Multiplex fluorescent genotyping detection primer probe group and kit for norovirus epidemic strain

By designing a set of primers and probes for multiplex fluorescent genotyping detection and a universal fluorescent detection reagent, the problem of time-consuming and labor-intensive norovirus detection has been solved, enabling rapid and sensitive genotyping and supporting norovirus tracing and prevention.

CN121380458AActive Publication Date: 2026-01-23JIANGSU PROVINCIAL CENTER FOR DISEASE CONTROL AND PREVENTION (PUBLIC HEALTH RESEARCH INSTITUTE OF JIANGSU PROVINCE)
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202511966219.1
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-12-24
Publication Date
2026-01-23
Estimated Expiration
2045-12-24

AI Technical Summary

Technical Problem

Existing norovirus testing technologies are time-consuming and labor-intensive, making it difficult to quickly and sensitively identify samples with low viral loads, which leads to difficulties in tracing the source and hinders the timely development of prevention and control measures.

Method used

A set of primers and probes for multiplex fluorescent genotyping detection of norovirus strains was designed. Combined with universal multiplex fluorescent detection reagents, simultaneous detection of GII.17, GII.3 and GII.4 types was achieved through fluorescent PCR technology. MGB quencher groups were used to improve specificity and sensitivity.

Benefits of technology

It enables rapid, simple, and sensitive norovirus genotyping detection, reducing the overall time to 1.5 hours, with 100% sensitivity and specificity. It is suitable for environmental sample testing and supports the timely formulation of source tracing and control strategies.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121380458A_ABST
    Figure CN121380458A_ABST
Patent Text Reader

Abstract

The invention relates to a multiplex fluorescent genotyping detection primer probe group and a kit aiming at a norovirus epidemic strain, and belongs to the technical field of biology. The primer probe group comprises a primer pair and a probe which are used for detecting the GII.17 type, the GII.3 type and the GII.4 type of the noroviruses; wherein the nucleotide sequences of the primer pair and the probe for detecting the GII.17 type are as shown in SEQ ID NO: 1-3; the nucleotide sequences of the primer pair and the probe for detecting the GII.3 type are as shown in SEQ ID NO: 4-6; the nucleotide sequences of the primer pair and the probe for detecting the GII.4 type are as shown in SEQ ID NO: 7-9. The method has the following technical effects: 1, the detection time is short, the operation is simple and convenient, and the total detection time is about 1.5 hours; 2, the sensitivity is high; 3, the detection limit is low, and the method can be applied to environmental specimen detection.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to a multiplex fluorescent genotyping detection primer probe set and kit for norovirus epidemic strains, and belongs to the technical field of biology. BACKGROUND

[0002] Norovirus has 10 gene groups (GI-GX), among which GII gene group is the main gene group causing human norovirus acute gastroenteritis infection. According to the virus polymerase (RdRp) gene sequence and capsid protein (VP1) gene sequence, GII gene group can be further divided into 37 P types and 26 VP1 genotypes. In the past ten years, the main epidemic types are GII.4[P16], GII.4[P31], GII.17[P17], GII.3[P12], GII.2[P16] and GII.6[P7] and so on, and the proportion of GII.17[P17], GII.4[P16] and GII.3[P12] three dominant genotypes in norovirus outbreak monitoring and sporadic monitoring is close to 90%, and the disease burden is serious.

[0003] At present, the detection of norovirus is first to identify the gene group by real-time fluorescent RT-PCR, then to amplify and sequence by ordinary RT-PCR using typing primers, to carry out first-generation sequencing or second-generation sequencing of the sequencing product, and finally to carry out genotyping by online comparison tool of the sequencing sequence. The whole process takes about 2 days, which is time-consuming and laborious. Norovirus outbreaks often involve low viral load of anal swab specimens and environmental specimens, which are difficult to be typed by ordinary RT-PCR amplification and sequencing, which makes it difficult to trace the source of norovirus, and cannot effectively develop prevention and control measures in time, which finally leads to the expansion of norovirus outbreak.

