the plant is determined to be a Brassica napus with an intact Isatis indigotica g chromosome; if any arm marker (Mg1 - Mg6) is missing, it indicates that the corresponding arm segment of the g chromosome may be missing or broken; if the centromere marker (Cen6.2) is missing, it indicates that the centromere region of the g chromosome may be missing or structurally abnormal.

[0019] Specifically, the present application provides a molecular marker combination for identifying Brassica napus, which comprises: Mg1, Mg2, Mg3, Mg4, Mg5, Mg6 and Cen6.2, and the nucleotide sequences of the molecular markers Mg1, Mg2, Mg3, Mg4, Mg5, Mg6 and Cen6.2 are shown in SEQ ID NO: 15-21, respectively.

[0020] Further, the molecular markers Mg1-Mg2 are located on the short arm of the g chromosome of Isatis indigotica, the molecular markers Mg3-Mg6 are located on the long arm of the g chromosome of Isatis indigotica, and the molecular marker Cen6.2 is located on the centromere of the g chromosome of Isatis indigotica.

[0021] The application further provides a kit for identifying Isatis indigotica Fort. in Brassica rapa L., comprising primer sets for amplifying molecular markers Mg1, Mg2, Mg3, Mg4, Mg5, Mg6 and Cen6.2, the nucleotide sequences of which are shown in SEQ ID NOs:1-14, respectively.

[0022] Specifically, the primers for amplifying the molecular marker Mg1 are as follows:

[0023] Forward primer: TTCAGCTTTGAACTCTCTTTCTCCT (SEQ ID NO:1)

[0024] Reverse primer: TTGGATACACTATGCCACCTTCCG (SEQ ID NO:2)

[0025] The primers for amplifying the molecular marker Mg2 are as follows:

[0026] Forward primer: ATGGCGACGCATACTATGATC (SEQ ID NO:3)

[0027] Reverse primer: ATGAGTGAGTTTGGTCCGAG (SEQ ID NO:4)

[0028] The primers for amplifying the molecular marker Mg3 are as follows:

[0029] Forward primer: ACTGAAAAAGTAGAGGGGACAGT (SEQ ID NO:5)

[0030] Reverse primer: TGTTTGGGTGGTATTGATGACAG (SEQ ID NO:6)

[0031] The primers for amplifying the molecular marker Mg4 are as follows:

[0032] Forward primer: TTCACAACGAAAGGTGAGTCC (SEQ ID NO:7)

[0033] Reverse primer: TCCGTAAGACCACGAGGTG (SEQ ID NO:8)

[0034] The primers for amplifying the molecular marker Mg5 are as follows:

[0035] Forward primer: AGACGTGTTGGGTTAAAGATG (SEQ ID NO:9)

[0036] Reverse primer: CTAGTATGGGAGAGTTTGGCA (SEQ ID NO:10)

[0037] The primers for amplifying the molecular marker Mg6 are as follows:

[0038] Forward primer: CTTATCGGATGGAACAAGACGTC (SEQ ID NO: 11)

[0039] Reverse primer: CACAAGTCGGTCAGTAAACAGAC (SEQ ID NO: 12)

[0040] The primers for amplifying the molecular marker Cen6.2 are as follows:

[0041] Forward primer: TCGGGTCCAGAAATGTCCTATG (SEQ ID NO: 13)

[0042] Reverse primer: GTATTCCATGCTTCGCATCTATCT (SEQ ID NO: 14)

[0043] Further, the primers for amplifying the molecular markers Mg1-Mg2 as shown in SEQ ID NOs: 1-4 are designed for the Iin2: 4173633-4174347 and Iin2: 8577987-8579084 regions of the short arm of the g chromosome of Isatis indigotica, and the amplified fragments are shown in SEQ ID NOs: 15-16; the primers for amplifying the molecular markers Mg3-Mg6 as shown in SEQ ID NOs: 5-12 are designed for the Iin2: 22578621-22579040, Iin2: 26683583-26684647, Iin2: 31675641-31676305 and Iin2: 38304818-38305706 regions of the long arm of the g chromosome of Isatis indigotica, and the amplified fragments are shown in SEQ ID NOs: 17-20; the primers for amplifying the molecular marker Cen6.2 as shown in SEQ ID NOs: 13-14 are designed for the specific centromere repeat sequence monomer located in the centromere region of the g chromosome of Isatis indigotica as shown in SEQ ID NO: 21.

