RNA interference mediated therapy for neoplastic diseases

Abstract

A double-stranded small interfering RNA (siRNA) of at least 19 nucleotides in length, which targets the exons of the mRNA of the Trim28 gene (gene ID: ENST000000253024.10) wherein the exons are selected from the group consisting of exon 3, exon 4, exon 6 and exon 12, and wherein the double-stranded siRNA is capable of inhibiting the TRIM28 protein, as well as uses and compositions thereof.

Description

Technical Field

[0001] This invention relates to RNA interference-mediated therapy for primary and metastatic cancers. More specifically, this invention relates to siRNA-mediated gene silencing of TRIM28 as a therapy for oncological diseases. Background Technology

[0002] RNA interference (RNAi), a discovery of a natural mechanism controlling gene expression in mammalian cells, has recently led to the development of innovative approaches that effectively suppress target genes by delivering synthetic small interfering RNA (siRNA) molecules into host cells (1). siRNA selectively binds to messenger RNA (mRNA), preventing its translation into protein. As a result, target genes can be effectively silenced both in vitro and in vivo.

[0003] Due to its flexibility and effectiveness, the use of siRNA in therapy is increasingly seen as a promising treatment strategy, with siRNA drugs recently approved for clinical use or currently being evaluated for use in diseases such as cancer (i.e. glioblastoma) (2).

[0004] Colorectal cancer (CRC) is the third leading cause of cancer death worldwide and the second leading cause of cancer-related death (3). Over the past two decades, a deeper understanding of pathogenic mechanisms and risk factors has facilitated the development of surveillance programs and new treatment modalities. Nevertheless, CRC incidence continues to rise, and mortality remains unacceptably high (3). In the context of CRC, chronic inflammation is widely recognized as a key trigger for colorectal cancer development, but little is known about the molecular sensors that link chronic inflammatory signals to genomic instability, DNA mutations, and subsequent cellular transformation.

[0005] To develop more effective treatment strategies, many studies have evaluated the potential of using siRNA-based drugs to target key oncogenic signaling pathways (e.g., Hedgehog, JAK / STAT, TGFβ, EGFR / MAPK, Notch, PI3K, Wnt / βcatenin, NF-κB) (4, 5). This has yielded substantial preclinical in vitro and in vivo evidence that siRNA-mediated gene silencing can effectively inhibit tumor cell proliferation, survival, progression, invasion, and treatment resistance (4, 5).

[0006] To develop siRNA therapy, three central steps must be taken: (i) identifying cancer-related genes, (ii) designing and synthesizing specific siRNAs, and (iii) delivering the synthetic siRNAs to cancer cells to control for the absence of nonspecific off-target effects.

[0007] TRIM28, also known as KRAB (Kruppel-associated box)-associated protein (KAP1) or transcriptional intermediate factor 1β (TIF1β), is a pleiotropic protein involved in several aspects of dynamic chromatin organization and cell physiology, including gene expression, DNA repair, pluripotency, proliferation, differentiation, and survival (6). Due to this diverse range of functions, TRIM28 plays a complex role in cancer cell biology. Although it can prevent tumor transformation by maintaining epigenetic stability and promoting the repair of double-stranded DNA breaks (DSBs) (7, 8), TRIM28 is an oncogenic driver in most cancers. In fact, TRIM28 can promote cancer cell survival and proliferation by inhibiting p53-dependent apoptosis (9, 10), inhibiting the cell cycle-dependent kinase inhibitor p21 (11, 12), and inducing the mTOR signaling pathway (13, 14). Furthermore, in various cancer cell types, such as pancreatic (15), lung (16), breast (17), and ovarian (18) cancer cells, TRIM28 facilitates invasion and spread by supporting epithelial-mesenchymal transition (EMT) and cell migration. Finally, unsurprisingly, as a key steward of pluripotency in normal embryonic stem cells (19, 20) and induced pluripotent stem cells (21, 22), different studies have shown that TRIM28 overexpression also promotes the maintenance of cancer stem cells in different types of cancer (e.g., breast cancer, melanoma, and glioblastoma) (23–26). Therefore, TRIM28 is overexpressed in many human cancers (e.g., gastric cancer, colon cancer, pancreatic cancer, kidney cancer, ovarian cancer, melanoma, prostate cancer, testicular cancer, liver cancer, lymphoma, lung cancer, thyroid cancer, glioma), and its association with poorer clinical outcomes in cervical cancer, gastric cancer, ovarian cancer, glioma, hepatocellular carcinoma, colorectal cancer, breast cancer, and prostate cancer has been established (27). Recent gene expression analyses of the TCGA and GTEx databases have further solidified this conclusion, confirming that TRIM28 expression is higher in various tumor tissues than in normal tissues, and that higher TRIM28 expression is associated with poorer prognosis in various cancers (42). Additional histological analyses using specific antibodies targeting TRIM28 showed higher TRIM28 intensity levels at tumor lesion sites compared to healthy resection margins (human protein map).

[0008] In summary, this substantial evidence has facilitated the development of strategies aimed at inhibiting TRIM28 expression or activity for novel potential cancer therapies. Thus, the anti-TRIM28 selective nanobody NB237 recently demonstrated significant inhibition of glioblastoma cancer stem cell invasion in a zebrafish model (29), while TRIM28 knockdown in lung cancer cells not only inhibited tumorigenicity in vitro and in vivo but also increased the sensitivity of tumor cells to the chemotherapeutic agent 5-fluorouracil (28).

[0009] Therefore, drugs or small molecules that specifically inhibit TRIM28 expression or activity may represent valuable new cancer therapies.

[0010] Invention content and purpose The purpose of this invention is to provide a therapeutic agent that is effective in treating neoplastic diseases associated with overexpression of the TRIM28 protein encoded by the Trim28 gene.