[0004] Therefore, it is necessary to provide a detection technology which can quickly detect and has high sensitivity. SUMMARY

[0005] The present application aims to overcome the shortcomings of the prior art, and provides a multiplex fluorescent genotyping detection primer probe set and kit for norovirus epidemic strains.

[0006] The inventor of the present application designs a multiplex fluorescent genotyping detection primer probe set and kit for norovirus epidemic strains, which can detect the capsid protein VP1 genes (i.e., GII.17, GII.3 and GII.4) of three dominant epidemic strains genotypes GII.17[P17], GII.4[P16] and GII.3[P12]. The primer probes of the three genotypes are all designed by the inventor. The GII.17-F primer is located at the 277-300 nucleotide site of the VP1 gene, the GII.17-R primer is located at the 435-459 nucleotide site of the VP1 gene, and the GII.17-Probe primer is located at the 321-345 nucleotide site of the VP1 gene. The GII.3-F primer is located at the 53-74 nucleotide site of the VP1 gene, the GII.3-R primer is located at the 290-311 nucleotide site of the VP1 gene, and the GII.3-Probe primer is located at the 170-190 nucleotide site of the VP1 gene. The GII.4-F primer is located at the 59-80 nucleotide site of the VP1 gene, the GII.4-R primer is located at the 211-232 nucleotide site of the VP1 gene, and the GII.4-Probe primer is located at the 113-134 nucleotide site of the VP1 gene.

[0007] In the present application, the multiplex fluorescent genotyping detection primer probe set for norovirus epidemic strains includes primer pairs and probes for detecting norovirus GII.17, GII.3 and GII.4, and the specific sequences of each primer and probe are as follows: The GII.17-F, i.e., the GII.17 upstream primer, has a nucleotide sequence as shown in SEQ ID NO: 1, and a specific nucleotide sequence of TCAAGGATGTACAATGGGTATGCT. The GII.17-R, i.e., the GII.17 downstream primer, has a nucleotide sequence as shown in SEQ ID NO: 2, and a specific nucleotide sequence of TGGYTCAAGAGTCCTRACATCTACT. The GII.17-Probe, i.e., the GII.17 probe, has a nucleotide sequence as shown in SEQ ID NO: 3, and a specific nucleotide sequence of TCTCCTGGCAGGGAACGCGTTCACT. The GII.3-F, i.e., the GII.3 upstream primer, has a nucleotide sequence as shown in SEQ ID NO: 4, and a specific nucleotide sequence of TCGTCCCAGAGATCAACARTGA. The GII.3-R, i.e., the GII.3 downstream primer, has a nucleotide sequence as shown in SEQ ID NO: 5, and a specific nucleotide sequence of TCAAAYCCACCTGCATAACCAT. GII.3-Probe, i.e., a GII.3 probe, the nucleotide sequence of which is shown in SEQ ID NO: 6; the specific nucleotide sequence is ACTCACCACCAGGTGCTTGCA; GII.4-F, i.e., a GII.4 upstream primer, the nucleotide sequence of which is shown in SEQ ID NO: 7; the specific nucleotide sequence is CAGAGGTCAACAATGAGGTTAT; GII.4-R, i.e., a GII.4 downstream primer, the nucleotide sequence of which is shown in SEQ ID NO: 8; the specific nucleotide sequence is CTCCATAGTATTTCACCTGGA; GII.4-Probe, i.e., a GII.4 probe, the nucleotide sequence of which is shown in SEQ ID NO: 9; the specific nucleotide sequence is TGTTGGCCCGCTACAGGTGC.

[0008] The fluorescent probe is an oligonucleotide probe, a fluorescent group is connected to the 5' end of the probe, and a quenching group is connected to the 3' end of the probe. The fluorescent group for detecting GII.17 is FAM, and the quenching group is MGB. The fluorescent group for detecting GII.3 is VIC, and the quenching group is MGB. The fluorescent group for detecting GII.4 is CY5, and the quenching group is MGB.

[0009] The application also provides a multiplex fluorescent genotyping detection kit for prevalent strains of norovirus, which comprises the multiplex fluorescent genotyping detection primer probe set for prevalent strains of norovirus described above.