[0044] The application further provides the use of the above-mentioned molecular marker combination or the above-mentioned kit in identifying Isatis indigotica oilseed rape or in preparing an identified Isatis indigotica oilseed rape product.

[0045] Further, the Isatis indigotica oilseed rape is a Brassica napus-Isatis indigotica G monosomic addition line.

[0046] The application further provides a method for identifying Isatis indigotica oilseed rape, comprising the following steps:

[0047] (1) extracting genomic DNA of a sample to be tested;

[0048] (2) Using the genomic DNA of the sample to be tested as a template, the genomic DNA of the sample is subjected to PCR amplification by using the kit, and Brassica napus is used as a negative control and Isatis indigotica is used as a positive control;

[0049] (3) The PCR products are subjected to agarose gel electrophoresis analysis;

[0050] (4) Result interpretation: for molecular markers Mg1-Mg6: when two bands consistent with the positive and negative controls are amplified at the same time, it is determined to be positive, otherwise it is determined to be negative; for molecular marker Cen6.2: when only a band consistent with the positive control is amplified, it is determined to be positive, otherwise it is determined to be negative;

[0051] (5) When the 7 amplification products of the sample to be tested are all determined to be positive, it indicates that the sample to be tested is a Radix Isatidis rape stem with an intact g chromosome of Isatis indigotica added.

[0052] Further, the amplification system for PCR amplification in step (2) is: 2 x PCR Mix 3.5 μL, 10 μΜ forward primer 0.5 μL, 10 μΜ reverse primer 0.5 μL, genomic DNA with a concentration of 50-100 ng / μL 2.0 μL, and ddH2O 3.5 μL.

[0053] Further, the reaction program for PCR amplification in step (2) is:

[0054] (1) 94℃ pre-denaturation for 5 min;

[0055] (2) First cycle amplification, 10 cycles: 94℃ denaturation for 30 s; annealing using a drop program, the initial temperature is set to 60℃-64℃, and it is reduced by 0.4℃-0.5℃ per cycle, for 30 s; 72℃ extension for 40-60 s;

[0056] (3) Second cycle amplification, 30 cycles: 94℃ denaturation for 30 s; 56℃-60℃ annealing for 30 s; 72℃ extension for 40-60 s;

[0057] (4) 72℃ final extension for 5 min.

[0058] Further, for the primer for amplifying molecular marker Mg1, the initial annealing temperature in the first cycle amplification is 64℃, it is reduced by 0.4℃ per cycle, and the 72℃ extension time is 45 s; the annealing temperature in the second cycle amplification is 60℃, and the 72℃ extension time is 45 s;

[0059] For the primers used to amplify molecular marker Mg2, the annealing starting temperature in the first cycle of amplification was 64°C, decreasing by 0.4°C per cycle, and the extension time at 72°C was 60 s; the annealing temperature in the second cycle of amplification was 60°C, and the extension time at 72°C was 60 s;

[0060] For the primers used to amplify molecular marker Mg3, the annealing starting temperature in the first cycle of amplification was 64°C, decreasing by 0.4°C per cycle, and the extension time at 72°C was 40 s; the annealing temperature in the second cycle of amplification was 60°C, and the extension time at 72°C was 40 s;

[0061] For the primers used to amplify molecular marker Mg4, the annealing starting temperature in the first cycle of amplification was 64°C, decreasing by 0.4°C per cycle, and the extension time at 72°C was 60 s; the annealing temperature in the second cycle of amplification was 60°C, and the extension time at 72°C was 60 s;

[0062] For the primers used to amplify molecular marker Mg5, the annealing starting temperature in the first cycle of amplification was 60°C, decreasing by 0.5°C per cycle, and the extension time at 72°C was 45 s; the annealing temperature in the second cycle of amplification was 56°C, and the extension time at 72°C was 45 s;

[0063] For the primers used to amplify molecular marker Mg6, the annealing starting temperature in the first cycle of amplification was 62°C, decreasing by 0.5°C per cycle, and the extension time at 72°C was 50 s; the annealing temperature in the second cycle of amplification was 57°C, and the extension time at 72°C was 50 s.