[0011] According to the present invention, the above-mentioned objectives are achieved by the methods specifically mentioned in the following claims, which should be understood as forming an integral part of this specification.

[0012] This disclosure discloses a therapeutic agent for treating oncological diseases associated with TRIM28 protein overexpression and / or its elevated phosphorylation state.

[0013] In one embodiment, this specification provides a double-stranded small interfering RNA (siRNA) of at least 19 nucleotides in length that targets exons of the Trim28 gene mRNA (gene ID: ENST000000253024.10), wherein the exons are selected from the group consisting of exon 3, exon 4, exon 6 and exon 12, and wherein the double-stranded siRNA is capable of inhibiting the TRIM28 protein, thereby restoring the normal expression level and / or activity of the TRIM28 protein.

[0014] In one embodiment, this specification discloses the medical use of a double-stranded small interfering RNA (siRNA) targeting Trim28 gene mRNA and a pharmaceutical composition comprising at least one double-stranded small interfering RNA (siRNA) targeting Trim28 gene mRNA. Attached Figure Description

[0015] The invention will now be described by way of example only, with reference to the disclosed drawings, in which: - Figure 1The Trim28 protein was identified by mass spectrometry as a target of an inflammatory signaling cascade that functions in different polarized forms of macrophages, including tumor-associated macrophages (TAMs). The phosphoproteomics of TAMs isolated from mouse MN / MCA1 fibrosarcoma were investigated using mass spectrometry-based phosphoproteomics and compared with resting (ctr), M1 (IFNγ / LPS, 30 min), and M2 (IL-4, 8 h) polarized macrophages. Figure 1 The obtained data (Table 1) report 24 proteins with high phosphorylation levels. In particular, Trim28 was the number one phosphorylated protein in M1 polarized macrophages and TAMs, with the highest phosphorylation level of Ser473 (S473p) (Table 1, red arrow). These values ​​represent the average of two biological replicates. These data were also confirmed by Western blot analysis. Figure 1 B. Western blot. In short, PEC was either untreated (CTR) or stimulated with INFγ+LPS for 30 minutes (M1 polarization activation) or stimulated with IL-4 for 8 hours (M2 polarization activation). TAM was isolated from MN / MCA1 fibrosarcoma. 30 μg of total protein extract was analyzed by Western blot targeting Trim28 S473p and TRIM28. Actin was used as a loading control.

[0016] - Figure 2 Gene ablation of the Trim28 gene in intestinal epithelial cells inhibited tumor development in a mouse model of colitis-associated cancer (CAC). Figure 2 A) Illustration of the AOM / DSS model treatment protocol. To simulate the development of colitis-associated cancer (CAC), we utilized an azomethane (AOM) / dextrose sulfate (DSS) mouse model (29). Briefly, Trim28 Villin-Cre mice (carrying conditionally ablated Trim28 genes only on intestinal epithelial cells) and Trim28 flox / flox mice (relative to Trim28 functionally normal control mice) were treated with a single intraperitoneal injection of AOM (10 mg / kg / mouse) (a potent mutagen) followed by three rounds of DSS treatment, a sucrose-based sugar characterized by high inflammatory potential. Each round of DSS treatment consisted of 5 days of drinking water supplemented with 2.5% DSS, followed by 16 days of free access to regular water. Mice were sacrificed at the end of the experiment, and the colon was dissected excised. Figure 2 B reports representative images of colonic lesions detected in both experimental groups, where the colon was opened longitudinally and polyps were counted. Figure 2B). Data are presented as mean ± SEM, two-tailed t-test, n=7 (for each experimental group, n=8 Trim28Villin-Cre mice and n=8 Trim28flox / flox mice); Value ≤ 0.05; Value ≤ 0.01; Value ≤ 0.001; (Value ≤ 0.0001).

[0017] - Figure 3 The effectiveness of selected Trim28-targeting siRNAs (siRNA1-siRNA2-siRNA3-siRNA4) in downregulating TRIM28 was investigated. Screening tests were performed against four selected human siRNA-Trim28 sequences (siRNA1-siRNA2-siRNA3-siRNA4) to verify their downregulation efficiency on Trim28 mRNA levels. The obtained values ​​were compared with those obtained after treatment with a siRNA scrambled control. At two predetermined time points (24h and 48h), 2.5 μg of siRNA and the scrambled control were transfected into human colorectal adenocarcinoma Caco2 cells, respectively. Real-time PCR was performed to verify the downregulation efficiency of the Trim28 transcript. Figure 3 A), and TRIM28 protein levels were assessed by Western blot analysis. Figure 3 B). For 48 h samples, TRIM28 expression in 30 μg total protein extract was analyzed by Western blot. β-actin was used as a loading control. Values ​​represent mean ± SEM (n=3); Value ≤ 0.05; Value ≤ 0.01; Value ≤ 0.001; (Value ≤ 0.0001).

[0018] - Figure 4 Characterization of the inhibitory effect of siRNA3 (S3) in the human colorectal cancer cell line Caco2. Caco2 cells were transfected with liposomes loaded with 2.5 μg siRNA3 or control siRNA (randomized). The TRIM28 mRNA level was determined by real-time PCR at three predetermined time points (24h-48h-72h). Figure 4 A) and Western blotting of relative protein levels at 48-72 h post-transfection (A) Figure 4B) Determine the inhibitory activity of siRNA3. At 48h and 72h time points, TRIM28 expression in 30 μg of total protein extract was analyzed by Western blotting, with actin used as a loading control. The proliferation of Caco2 tumor cells treated with siRNA3 or a control randomized sequence was further analyzed by flow cytometry. Figure 4 C) Apoptosis and necrosis Figure 4 DE activity and at 24h ( Figure 4 F), 48h Figure 4 G) and 72h Figure 4 H) represents the progression stage in the cell cycle. Values ​​represent mean ± SEM (n=3); Value ≤ 0.05; Value ≤ 0.01; Value ≤ 0.001; (Value ≤ 0.0001).