[0010] Further, the kit further comprises a multiplex fluorescent detection reagent, which can be a multiplex fluorescent detection reagent commonly used in the market, such as the HiScript II U+ One Step qRT-PCR Probe Kit reagent produced by Nanjing Nuowei.

[0011] The application also provides a preparation method of the primer probe set working solution, comprising the following steps: 1) The synthesized dry powder of each primer and probe is prepared into a working concentration of 10 micromoles per liter by adding RNase-free water.

[0012] 2) Each primer and probe for detecting GII.17, GII.3 and GII.4 is respectively configured into three kinds of probe primer mixed solutions according to the volume ratio of 2:2:1 of the upstream primer: the downstream primer: the probe; in the application, the volume ratio of the upstream primer: the downstream primer: the probe is 400:400:200 (μL).

[0013] 3) Finally, the three kinds of probe primer mixed solutions are mixed in equal volume to prepare the primer probe working solution.

[0014] In detection, the general multiplex fluorescent detection reagent plus the primer probe working solution of the application can be detected on the machine, and GII.17, GII.3 and GII.4 epidemic strain infections can be judged at the same time.

[0015] The inventive concept of the application is as follows: PCR primers and fluorescent Taqman probes are designed for the gene-conserved sequences of three specific norovirus epidemic variants. A nucleotide probe with fluorescent dye groups at both ends is added on the basis of conventional PCR, wherein the fluorescent group is at the 5' end and the quencher group is at the 3' end, and the two groups form an energy transfer structure. When the probe is complete, the fluorescent group is inhibited by the quencher group and no fluorescence is generated. When the probe binds to the target sequence, the upstream primer is extended to the position, and the probe is hydrolyzed under the action of exonuclease, the fluorescent signal of the fluorescent group is released and collected and detected by the instrument, thereby prompting the presence of the target sequence. The detection genes of the three epidemic strains form a combination, and the real-time, high-sensitivity and good specificity of the fluorescent PCR technology can visually and quickly judge GII.17, GII.3 and GII.4 infections at the end of the reaction or even before the end. In addition, the quencher groups of the three gene probes are all MGB, instead of TAMRA quencher groups. The MGB quencher group system allows the use of shorter and more specific probes through its unique small groove binding capacity, and combines with the non-fluorescent quenching technology, which is significantly superior to the traditional TAMRA quencher group in specificity, sensitivity and signal-to-noise ratio.

[0016] The multiplex fluorescent genotyping detection primer probe set and kit for norovirus epidemic strains of the application have the following technical effects: 1. Short detection time and simple operation The existing norovirus detection first identifies the gene group through real-time fluorescent RT-PCR (about 1.5-2 hours), then performs ordinary RT-PCR amplification sequencing using the typing primer (about 2-5 hours), carries out first-generation sequencing (about 10 hours) or second-generation sequencing (about 20 hours) of the sequencing product, and finally carries out genotyping of the sequence obtained by sequencing through an online comparison tool (about 1 hour). The whole process takes about 2 days, which is time-consuming and laborious. The experimental operation of the application is more simple, the general reagent plus the primer probe working solution of the application can be detected on the machine, and GII.17, GII.3 and GII.4 epidemic strain infections can be judged at the same time, and the total detection time is about 1.5 hours. The results are also easy to judge, and only the cycle numbers (Ct values) of the three channels need to be observed. The simple operation process and conventional fluorescent detection instrument equipment can also be carried out by the primary units.

[0017] 2. High sensitivity, good specificity, strong repeatability and no cross-reaction between types.

[0018] The present application is based on the VP1 region sequence of the three popular genotypes which account for nearly 90% at present, and can theoretically detect all GII.17, GII.3 and GII.4 popular variant strains. In practical application, the inventors detected all GII.17, GII.3 and GII.4 variant strains (including GII.17[P17], GII.4[P16] and GII.3[P12]), and used GII.2[P16], GII.6[P7] and GII.7[P7] as controls, and the results showed that the sensitivity and specificity were both 100%. When the monthly norovirus specimens were rechecked, it was found that the results were completely consistent with the sequencing results, showing good stability and repeatability.