[0064] Further, the PCR reaction procedure for the primers used to amplify molecular marker Cen6.2 was as follows: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 s, annealing at 55°C for 30 s, extension at 72°C for 45 s, for a total of 35 cycles; and extension at 72°C for 5 min.

[0065] Beneficial effects: Based on the newly assembled T2T reference genome of Isatis indigotica and the collinearity analysis of the g chromosome of Isatis indigotica and the A and C subgenomes of Brassica napus, a combination of molecular markers covering the key regions (short arm, long arm and centromere) of the g chromosome of Isatis indigotica is developed, which has the advantages of strong specificity, comprehensive coverage, simple and rapid operation, low cost and the like, and can quickly and accurately identify the presence or absence of the g chromosome of Isatis indigotica and the structural integrity of the g chromosome of Isatis indigotica in the Brassica napus stem of Isatis indigotica at the seedling stage, which is used for comprehensive evaluation of the integrity and authenticity of the g chromosome of Isatis indigotica in the Brassica napus stem of Isatis indigotica, effectively solving the problems of complex operation, poor timeliness and limited accuracy of existing identification methods. The population can be quickly screened at the seedling stage (before transplanting), and plants without the g chromosome of Isatis indigotica are removed, thereby significantly improving the production purity and efficiency of the Brassica napus stem of Isatis indigotica, effectively guaranteeing the commercial quality of the Brassica napus stem of Isatis indigotica. In addition, it can also be used for product authenticity identification, which can accurately distinguish the true Brassica napus stem of Isatis indigotica from counterfeit ordinary Brassica napus or other Brassica napus stem products, protect the rights and interests of consumers and breeders, and has wide application prospect and promotion value. BRIEF DESCRIPTION OF DRAWINGS

[0066] In order to more clearly illustrate the technical solutions of the embodiments of the present application, the following will briefly introduce the drawings needed to be used in the embodiments. It should be understood that the following drawings only show some embodiments of the present application, and therefore should not be regarded as a limitation on the scope. For those skilled in the art, other related drawings can also be obtained without creative labor on the basis of these drawings.

[0067] Figure 1 The figure shows the collinearity comparison of the g chromosome of Isatis indigotica and the A and C subgenomes of Brassica napus in the embodiments of the present application; the blue line and the red line in the figure respectively represent the regions with better collinearity of the g chromosome of Isatis indigotica (i.e. the 2nd chromosome of Isatis indigotica) and the A and C subgenomes of Brassica napus.

[0068] Figure 2 The figure shows the position of the g chromosome specific molecular marker of Isatis indigotica in the g chromosome in the embodiments of the present application; the black part represents the predicted centromere region, the shorter green region is the short arm region of the g chromosome, and the longer green region represents the long arm region of the g chromosome.

[0069] Figure 3 The figure shows the PCR product detection of each molecular marker in the DNA of Huashuang No. 3, Isatis indigotica and the Brassica napus stem of Isatis indigotica in the embodiments of the present application; the lane M represents 2000 bp marker, HS represents Brassica napus-Huashuang No. 3, SL represents Isatis indigotica, and Mg represents the Brassica napus stem of Isatis indigotica with additional g chromosome of Isatis indigotica.

[0070] Figure 4Figure 1 shows a gel map of some PCR products of each molecular marker in 154 selfed Brassica rapa plants of B. rapa var. chinensis in the present application. Lane M represents 5000 bp marker, lane HS represents Brassica napus var. pekinensis Hua Shuang 3, lane SL represents Isatis indigotica Fort, and lane BRC represents B. rapa var. chinensis to be identified.