[0019] - Figure 5 Characterization of the inhibitory effect of siRNA3 (S3) in the human colorectal cancer metastatic cell line SW620. SW620 cells were transfected with liposomes loaded with 2.5 μg siRNA3 or control siRNA (randomized). TRIM28 mRNA levels were determined by real-time PCR at 24h-48h-72h. Figure 5 A) and Western blotting of relative protein levels at 48-72 h post-transfection (A) Figure 5 B) Determine the inhibitory activity of siRNA3. TRIM28 expression in 30 μg of total protein extract was analyzed by Western blotting at 48h and 72h time points. Actin was used as a loading control. The proliferation of SW620 tumor cells treated with siRNA3 or a control randomized sequence was further analyzed by flow cytometry. Figure 5 C) Apoptosis and necrosis Figure 5 DE activity and at 24h ( Figure 5 F), 48h Figure 5 G) and 72h Figure 5 H) represents the progression stage in the cell cycle. Values ​​represent mean ± SEM (n=3); Value ≤ 0.05; Value ≤ 0.01; Value ≤ 0.001; (Value ≤ 0.0001).

[0020] - Figure 6 The antitumor activity of siRNA Trim28 treatment in a mouse model of colitis-associated cancer (CAC). Figure 6A) Treatment protocol using AOM / DSS in a CAC mouse model (29). Wild-type male mice were treated with a single intraperitoneal injection of AOM (a potent mutagen), followed by three rounds of treatment with sodium dextran sulfate (DSS), a sugar synthesized from sucrose and characterized by high inflammatory potential. Each round of treatment consisted of adding 2.5% DSS to drinking water for 5 days, followed by free access to regular water for 16 days. Starting from the 3rd cycle of DSS, mice were treated three times a week with a rectal dose of 5 μg of mouse Trim28 siRNA or a scrambled control. At the end of the experiment, mice were sacrificed and the colon was dissected. Figure 6 B. siRNA inhibits tumor development in a mouse model of colitis-associated cancer (CAC). Figure 6 C reports representative images of tumor lesions in cross-sections of the colon detected by hematoxylin and eosin in two experimental groups. Data are presented as mean ± SEM, two-tailed t-test (n=4 mice for each experiment); Value ≤ 0.05; Value ≤ 0.01; Value ≤ 0.001; (Value ≤ 0.0001).

[0021] - Figure 7 The anti-metastasis effect of Trim28 treatment. Figure 7 A) MC38pLuc colorectal cancer cells (300,000 cells / mouse), a mouse colorectal cancer cell line with a high metastatic potential, were injected into the spleens of C57BL76 / J mice. Next, the mice were divided into two experimental groups and administered intravenously (three times a week for four weeks) liposomes loaded with 25 μg Trim28 mouse siRNA or a disordered control, respectively. At the end of the experiment, the mice were sacrificed, and the livers of both groups were collected and analyzed for metastasis formation as a target region of interest (ROI) assessment. Figure 7 BC). Bone marrow cells and lymphocytes in blood and tumor tissues were evaluated. In short, 1,000,000 cells were stained with bone marrow (i.e., Ly6C, Ly6G, and F4 / 80) or lymphocyte (i.e., CD8, CD4, and CD19) markers and analyzed by flow cytometry. Figure 7 DE). In addition, the metastatic potential of MC38pLuc was confirmed by flow cytometry, and key markers characterizing stem and mesenchymal phenotypes (Vim = vimentin; Lgr5 = G protein-coupled receptor 5 rich in leucine repeats; and E-Cadh = E-cadherin) were evaluated to identify pro-metastatic tumor cells with epithelial-mesenchymal transition (30). Figure 7 E, bottom). Data are presented as mean ± SEM, two-tailed t-test (n=5 mice / group); Value ≤ 0.05; Value ≤ 0.01; Value ≤ 0.001; (Value ≤ 0.0001).

[0022] - Figure 8 Antitumor effect of siRNA-mediated Trim28 downregulation in a mouse mesothelioma orthotopic model. (Figure R1A) Mouse mesothelioma AB22-pLuc cell line (50,000 cells / mouse) was injected into the sternum of female Balb\c mice. Mice were divided into two experimental groups and intravenously administered (three times a week for 3 weeks) liposomes loaded with 25 μg of Trim28 mouse siRNA or a related disordered siRNA control. Tumor growth was assessed at 10, 14, and 21 days after the start of treatment, and the tumor response area was assessed using an in vivo imaging instrument (IVIS Illumina III). Figure 8 AB). At the end of the experiment, mice were euthanized and lung and pleural tumors were collected, and the number of tumor lesions was analyzed visually. Figure 8 CD). Data is presented as mean ± SEM; ( Value ≤ 0.05; Value ≤ 0.01; Value ≤ 0.001; (Value ≤ 0.0001).

[0023] - Figure 9 Validation of human TRIM28 gene downregulation and cell survival analysis. The human pancreatic cancer cell line PANC1 was transfected with liposomes loaded with 2.5 μg of siRNA targeting exons 3 (siRNA1), 6 (siRNA2), and 12 (siRNA3) of the human TRIM28 gene, or a scrambled siRNA control. The inhibitory activity of all siRNAs was assessed by real-time PCR to determine the TRIM28 mRNA levels at three predetermined time points (24h-48h-72h). Figure 9 A), and the relative protein expression level determined by flow cytometry at (48h-72h) Figure 9 B). Furthermore, the survival rate of PANC1-transfected cells at 24h–48h–72h was assessed, expressed as the absolute number of viable cells (B). Figure 9 C). The value represents the mean ± SEM (n=3) (AB); Value ≤ 0.05; Value ≤ 0.01; Value ≤ 0.001; Value ≤ 0.0001). For this purpose, human siRNA4, which shares co-interference activity against exon 3 of the TRIM28 gene with siRNA1, was used. Figure 1 ) has been replaced by siRNA8 because the latter has significant interference activity with exon 4.