[0019] 3. Low detection limit, which can be applied to environmental specimen detection.

[0020] The most representative advantage of the present application is the detection of environmental specimens. Environmental specimens are large in quantity and low in viral load, which causes great difficulty in detection. Due to the low viral load, it is difficult to carry out sequencing and typing detection on environmental specimens, but when a norovirus outbreak occurs, there is basically environmental pollution in the place where the infected person is, and it is impossible to sequence and provide the genotype of the norovirus variant strain, which leads to difficulty in tracing. The method of the present application can detect the specific popular strain infection type when detecting environmental specimens, and the detection results are completely consistent with the results of epidemiological tracing investigation, and the sensitivity and specificity are both 100%, which effectively helps to quickly trace and timely formulate prevention and control strategies during a norovirus outbreak. BRIEF DESCRIPTION OF DRAWINGS

[0021] Figure 1 The figure is the detection result of norovirus GII.17[P17], GII.3[P12] and GII.4[P16] patient nucleic acid mixture.

[0022] Figure 2 The figure is the detection result of anal swab specimens and environmental specimens in the norovirus GII.17[P17] outbreak.

[0023] Figure 3 The figure is the detection result of anal swab specimens and environmental specimens in the norovirus GII.4[P16] outbreak.

[0024] Figure 4 The figure is the detection result of norovirus GII.2[P16], GII.6[P7] and GII.7[P7] nucleic acid.

[0025] Figure 5 The figure is the specificity verification result (influenza virus, enterovirus, rotavirus and sapovirus).

[0026] Figure 6 This is a comprehensive comparison of first-generation sequencing genotyping and fluorescence genotyping results. Detailed Implementation

[0027] The following are specific embodiments of the present invention, which are described in conjunction with the accompanying drawings. However, the present invention is not limited to these embodiments.

[0028] Example 1

[0029] 1. Primer and probe design: The inventors designed their own primers for detecting prevalent norovirus strains by downloading 1000 complete VP1 region gene sequences for each of three genotypes (GII.17, GII.3, and GII.4) and performing comparative analysis. Primers were designed using Oligo 7 software, resulting in 15 primer-probe pairs for GII.17, 12 for GII.3, and 10 for GII.4. Specificity comparison analysis of these primers and probes was performed using the NCBI BLAST online database. Primers with high PCR efficiency, high sensitivity, good specificity, and good stability were screened, ultimately yielding three sets of primer and probe sequences with the best quality control. Simultaneously, the quenching groups of the probes were changed from TAMRA-type to MGB, improving their specificity and accuracy. The nucleotide sequences of the obtained primer-probe sets are shown in Table 1.

[0030] Table 1 Primer and probe sequences for multiplex fluorescent detection of circulating norovirus strains .

[0031] 2. Kit for multiplex fluorescent detection of circulating norovirus strains The kit for multiplex fluorescence detection of circulating norovirus strains includes the above-mentioned primer and probe set and multiplex fluorescence detection reagent. The multiplex fluorescence detection reagent can be any commercially available multiplex fluorescence detection reagent. In this invention, the HiScript II U+ One Step qRT-PCR Probe Kit (purchased from Nanjing Novizan) is used.

[0032] The primer and probe kit is prepared as a primer and probe working solution. The preparation method is as follows: 1) Prepare a working concentration of 10 μmol / L by adding RNase-free water to the synthetic dry powder of each primer and probe.

[0033] 2) The primers and probes for detecting GII.17, GII.3 and GII.4 are mixed in a ratio of 2:2:1 (upstream primer: downstream primer: probe) to prepare three probe primer mixtures, and in the present application, the added volumes of upstream primer, downstream primer and probe are 400 μL, 400 μL and 200 μL, respectively.

[0034] 3) Finally, the three mixtures are mixed in equal volumes to prepare the primer probe working solution.

[0035] In detection, the universal multiplex fluorescence detection reagent is added to the prepared primer probe working solution, and the machine is detected, and GII.17, GII.3 and GII.4 epidemic strains can be judged at the same time.