[0071] Figure 5 Figure 2 shows an alignment of resequencing data of B. rapa var. chinensis plants identified as B. rapa var. chinensis with additional I. indigotica g chromosome by molecular markers in the present application with zs11_v0 genome and newly assembled I. indigotica chromosome Iin2. DETAILED DESCRIPTION

[0072] The following examples are only used to more clearly illustrate the technical solutions of the present application, and therefore are only examples, and cannot be used to limit the protection scope of the present application. It should be noted that, unless otherwise specified, the technical terms or scientific terms used in the present application should be understood as the usual meanings understood by the skilled in the art to which the present application belongs. Unless otherwise specified, the reagents, methods and devices used in the present application are conventional reagents, methods and devices in the art. Unless otherwise specified, the reagents and materials used in the following examples are commercially available.

[0073] Example 1 Assembly of I. indigotica T2T genome

[0074] (1) PacBio long read library was constructed using SMRTbell Express Template Prep kit 2.0 (Pacific Biosciences) kit. After removing sequence fragments with a length of ≤ 25 kb, the library was purified with 1x AMPure PB beads, and the size and quality of the constructed library were evaluated using FEMTO Pulse and Qubit dsDNA HS kit. The primers and Sequel II DNA polymerase used for sequencing were combined with the final SMRTbell library, respectively. SMRT sequencing used Sequel II sequencing kit and was sequenced on 8M SMRT Cell Sequel II platform. The library construction and sequencing part were completed by Baiyihui Neng Company.

[0075] (2) Isatis indigotica T2T genome assembly sketch. The PacBio revio HiFi data were used for sketch assembly. Four versions of Contig sketches were generated using Hifiasm (0.25.0) (Cheng et al., 2021), Canu (v2.2) (Koren et al., 2017), Verkko (v0.1.13) and LJA (v0.2) (Bankevich et al., 2022). After comparison, the hap2 sketch assembled by Hifiasm was selected as the skeleton for fine mapping.

[0076] (3) To construct the chromosome-level genome, the selected Contigs were corrected, ordered, oriented and clustered using Juicer (https: / / github.com / aidenlab / juicer) and 3D-DNA (https: / / github.com / aidenlab / 3d-dna) (Dudchenko et al., 2017) pipelines with the published Hi-C data. Finally, we used Juicebox Assembly Tools (v1.11.08) (https: / / github.com / aidenlab / Juicebox) (Durand et al., 2016) software to manually correct the results, further remove redundant sequences and obtain chromosome-level Scaffolds.

[0077] (4) Then, using the TGS-GapCloser (Xu et al., 2020) and manual completion methods, the four versions of Contig sketches were sequence aligned with the chromosome-level Scaffolds, and a chromosome-level genome containing only 2 gaps was obtained.

[0078] (5) Finally, the original reads of PacBio revio Hifi sequencing were aligned to the assembled genome using the minimap2 (v2.17) (https: / / github.com / lh3 / minimap2) (Li., 2018) software, and corrected using the Racon (v1.4.19) (https: / / yiweiniu.github.io / blog / 2018 / 03 / Genome-assembly-pipeline-Racon) software, which was iterated for three rounds.

[0079] Example 2: Analysis of the colinearity between the g chromosome of Isatis indigotica and the A, C subgenomes of Brassica napus

[0080] (1) The degree of collinearity between the g chromosome of Isatis indigotica and the A and C subgenomes of Brassica napus: The collinear blocks and gene pairs between the assembled g chromosome of I. indigotica (Iin2) and the A and C subgenomes of the Brassica napus reference genome (zsll.v0) were identified using jcvi (python version MCScan) (https: / / github.com / tanghaibao / jcvi / wiki / MCscan-(Python-version) (Wang et al., 2012) and plotted into pictures (Fig. 1). Figure 1 ).

[0081] (2) Based on the results of collinear blocks and gene pairs, the sites with stable insertion / deletion (InDel) polymorphisms between I. indigotica and B. napus were screened in the gene regions of the short arm and long arm of the g chromosome, respectively. Finally, the regions of Iin2: 4173633 - 4174347 and Iin2: 8577987 - 8579084 located on the short arm, and the regions of Iin2: 22578621 - 22579040, Iin2: 26683583 - 26684647, Iin2: 31675641 - 31676305 and Iin2: 38304818 - 38305706 located on the long arm were selected as target sites for the development of g chromosome arm-specific molecular markers, and the specific sequences of the target sites are shown in Table 1.