[0024] - Figure 10 The effects of TRIM28 siRNA on apoptosis / necrosis and the expression level of the cell cycle inhibitor p21 (a cyclin-dependent kinase inhibitor) in PANC1 tumor cells. PANC1 cell lines were transfected with liposomes loaded with 2.5 μg of siRNA targeting exons 3, 4, 6, and 12, or a scrambled control. Flow cytometry was used to target the expression levels of p21 at 24 h. Figure 10 A) and 48 h ( Figure 10 The apoptosis-necrosis activity of B) was analyzed in PANC1 tumor cells. Furthermore, the protein expression of p21, a cyclin-dependent kinase inhibitor involved in cell cycle arrest, was detected by flow cytometry in transfected cells. Figure 10 C). The value represents the mean ± SEM (n=3); Value ≤ 0.05; Value ≤ 0.01; Value ≤ 0.001; Value ≤ 0.0001). Notably, siRNA3 targeting exon 12 significantly reduced cell viability and enhanced early apoptotic cell death (Figures R3A and B), and also showed a higher induction effect on the cyclin-dependent kinase inhibitor p21. Figure 10 C; 48h).

[0025] - Figure 11 The effect of siRNA-mediated TRIM28 downregulation on the survival of human hepatocellular carcinoma cells HepG2. HepG2 hepatocellular carcinoma cells were transfected with liposomes loaded with 2.5 μg of siRNA targeting exons 3, 4, 6, and 12 or a control scrambled siRNA. Cells were isolated and treated by real-time PCR at three predetermined time points (24h-48h-72h). Figure 11 A) Determine TRIM28 mRNA levels and protein expression levels by flow cytometry at 48 h and 72 h post-transfection. Figure 11 B) To evaluate the inhibitory activity of the tested siRNA. Further analysis was performed on the cell viability of HepG2 tumor cells treated with siRNAs targeting exons 3, 4, 6, and 12 or with a scrambled control, assessed by evaluating the absolute number of viable cells (B). Figure 11 C). Cell viability was assessed at 24h-48h-72h using crystal violet assay. Figure 11 D). The value represents the mean ± SEM (n=3); Value ≤ 0.05; Value ≤ 0.01; Value ≤ 0.001; Value ≤ 0.0001). Notably, siRNA targeting exon 12 significantly reduced cell survival (i.e., Figure 11 D, 72 h).

[0026] - Figure 12 The effect of selected siRNAs on the death and proliferation of HepG2 hepatocellular carcinoma cells. HepG2 cell lines were transfected with liposomes loaded with 2.5 μg of siRNAs targeting exons 3, 4, 6, and 12, or with a scrambled control. Cells were cultured by flow cytometry for 24 hours. Figure 12 A) 48 hours ( Figure 12 B) and 72 hours ( Figure 12 C) Analysis of HepG2 tumor cells regarding their survival and apoptosis-necrosis status. Furthermore, p21 protein expression was determined by flow cytometry. Figure 12 D). Flow cytometry was used to detect the proliferative activity of siRNA-transfected cells at predetermined time points, and the cell proliferation marker Ki67 was estimated. Figure 12 E). The value represents the mean ± SEM (n=3); Value ≤ 0.05; Value ≤ 0.01; Value ≤ 0.001; Value ≤ 0.0001). In summary, siRNA3 targeting exon 12 showed a higher ability to induce apoptotic cell death ( ). Figure 12 C), which is related to increased p21 expression (i.e., Figure 12 D, 48h) and Ki67 expression decreased (i.e., Figure 12 E, 48h) related.

[0027] - Figure 13 To assess the contribution of TRIM28 to the DNA damage response, MC38 TRIM28 WT and TRIM28 KO cells were pretreated with olaparib (10 μM) for 4 h to induce inhibition of poly-ADP-ribose polymerase (PARP), thereby inhibiting the DNA repair process, or left untreated (43). Subsequently, the cells were administered the carcinogen etoposide for 1 h to induce DNA damage. After 2 h and 3 h, cells were collected and the expression of DNA damage γH2AX molecular markers and the expression level of the tumor suppressor gene p53 were analyzed by flow cytometry (FCM). Figure 13 AB). Human pancreatic cancer cell line PANC1 was transfected with siRNA3 or a randomized control. Figure 13CF) for 48h. Subsequently, cells were pretreated with olaparib (10 μM) for 4h, or left untreated. Next, PANC1 cells were administered etoposide for 1h to induce DNA damage. At 2h ( Figure 13 C and E) and 3h ( Figure 13 After D and F, cells were collected and the expression levels of γH2AX and p53 were assessed by flow cytometry. Value ≤ 0.05; Value ≤ 0.01; Value ≤ 0.001; (Value ≤ 0.0001).