[0036] 3. The detection process is as follows: 3.1 System preparation The experimental system is prepared in the system preparation room. The universal multiplex fluorescence detection kit on the market can be selected, and the present application uses HiScript II U+ One Step qRT-PCR Probe Kit kit (purchased from Nanjing Novozyme). The system preparation is shown in Table 2.

[0037] Table 2 PCR reaction system .

[0038] After the system preparation is completed, shake and mix, and centrifuge, and then according to 10 μL / person, dispense into the PCR reaction tube.

[0039] 3.2 Sample processing In the sample adding room, 2.5 μL of the nucleic acid of the sample to be detected, positive control and negative control are added to the prepared PCR reaction tube, the final volume is 12.5 μL, the tube cover is tightly covered, and the tube is shaken and centrifuged. The sample is the norovirus nucleic acid owned by the inventor's laboratory, and the type includes GII.17[P17] type, GII.4[P16] type, GII.3[P12] type, other types including GII.2[P16] type, GII.6[P7] type and GII.7[P7] type, in addition to GII gene group positive but untyped nucleic acid, and the source includes patient specimens and external environment specimens. In addition, it also includes influenza virus, enterovirus, rotavirus and sapovirus nucleic acid samples for specific detection. The positive control is GII.17[P17] nucleic acid with successful sequencing. The negative control is RNase-free water.

[0040] 3.3 PCR amplification The PCR reaction tubes were placed in an ABI QuantStudio Q5 real-time PCR instrument for amplification and detection, without selecting ROX correction. The fluorescent groups were FAM, VIC, and CY5. The cycling parameters are set as shown in Table 3.

[0041] Table 3 Reaction Procedure .

[0042] 3.4. Results Analysis The negative control showed no fluorescence curve, while the positive control showed three smooth curves. A specimen was considered positive if its fluorescence curve was smooth and the cycle number (Ct value) was less than 38; otherwise, it was negative. If only one of FAM and VIC had a Ct ≤ 38, a retest was required regardless of whether CY5 also had a Ct ≤ 38. Specific determination results are shown in Table 4.

[0043] Table 4 Result Judgment .

[0044] (1) The results of nucleic acid mixing detection in patients with norovirus GII.17[P17], GII.3[P12], and GII.4[P16] types showed curves in the FAM, VIC, and CY5 channels with Ct≤38, indicating infection with norovirus GII.17[P17], GII.3[P12], and GII.4[P16] types. The results are as follows... Figure 1 As shown.

[0045] (2) Results of anal swab and environmental specimen testing in the GII.17 [P17] outbreak: The presence of a curve in the FAM channel and Ct≤38 indicates GII.17 [P17] infection. Results are as follows... Figure 2 As shown.

[0046] (3) The results of anal swab and environmental specimen tests in the GII.4[P16] outbreak showed curves in the CY5 channel and Ct≤38, indicating GII.4[P16] infection. The results are as follows... Figure 3 As shown.

[0047] (4) The nucleic acid detection results for norovirus GII.2[P16], GII.6[P7], and GII.7[P7] types showed no curves in the FAM, VIC, and CY5 channels, indicating that the primer combination of the present invention does not react with other types of norovirus nucleic acids. The results are as follows... Figure 4 As shown.

[0048] (5) Specificity verification results (influenza virus, enterovirus, rotavirus, and zaruzin virus): No curves were observed in the FAM, VIC, and CY5 channels, indicating that the primer combination of this invention does not react with other viral nucleic acids. Results are as follows: Figure 5 As shown.