[0082] Table 1 Location of selected InDel regions on the g chromosome of I. indigotica and their sequence information

[0083]

[0084] Example 3 Comparison of centromere region repeat sequences of the g chromosome of I. indigotica

[0085] (1) Prediction of the centromere region of G chromosome of Isatis indigotica. The centromere region of G chromosome of I. indigotica was predicted by Centromics software combined with the T2T genome data of I. indigotica and the published Hi-C data, and a centromere repeat sequence monomer with a length of 148 bp was obtained. The satellite sequence has nucleotide polymorphism, and each repeat unit has differences in some sites. The representative sequence of the fragment is as follows: 5'-CACTTTAATGTGTACCTTATAAAAGCTTAGAAAGCATATTTGGGGTCCAAAAAATGTCCTATGAGGTTTCTAAACAAAACTATTTTCGCAAAACTTCTTATAAAGATAGAACGCGAAGCATGGGATACAAGTTTGTGTTCCAAAAGAG-3' (SEQ ID NO: 21), and the centromere region is mainly distributed in 13.83-17.48 Mb.

[0086] (2) Comparison of repeat sequences in the centromere region of I. indigotica and Brassica napus. The 148 bp centromere repeat sequence monomer CL1 obtained from I. indigotica was aligned to the Brassica napus genome using blastn, and no similar sequence was found. The similarity between CL1 and Brassica species centromere-related repeat sequences such as CRB, CL3, CenBr1, CenBr2, etc. was compared, and no sequence conservative region was found. Therefore, the CL1 repeat region can be used to design I. indigotica-specific centromere molecular markers.

[0087] Example 4 Development and detection of I. indigotica G chromosome arm-specific markers

[0088] (1) For the 6 InDel regions selected in the collinearity analysis, 6 pairs of specific primers covering the short arm and long arm of the G chromosome of I. indigotica were designed, and the positions of each molecular marker on the G chromosome are shown in Table 1. Figure 2 The specific sequences of the primers used to amplify each molecular marker are shown in Table 2.

[0089] Table 2 Specific primer sequences and amplification products of I. indigotica G chromosome arm

[0090]

[0091] (2) The DNA of Brassica napus Huashuang No. 3 (provided by the Brassica Research Room of Huazhong Agricultural University), Isatis indigotica (provided by the Brassica Research Room of Huazhong Agricultural University) and Banlangen Youcaiti (provided by the Brassica Research Room of Huazhong Agricultural University, which is added with a g chromosome of Isatis indigotica in the background of Brassica napus Huashuang No. 3) was amplified by PCR using g chromosome arm-specific molecular marker primers, and a 10 μL system was used. The specific amplification system is shown in Table 3:

[0092] Table 3 PCR amplification system of g chromosome arm-specific primers

[0093]

[0094] In the amplification system of the above-mentioned PCR reagents, 2 × PCR Mix is a commercially available product.

[0095] (3) The PCR reaction program of the g chromosome arm-specific primers is as follows:

[0096] Pre-denaturation: 94℃ for 5 min.

[0097] First cycle amplification (10 cycles):

[0098] a) Denaturation: 94℃ for 30 s;

[0099] b) Annealing: using a touchdown program (Touchdown PCR), the initial temperature is set to 60℃-64℃ according to the marker, and is reduced by 0.4℃-0.5℃ per cycle (see Table 4 for details), for 30 s;

[0100] c) Extension: 72℃ for 40-60 s (see Table 4 for details).

[0101] Second cycle amplification (30 cycles):

[0102] a) Denaturation: 94℃ for 30 s;

[0103] b) Annealing: 56℃-60℃ (see Table 4 for details), for 30 s;

[0104] c) Extension: 72℃ for 40-60 s (see Table 4 for details).

[0105] Final extension: 72℃ for 5 min.