[0028] - Figure 14 Evaluation of the antitumor effect of Trim28 downregulation in a pancreatic cancer xenograft model. Human pancreatic cancer cells PANC1 (5 x 10⁻⁶ cells / year) were subcutaneously injected into male Swiss nude mice. 6 (cells / mouse) Figure 14 A). Mice were divided into three experimental groups and administered intravenously (three times a week for 3 weeks) 25 μg of siRNA3, siRNA1, and a disordered control loaded with liposomes, respectively. Figure 14 AB). Monitoring tumor growth from the start of treatment ( Figure 14 C). At the end of the experiment, the mice were euthanized, the tumors were dissected and weighed. Figure 14 BD). The tumor was embedded in paraffin and collected for further histological evaluation. Value ≤ 0.05; Value ≤ 0.01; Value ≤ 0.001; (Value ≤ 0.0001). Detailed Implementation

[0029] The present invention will now be described in detail by way of non-limiting examples with reference to RNA interference-mediated therapy, which uses cellular and in vivo models that reproduce the tumor pathology of colorectal cancer associated with TRIM28 alterations. However, the RNA interference-mediated therapy described herein can be used to treat other cancerous diseases associated with abnormalities in the TRIM28 protein encoded by the Trim28 gene.

[0030] In the following description, numerous specific details are set forth to provide a full understanding of the embodiments. Embodiments may be implemented without one or more of these specific details, or by utilizing other methods, components, materials, etc. In other instances, well-known structures, materials, or operations are not shown or described in detail to avoid obscuring aspects of the embodiments.

[0031] Throughout this specification, the terms "one embodiment" or "implementation" refer to a specific feature, structure, or characteristic described in relation to that embodiment, which is included in at least one embodiment. Therefore, the terms "in one embodiment" or "in an embodiment" appearing in various places throughout this specification do not necessarily refer to the same embodiment. Furthermore, specific features, structures, or characteristics may be combined in any suitable manner in one or more embodiments.

[0032] The titles provided in this document are for convenience only and do not explain the scope or meaning of the implementation methods.

[0033] In one embodiment, the present invention relates to a double-stranded small interfering RNA (siRNA) of at least 19 nucleotides in length that targets an exon of the Trim28 gene mRNA having the nucleotide sequence shown in ENST000000253024.10, wherein the exon is selected from the group consisting of exon 3, exon 4, exon 6 and exon 12, and wherein the double-stranded siRNA is capable of inhibiting the TRIM28 protein, thereby restoring the normal expression level and / or activity of the TRIM28 protein.

[0034] In one embodiment, the double-stranded siRNA is capable of inducing selective degradation of Trim28 transcripts containing one of exons 3, 4, 6, and 12.

[0035] In one embodiment, the double-stranded siRNA is capable of inducing selective degradation of one of exon 3, exon 4, exon 6, or exon 12 of the Trim28 transcript.

[0036] In one embodiment, the exons are selected from the group consisting of exon 4, exon 6, and exon 12.

[0037] Our comparative study of siRNA activity targeting TRIM28 showed that the use of siRNA targeting exon 12 of TRIM28 (i.e., siRNA3) offered a significant advantage in functionally silencing TRIM28 activity. This was evidenced by the consistent induction of higher cell death in various tumor cell lines (PANC1 and HepG2), which was associated with higher expression of cell cycle inhibitors (i.e., the cyclin-dependent kinase inhibitor p21).

[0038] In one embodiment, the exon is exon 12.

[0039] In one embodiment, the length of the double-stranded siRNA is between 19 and 29 nucleotides, preferably between 19 and 23 nucleotides, and more preferably between 19 and 21 nucleotides.

[0040] In one embodiment, at least one strand of the double-stranded siRNA has a protruding end at the 3' end.

[0041] In one embodiment, at least one strand of the double-stranded siRNA has a protrusion at its 3' end, wherein the protrusion comprises at least one deoxyribosyl thymine.

[0042] In one embodiment, the double-stranded siRNA has a GC base content of less than 52%.

[0043] In one embodiment, the double-stranded siRNA has a GC base content of more than 36%.

[0044] In one embodiment, the double-stranded siRNA has a GC base content greater than 36% and less than 52%.

[0045] In one embodiment, the melting temperature of at least one strand of the double-stranded siRNA is below 64°C.

[0046] In one embodiment, the melting temperature of each strand of the double-stranded siRNA is below 64 °C.

[0047] In one embodiment, the sense strand of the double-stranded siRNA has a nucleotide sequence selected from SEQ ID No.: 1 to 4 and 21, wherein the antisense strand has a sequence that is complementary to and opposite to its antisense strand.

[0048] In one embodiment, the sense strand of the double-stranded siRNA has a nucleotide sequence selected from SEQ ID No.: 2, 3 and 21, preferably, the sense strand of the double-stranded siRNA has a nucleotide sequence as shown in SEQ ID No.: 21, wherein the antisense strand has a sequence that is complementary to and opposite to its antisense strand.

[0049] In one embodiment, the present invention relates to double-stranded siRNA as disclosed above for the treatment and / or prevention of neoplastic diseases associated with abnormalities of the TRIM28 protein encoded by the Trim28 gene.

[0050] In one embodiment, the TRIM28 gene-encoded protein TRIM28 abnormality is the upregulation and / or hyperphosphorylation of the protein TRIM28 in cancerous tissue compared to normal, healthy adjacent tissues.

[0051] In one embodiment, the neoplastic disease is primary cancer and / or metastatic cancer.

[0052] In one embodiment, the neoplastic disease is selected from gastric cancer, pancreatic cancer, kidney cancer, ovarian cancer, melanoma, prostate cancer, testicular cancer, liver cancer, lymphoma, lung cancer, thyroid cancer, glioma, cervical cancer, gastric cancer, ovarian cancer, glioma, colorectal cancer, breast cancer, and prostate cancer.

[0053] In one embodiment, the neoplastic disease is primary and / or metastatic colorectal cancer.

[0054] In one implementation, the double-stranded siRNA is used to prevent the development of colitis-related cancers.

[0055] In one embodiment, the double-stranded siRNA is used in combination therapy with a poly-ADP-ribose polymerase (PARP) inhibitor for the treatment of neoplastic diseases. PARP inhibitors, such as olaparib, have been shown to significantly prolong survival in patients with cancers such as breast and ovarian cancer (49).