[0049] (6) The comprehensive comparison results of sequencing typing detection and fluorescence typing detection. 82 GII group fluorescence positive nucleic acids were selected for detection in recent period. In the total number of typing, the number of suspected and the number of typing of different sample types, the fluorescence typing results were higher than the first generation sequencing typing results, and the number of untyped specimens was much lower than the first generation sequencing typing results, which indicated that the primer combination had excellent detection capability. The suspected was irregular in the sequencing map peak type in the first generation sequencing, and the sequence base variation degree was large; in the fluorescence typing, the Ct value was near 38, and the amplification curve was close to S type. The comprehensive comparison results are shown in Table 2. Figure 6

[0050] The above examples are only for illustrating the technical concept and characteristics of the present application, the purpose is to enable the person skilled in the art to understand the content of the present application and to implement it, and cannot limit the protection scope of the present application. Any equivalent changes or modifications made according to the spirit and essence of the present application shall be covered within the protection scope of the present application.​

Claims

1. A multiplex fluorescent genotyping detection primer probe set for Norovirus epidemic strains, characterized in that, The primer probe set comprises a primer pair and a probe for detecting Norovirus GII.17, GII.3 and GII.4, and the specific sequences of the primers and the probe are as follows: GII.17-F, i.e. GII.17 upstream primer, the nucleotide sequence of which is shown in SEQ ID NO: 1, and the specific nucleotide sequence is TCAAGGATGTACAATGGGTATGCT; GII.17-R, i.e. GII.17 downstream primer, the nucleotide sequence of which is shown in SEQ ID NO: 2, and the specific nucleotide sequence is TGGYTCAAGAGTCCTRACATCTACT; GII.17-Probe, i.e. GII.17 probe, the nucleotide sequence of which is shown in SEQ ID NO: 3, and the specific nucleotide sequence is TCTCCTGGCAGGGAACGCGTTCACT; GII.3-F, i.e. GII.3 upstream primer, the nucleotide sequence of which is shown in SEQ ID NO: 4, and the specific nucleotide sequence is TCGTCCCAGAGATCAACARTGA; GII.3-R, i.e. GII.3 downstream primer, the nucleotide sequence of which is shown in SEQ ID NO: 5, and the specific nucleotide sequence is TCAAAYCCACCTGCATAACCAT; GII.3-Probe, i.e. GII.3 probe, the nucleotide sequence of which is shown in SEQ ID NO: 6, and the specific nucleotide sequence is ACTCACCACCAGGTGCTTGCA; GII.4-F, i.e. GII.4 upstream primer, the nucleotide sequence of which is shown in SEQ ID NO: 7, and the specific nucleotide sequence is CAGAGGTCAACAATGAGGTTAT; GII.4-R, i.e. GII.4 downstream primer, the nucleotide sequence of which is shown in SEQ ID NO: 8, and the specific nucleotide sequence is CTCCATAGTATTTCACCTGGA; GII.4-Probe, i.e. GII.4 probe, the nucleotide sequence of which is shown in SEQ ID NO: 9, and the specific nucleotide sequence is TGTTGGCCCGCTACAGGTGC; The fluorescent probe is an oligonucleotide probe, the 5' end of which is connected with a fluorescent group, and the 3' end of which is connected with a quenching group.

2. The primer probe set according to claim 1, characterized in that, the 5' end of the probe for detecting GII.17 is connected with a fluorescent group FAM, and the 3' end is connected with a quenching group MGB; the 5' end of the probe for detecting GII.3 is connected with a fluorescent group VIC, and the 3' end is connected with a quenching group MGB; the 5' end of the probe for detecting GII.4 is connected with a fluorescent group CY5, and the 3' end is connected with a quenching group MGB.

3. A multiplex fluorescent genotyping test kit for Norovirus epidemic strains, characterized by, The primer probe set according to claim 1 or 2.

4. The kit of claim 3, wherein Further comprising a multiplex fluorescent detection reagent.

5. A method for preparing a primer probe working solution comprising the primer probe set according to claim 1 or 2, characterized in that, Comprising the following steps: 1) The synthesized dry powder of each primer and probe is prepared into a working concentration of 10 micromole / liter with RNAse-free water; 2) The respective primers and probes for detecting GII.17, GII.3 and GII.4 are respectively configured into three probe primer mixtures in the proportion of 2:2:1 (volume ratio) of upstream primer: downstream primer: probe; 3) Finally, the three probe primer mixtures are mixed in equal volume to prepare the primer probe working solution.

Citation Information

Patent Citations

  • Methods for detecting norovirus

    CN110073005A

  • Norovirus GI, GII and GIV nucleic acid genotyping reagent kit and detection method

    CN110273027A