[0106] Table 4 Key difference parameters of six g chromosome arm-specific primers

[0107]

[0108] (4) Agarose gel electrophoresis detection. 4-5 μl of the amplification product was subjected to 1.5% agarose gel electrophoresis (containing 0.1% ethidium bromide), and the gel imaging system (Bio-Rad, Gel DocTM XR+) was used to take photographs and observe the results, as shown in Fig. 2, the results showed that the molecular markers Mg1-Mg6 designed in the application could amplify two clear bands with different fragment sizes in the original parent Brassica napus variety Huashuang No. 3 (HS) and B. campestris var. napiformis (SL), and the fragment sizes were consistent with Table 2, while two clear bands could be amplified in B. campestris var. napiformis (Mg, which was added with a g chromosome of B. campestris under the genomic background of Brassica napus Huashuang No. 3), one of which was consistent with the band of Brassica napus Huashuang No. 3 (HS), and the other was consistent with the specific band of B. campestris var. napiformis (SL). Figure 3

[0109] Example 5 Development and detection of B. campestris g chromosome centromere region specific marker

[0110] (1) According to the identified B. campestris specific centromere repeat sequence (SEQ ID NO: 21), primers were designed at both ends to obtain a pair of B. campestris centromere specific primers (as shown in the sequence table SEQ ID NO: 13-14) expected to clearly distinguish B. campestris and Brassica napus chromosomes, which can be used to amplify the molecular marker Cen6.2 (as shown in the sequence table SEQ ID NO: 21), and the specific primer sequences are as follows:

[0111] Cen6.2-forward primer: 5'-TCGGGTCCAGAAATGTCCTATG-3' (SEQ ID NO: 13);

[0112] Cen6.2-reverse primer: 5'-GTATTCCATGCTTCGCATCTATCT-3' (SEQ ID NO: 14).

[0113] (2) The DNA of Brassica napus Huashuang No. 3 (provided by the Brassica napus research room of Huazhong Agricultural University), B. campestris (provided by the Brassica napus research room of Huazhong Agricultural University) and B. campestris var. napiformis (provided by the Brassica napus research room of Huazhong Agricultural University) was subjected to PCR amplification using Cen6.2 centromere specific primers, and a 10 μL system was used.

[0114] The system components include: 3.5 μL 2 × PCR Mix, 0.5 μL forward primer (concentration of 10 μM), 0.5 μL reverse primer (concentration of 10 μM), 2 μL DNA (concentration of 50-100 ng / μL), 3.5 μL ddH2O.

[0115] ​The reaction procedure is: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, 55℃ recombination for 30 s, 72℃ extension for 45 s, a total of 35 cycles; 72℃ extension for 5 min, 4℃ storage.

[0116] (3) Agarose gel electrophoresis detection. Take 4-5 μL of the amplification product, and after electrophoresis through 1% agarose gel (containing 0.1% ethidium bromide), the gel imaging system (Bio-Rad, Gel DocTM XR+) takes a photograph and observes the results. Plant centromeres are usually composed of high-density satellite repeats, with long terminal inverted repeats (LTRs) interspersed, which leads to the inconsistent number of repeat units in the amplification bands of the centromere marker in Isatis indigotica and Baphalaneracana, as shown in FIG. 1. The specific molecular marker Cen6.2 designed in the present application cannot amplify a band in the original parent Brassica napus variety Huashuang 3 (HS), but can amplify a band showing "ladder-like" or "diffuse tailing" characteristics in Isatis tinctoria (SL), and can also amplify a band showing "ladder-like" or "diffuse tailing" characteristics consistent with the Isatis indigotica control in Baphalaneracana (Mg, with an additional Isatis indigotica g chromosome in the Brassica napus Huashuang 3 genomic background). Figure 3

[0117] Example 6 Application of Isatis indigotica g chromosome specific molecular marker in the production of Baphalaneracana

[0118] The 32-hole tray was used for the seedling culture of Baphalaneracana self-pollinated seeds, and when the seedlings grew to the 3-leaf stage, leaf samples were collected, and the CTAB method was used to extract DNA.

[0119] The above-mentioned 7 pairs of specific molecular marker primers (sequences are shown in the sequence table SEQ ID NO: 1-14) designed for Isatis indigotica g chromosome were used for g chromosome PCR amplification identification in turn. The PCR amplification system and reaction procedure are shown in Example 4 and Example 5. The agarose gel electrophoresis map of the PCR amplification product was used to interpret each molecular marker for each plant.