[0056] As discussed above, poly(ADP-ribose) polymerase 1 (PARP1) is an enzyme that plays a crucial role in recognizing and repairing DNA damage. PARP inhibitors (i.e., olaparib) are known to induce “synthetic lethality” in patients with homologous recombination deficiency (HRD) and BRCA mutations. However, PARP inhibitors (i.e., olaparib) also induce a molecular mechanism of therapy resistance in 40% of patients (45). Building on this, gene silencing mediated by TRIM28 siRNA may offer an advantage and treatment option for these patients, whether as monotherapy or in combination therapy, because it works through a mechanism different from that of PARP inhibitors. Indeed, the combination of double-stranded TRIM28 siRNA with PARP inhibitors has enhanced interference with the DNA damage repair activity of tumor cells, suggesting a novel and possible combination strategy for improving responses in cancer patients.

[0057] In one embodiment, the present invention relates to a pharmaceutical composition comprising at least one double-stranded siRNA as disclosed above and a pharmaceutically acceptable excipient.

[0058] In one embodiment, the pharmaceutical composition is suitable for administration via subcutaneous (sc), intramuscular (im), and intravenous routes (31-33).

[0059] In one embodiment, the present invention relates to a pharmaceutical composition comprising at least one double-stranded siRNA as disclosed above and a pharmaceutically acceptable excipient for treating neoplastic diseases associated with abnormalities of the TRIM28 protein encoded by the Trim28 gene.

[0060] The present invention also discloses a method for treating and / or preventing neoplastic diseases associated with abnormalities of the TRIM28 protein encoded by the Trim28 gene, comprising administering to a patient in need one or more siRNAs as disclosed above in an amount sufficient to perform the treatment, wherein the one or more siRNAs induce selective degradation of the Trim28 transcript comprising one of exons 3, 4, 6 and 12.

[0061] This invention relates to a therapeutic agent for treating cancer associated with abnormal upregulation or activation of the TRIM28 protein, wherein the therapeutic agent comprises one or more siRNAs targeting TRIM28 transcripts, the TRIM28 transcripts involving exons 4, 6, and 12 of the Trim28 gene, preferably exon 12.

[0062] Our comparative studies showed that siRNAs targeting exons 4, 6, and 12 generally exhibited better antitumor activity than siRNAs targeting exon 3. In particular, siRNA targeting exon 12 of TRIM28 (i.e., siRNA3) consistently showed strong induction of cell death in various tumor cell lines (PANC1 and HepG2), which was associated with increased expression of cell cycle inhibitors (i.e., the cyclin-dependent kinase inhibitor p21). This observation suggests that silencing TRIM28 with siRNAs targeting exons 4, 6, and / or 12 may represent a novel and effective antitumor approach that can interfere with tumor cell survival and proliferation. siRNA3 targeting exon 12 appeared to have the best antitumor activity. Our in vivo studies also showed that the antitumor activity of TRIM28 siRNA was best in all the preclinical models used (i.e., AOM / DSS CAC, colorectal cancer / MC38 metastatic model), and human siRNA3 strongly inhibited the progression of human pancreatic cancer in xenograft models.

[0063] Some embodiments of the present invention are disclosed below. This description should not be construed as limiting the scope of protection of this application, but is for illustrative purposes only.

[0064] This therapeutic siRNA is characterized by a sense strand containing at least 19 consecutive mRNA bases corresponding to exon 3 (ID:ENSE00003563013), exon 4 (ID:ENSE00003542576), exon 6 (ID:ENSE00003654842), or exon 12 (ID:ENSE00003587053) of TRIM28, and an antisense strand containing complementary and reverse sequences. Both the sense and antisense strands are characterized by a 3'-OH overhang (deoxyribosylthymine, dT) [dT-dT] to protect the molecule from RNase degradation. Furthermore, each strand is characterized by a melting temperature not exceeding 64°C, calculated using the following mathematical formula: Tm = [4(G + C) + 2(A + T)]°C. In addition, the GC base content ranges from 36% to 52% as a percentage in each siRNA backbone.

[0065] The complete human Trim28 gene sequence is identified by the following ID: ENSG00000130726. Other Trim28 transcript isoforms have the following nucleotide sequences: ID: ENST00000341753.10; ID: ENST00000597136.1; ID: ENST00000594806.5; ID: ENST00000593582.5; ID: ENST00000597968.1; ID: ENST000000253024.10. Sequence ID: ENST000000253024.10 is the largest in terms of base pairs and produces the largest encoded protein (835 aa).

[0066] Double-stranded siRNA does not bind to the intron region of the Trim28 gene sequence.

[0067] The sense and antisense strands of the double-stranded siRNA disclosed in this paper have the nucleotide sequences shown in Table 1.

[0068] Table 1

[0069] Cancers associated with altered (overexpression) of the TRIM28 gene-encoded protein, which may benefit from the administration of one or more siRNAs according to this specification, include: gastric cancer, pancreatic cancer, kidney cancer, ovarian cancer, melanoma, prostate cancer, testicular cancer, liver cancer, lymphoma, lung cancer, thyroid cancer, glioma, cervical cancer, gastric cancer, ovarian cancer, glioma, colorectal cancer, breast cancer, and prostate cancer.

[0070] This disclosure demonstrates the feasibility of siRNA-based gene therapy to achieve posttranscriptional gene silencing of Trim28 transcripts associated with exons 3, 4, 6, and 12.