[0120] ​Specifically, based on the amplification results of the original parent Brassica napus variety Huashuang No. 3 (HS, as a negative control) and Isatis indigotica (SL, as a positive control); for short arm (Mg1, Mg2) and long arm (Mg3-Mg6) markers: when a certain marker simultaneously amplifies two clear bands in the sample to be tested, one of which is consistent with the HS band, and the other is consistent with the SL specific band, it is determined that the marker is positive; if only the band consistent with the Brassica napus control is amplified or no band is amplified, it is determined to be negative; for the centromere marker (Cen6.2): when the sample to be tested amplifies a band with a "ladder-like" or "diffuse tailing" characteristic consistent with the SL control, it is determined that the marker is positive; if the band consistent with the HS control cannot be amplified, it is determined to be negative.

[0121] Comprehensive determination: if all 7 molecular markers of the sample to be tested show positive results, it is determined that the plant is a Radix Isatidis rape stem with an intact Isatis g chromosome; if any arm marker (Mg1-Mg6) is missing, it indicates that the corresponding arm segment of the g chromosome may be missing or broken; if the centromere marker (Cen6.2) is missing, it indicates that the centromere region of the g chromosome may be missing or structurally abnormal.

[0122] The detection results are shown in Table 1. Figure 4 As shown in Table 1, the results show that among the 154 plants, 125 plants carrying an intact Isatis g chromosome were identified. The plants identified by molecular markers as carrying an intact Isatis g chromosome were sampled for resequencing detection. The resequencing alignment results show that all the sampled plants have uniform coverage on the g chromosome (Iin2), and the coverage is only half of that of the Brassica napus chromosome (Iin1) Figure 5 ), indicating that these plants indeed carry a single and intact Isatis g chromosome, and also indicating that the molecular marker combination and specific primers screened by the present application have very high accuracy for identifying the retention and integrity of the Isatis g chromosome of Radix Isatidis rape stems.

[0123] In summary, based on the newly assembled Isatis T2T reference genome and the collinearity analysis of the Isatis g chromosome and Brassica napus A and C subgenomes, the present application designs a molecular marker combination and specific primer group that can cover the key regions of the Isatis g chromosome (short arm, long arm and centromere), which can quickly and accurately identify the presence or absence of the Isatis g chromosome and its structural integrity in Radix Isatidis rape stem plants at the seedling stage, with an accuracy of 100%, and is simple to operate and low in cost, thereby significantly improving and ensuring the production purity and efficiency of Radix Isatidis rape stems, and can be used for product authenticity identification to accurately distinguish between true Radix Isatidis rape stems and counterfeit ordinary Brassica napus or other rape stem products, and has a wide application prospect.

[0124] The above detailed description describes the implementation of the present application, but the present application is not limited to the specific details in the above implementation. Within the scope of the claims and technical concepts of the present application, various simple modifications and changes can be made to the technical solutions of the present application, and these simple modifications all belong to the protection scope of the present application.

Claims

1. A primer combination for identifying Isatis indigotica Fort. in Brassica rapa L., characterized in that, The primer combination includes primers for amplifying gene fragments Mg1, Mg2, Mg3, Mg4, Mg5, Mg6 and Cen6.2 in sequence, the nucleotide sequences of which are shown in SEQ ID NO:1-14.

2. The primer combination according to claim 1, characterized in that, The gene fragments Mg1-Mg2 are located on the short arm of the g chromosome of Isatis indigotica, the gene fragments Mg3-Mg6 are located on the long arm of the g chromosome of Isatis indigotica, and the gene fragment Cen6.2 is located on the centromere of the g chromosome of Isatis indigotica; the nucleotide sequences of the gene fragments Mg1, Mg2, Mg3, Mg4, Mg5, Mg6 and Cen6.2 are shown in SEQ ID NO:15-21.

3. A kit for identifying Isatis indigotica Fort, characterized in that, It comprises the primer combination as described in any one of claims 1-2.

4. The use of any primer combination of claims 1-2 or the kit of claim 3 in the identification of Isatis indigotica rapeseed or the preparation of products for identifying Isatis indigotica rapeseed.

5. A method for identifying Radix Isatidis in Brassica campestris, characterized in that, Includes the following steps: (1) Extract genomic DNA from the sample to be tested; (2) Using the genomic DNA of the sample to be tested as a template, the genomic DNA of the sample is amplified by PCR using any of the primer combinations described in claims 1-2 or the kit described in claim 3, with rapeseed as a negative control and isatis as a positive control. (3) The PCR products were analyzed by agarose gel electrophoresis; (4) Result interpretation: For primers used to amplify gene fragment Mg1-Mg6: when two bands consistent with the positive and negative controls are amplified at the same time, it is judged as positive; otherwise, it is judged as negative. For primers used to amplify gene fragment Cen6.2: when only a band consistent with the positive control is amplified, it is judged as positive; otherwise, it is judged as negative. (5) When all 7 amplification products of the sample to be tested are positive, it indicates that the sample to be tested is a rapeseed of Isatis indigotica with the complete Isatis indigotica g chromosome attached.

6. The method according to claim 5, characterized in that, The PCR amplification system in step (2) is as follows: 3.5 μL of 2 × PCR Mix, 0.5 μL of 10 μM forward primer, 0.5 μL of 10 μM reverse primer, 2.0 μL of genomic DNA at a concentration of 50~100 ng / μL, and 3.5 μL of ddH2O.

7. The method according to claim 5, characterized in that, The PCR amplification reaction procedure in step (2) is as follows: (1) Pre-denaturation at 94℃ for 5 min; (2) First cycle of amplification, 10 cycles: denaturation at 94℃ for 30 s; annealing using a drop program, with the starting temperature set at 60℃ - 64℃, decreasing by 0.4℃ - 0.5℃ per cycle for 30 s; extension at 72℃ for 40 - 60 s; (3) Second cycle amplification, 30 cycles: denaturation at 94℃ for 30 s; annealing at 56℃ - 60℃ for 30 s; extension at 72℃ for 40 - 60 s; (4) The final extension at 72℃ lasts for 5 minutes.

8. The method according to claim 7, characterized in that, For the primers used to amplify the Mg1 gene fragment, the annealing start temperature in the first amplification cycle was 64℃, decreasing by 0.4℃ per cycle, with a 72℃ extension time of 45s; the annealing temperature in the second amplification cycle was 60℃, with a 72℃ extension time of 45s. For the primers used to amplify the Mg2 gene fragment, the annealing start temperature in the first amplification cycle was 64℃, decreasing by 0.4℃ per cycle, with a 72℃ extension time of 60s; the annealing temperature in the second amplification cycle was 60℃, with a 72℃ extension time of 60s. For the primers used to amplify the Mg3 gene fragment, the annealing start temperature in the first amplification cycle was 64℃, decreasing by 0.4℃ per cycle, with a 72℃ extension time of 40s; the annealing temperature in the second amplification cycle was 60℃, with a 72℃ extension time of 40s. For the primers used to amplify the Mg4 gene fragment, the annealing start temperature in the first amplification cycle was 64℃, decreasing by 0.4℃ per cycle, with an extension time of 60s at 72℃; the annealing temperature in the second amplification cycle was 60℃, with an extension time of 60s at 72℃. For the primers used to amplify the Mg5 gene fragment, the annealing start temperature in the first amplification cycle was 60℃, decreasing by 0.5℃ per cycle, with an extension time of 45s at 72℃; the annealing temperature in the second amplification cycle was 56℃, with an extension time of 45s at 72℃. For the primers used to amplify the Mg6 gene fragment, the annealing start temperature in the first amplification cycle was 62℃, decreasing by 0.5℃ per cycle, with a 72℃ extension time of 50s; the annealing temperature in the second amplification cycle was 57℃, with a 72℃ extension time of 50s.

9. The method according to claim 5, characterized in that, The PCR reaction program for the primers used to amplify the Cen6.2 gene fragment was as follows: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, 55℃ annealing for 30 s, 72℃ extension for 45 s, for a total of 35 cycles; 72℃ extension for 5 min.

Images