[0071] A set of siRNAs targeting these exons' mRNAs was designed and detected in Caco2 cells, primary human adenocarcinoma cells, and SW620 human colorectal cancer metastatic cells using liposome nanocarrier transfection. Furthermore, siRNA3, which appeared to exhibit greater silencing activity, was detected in human metastatic colon cancer cell lines, and the impact of its silencing on regulatory biological activity was assessed. The silencing capacity of the five siRNAs was analyzed by assessing transcript expression using RT-PCR. Further screening using Western blotting investigated and confirmed the downregulation of TRIM28 protein.

[0072] In this specification, the inventors devised a novel method for restoring normal expression levels and activity of the TRIM28 protein. This method is based on the use of siRNAs selectively designed for exons 3, 4, 6, and 12, and is capable of causing degradation of the relevant transcripts.

[0073] These siRNAs offer therapeutic benefits to patients with various cancer pathologies exhibiting TRIM28 upregulation and hyperphosphorylation in their tumors. The five siRNAs evaluated here have the nucleotide sequences shown in Table 1. Table 2 provides further characterization of the siRNA sequences.

[0074] Table 2

[0075] Materials and methods siRNA The siRNAs used in this experiment were designed according to four exon sequences: 3, 4, 6, and 12. Each sequence was produced by Merck (United Kingdom). All siRNAs were produced in powder form, desalted, and purified to the required level. After resuspending in water, the siRNAs were aliquoted and stored at -80°C.

[0076] siRNA1 (exon 3): Chain of Justice: 5' GCACTAGCTGTGAGGATAA dTdT3' (SEQ ID No.: 11) Antisense chain: 5' TTATCCTCACAGCTAGTGC dTdT3' (SEQ ID No.: 12); siRNA2 (exon 6): Chain of Justice: 5' GTGCAAGTGGATGTCAAGA dTdT3' (SEQ ID No.: 13) Antisense chain: 5' TCTTGACATCCACTTGCAC dTdT3' (SEQ ID No.: 14); siRNA3 (exon 12): Chain of Justice: 5' GTACCACTGAGGACTACAA dTdT3' (SEQ ID No.: 15) Antisense chain: 5' TTGTAGTCCTCAGTGGTAC dTdT3' (SEQ ID No.: 16); siRNA4 (exon 3): Chain of Justice: 5' GTACACCAAGGACCATACT dTdT3' (SEQ ID No.: 17) Antisense chain: 5' AGTATGGTCCTTGGTGTAC dTdT3' (SEQ ID No.: 18).

[0077] siRNA8 (exon 4): Chain of Justice: 5' GATGGTGAACGTACTGTCTAT dTdT 3' (SEQ ID No.: 23) Antisense chain: 5' ATAGACAGTACGTTCACCATC dTdT 3' (SEQ ID No.: 24).

[0078] All generated siRNAs are characterized by the presence of a protrusion consisting of two deoxyribosyl thymine monophosphates (dT), which are introduced into the 3' end to improve the intracellular stability and efficiency of the siRNA.

[0079] Mouse Trim28 siRNA: Chain of Justice: 5' GACCTCGTCTAGCTTCACCTA dTdT 3' (SEQ ID No.: 19) Antonym: 5' TAGGTGAAGCTAGACGAGGTC dTdT 3' (SEQ ID No.: 20) Randomized control: The MISSION® siRNA universal negative control was used as a randomized control for each siRNA sequence (Merck, Milan, Italy).

[0080] Caco2 cell line (ATCC; HTB-37) The Caco2 cell line used for transfection experiments is a human colorectal cancer cell line derived from primary adenocarcinoma. The transfection efficiency (50% to 75%) in this cell line is relatively higher than other primary colorectal cancer cell lines. Therefore, this cell line was chosen to test the effectiveness of siRNA on endogenous selected exon transcripts and was used up to passage 35 in culture. Cells were maintained at 37°C and 5% CO2 in DMEM high-glucose complete medium (Euroclone) containing 10% fetal bovine serum (FBS) and free of antibiotics.

[0081] SW620 cell line (ATCC; CCL-227) The metastatic human colorectal cancer cell line SW620 was used to confirm the efficiency of siRNA3, with transfection efficiency ranging from 50% to 75%. Cells were maintained at 37°C and 5% CO2 in PRMI complete medium (Euroclone) containing 10% fetal bovine serum (FBS) and free of antibiotics, and were used up to the 35th passage in culture.

[0082] PANC1 cell line (ATCC; CRL-1469) The human pancreatic cancer cell line PANC1(48) was used to confirm the efficiency of siRNA-mediated Trim28 downregulation, with transfection efficiency ranging from 50% to 75%. Furthermore, in vitro and in vivo experiments were performed on the PANC1 cell line to examine the effects of Trim28 silencing on pancreatic cancer cells and their growth in vivo. PANC1 cells were cultured at 37°C and 5% CO2 in DMEM high-glucose complete medium (Euroclone) supplemented with 10% fetal bovine serum (FBS), antibiotics, and L-glutamine, and used up to passage 35.

[0083] HepG2 cell line (ATCC; HB-8065) The HepG2 human hepatocellular carcinoma cell line was used to confirm the efficiency of siRNA-mediated Trim28 downregulation, with transfection efficiency ranging from 50% to 75%. Furthermore, in vitro experiments were performed on the HepG2 cell line to examine the effect of Trim28 silencing on hepatocellular carcinoma cells. The HepG2 cell line was cultured at 37°C in 5% CO2 in RPMI complete medium (Euroclone) containing 10% fetal bovine serum (FBS) and supplemented with antibiotics, and used up to the 35th passage.

[0084] AB22-pLucipherase cell line The mouse mesothelioma cell line AB22 was kindly provided by Professor Paola Allavena (Humanitas Research Institute) and was used in an in vivo mouse orthotopic model of mesothelioma to verify the effect of Trim28 siRNA-mediated silencing on tumor growth. The mouse mesothelioma cell line AB22 was previously generated in BALB / c mice by intraperitoneal injection of crocidolite asbestos fibers (46). The AB22 cell line was cultured at 37°C and 5% CO2 in RPMI complete medium (Euroclone) containing 10% fetal bovine serum (FBS) and supplemented with antibiotics, and used up to passage 35.

[0085] MC38-p luciferase and MC38-p luciferase knockout (MC38 TRIM28 KO) cell lines The MC38-p luciferase mouse colorectal cancer cell line (47), kindly provided by Professor Maria Rescigno (Humanitas Research Institute), was used in an in vivo mouse model of colorectal cancer orthotopic metastasis to validate the effect of Trim28 siRNA-mediated silencing on tumor growth and dissemination. MC38-p luciferase TRIM28 knockout cells were generated using CrispR / Cas9 technology and used to assess the effect of TRIM28 ablation on DNA damage response. Both cell lines were cultured at 37°C and 5% CO2 in RPMI complete medium (Euroclone) containing 10% fetal bovine serum (FBS) and supplemented with antibiotics, and used up to passage 35.

[0086] Treatment of endogenous conditions using siRNA 1. Using siRNA for in vitro and in vivo cell transfection All cell lines using siRNA were transfected and in vivo experiments were performed using Lipofectamine 3000 lipid transfection reagent (Life Technologies-Invitrogen, Monza, Italy; #L3000-008).

[0087] 1.1. Preparation of cells for in vivo experiments The day before the experiment, 360,000 cells were seeded in 2 mL of complete culture medium in 6-well plates at 37°C and 5% CO2. The cells were then left to adhere for 24 hours.

[0088] 1.2. In vitro transfection of siRNA The day before transfection, according to the manufacturer's instructions, Caco2 and SW620 cell lines were plated at 300,000 cells / well (for 24 h), 200,000 cells / well (for 48 h), and 180,000 cells / well (for 72 h) to ensure confluence between 40-70% on the day of transfection.

[0089] One day before transfection, PANC-1 and Hep G2 cell lines were seeded in 6-well plates at 180,000 cells / well for 24h, 48h, and 72h.

[0090] 1.2.1. Perform transfection according to the manufacturer's instructions. For 250 µl of phenol red-free Opti-MEM medium (Life Technologies-Gibco, Monza, Italy; #11058-021), use 3.75 µl of Lipofectamine 3000 (catalog number: L300000, ThermoFisher) and 2.5 μg of siRNA per well, with a final volume of 2 ml DMEM or RPMI complete medium.

[0091] 1.2.2. As a control, cells were transfected with Lipofectamine 3000 (catalog number: L300000, ThermoFisher), which is a universal negative control loaded with MISSION® siRNA.

[0092] 1.2.3. After transfection, cells were incubated at 37°C in 5% CO2 for 6 h. After 6 h of incubation, the medium containing Lipofectamine was aspirated from each well, washed with 2 mL of saline, and replaced with fresh DMEM or RPMI complete medium.

[0093] 1.2.4. At predetermined time points (24h-48h-72h), transfected cells were washed with physiological saline and dissociated with a trypsin-EDTA mixture (EuroClone).

[0094] PANC-1 and Hep G2 cells were collected and manually counted using a hemocytometer; cell viability was assessed by trypan blue exclusion staining.

[0095] In addition, cell viability of the Hep G2 cell line was assessed by crystal violet staining. Briefly, at predetermined time points (24h-48h-72h), transfected cells were washed with physiological saline and stained with 0.5% crystal violet solution for 20 minutes at room temperature. At the end of incubation, cells were washed with tap water and the plates were air-dried for at least 2 hours. Methanol was then added to the wells and the plates were incubated on a Bech Rocket at room temperature for 20 minutes. At the end of incubation, the optical density (OD) at 570 nm was measured using an Agilent BioTek Synergy reader. 570 ).

[0096] According to the manufacturer's instructions, Trizol reagent (Life Technologies, Monza, Italy; #15596-026) was used for RNA extraction. A 6-well plate format was chosen to allow for the recovery of a sufficient number of cells at the end of the experiment for downstream molecular analyses (such as RT-PCR and Western blotting), and flow cytometry analysis of proliferation and cell death.

[0097] 2. RNA extraction and RT-PCR 2.1. Prior to all experiments, cells were washed with physiological saline and dissociated using a trypsin-EDTA mixture (EuroClone). RNA was extracted from each well using Trizol reagent according to the manufacturer's instructions.

[0098] 2.2. RNA was quantified using a Nanodrop spectrophotometer. RNA quality was assessed using OD ratios of 260 / 280 and 260 / 230 > 1.5. 1 μg of RNA was transcribed using a high-fidelity cDNA reverse transcription kit (ThermoFisher, catalog number: 4368814), and the diluted cDNA (1:5 ratio) was then used as a template for SYBER Green Master Mix (Biorad).

[0099] 2.3. The obtained cDNA was used as a template for evaluating transcripts using real-time PCR (ViiA™ 7 Real-Time PCR System with 96-Well BlockGreen, catalog number: 4453534). All samples were analyzed three times.

[0100] 2.4. The expression level of Trim28 after siRNA-mediated Trim28 silencing was analyzed using the following primers: Human TRIM28 FW: 5' CTACTCAAGTGCAGAGCCCC 3' (SEQ ID No.: 9) Human TRIM28 RV: 5' GGGAAGACCTTGAAGACGGG 3' (SEQ ID No.: 10) 3. CrispR / Cas9 knockout technology As previously described, the MC38p luciferase cell line was maintained in culture. A GFP-plasmid designed to target MC38-p luciferase and generate the TRIM28 KO cell line was prepared and delivered via liposomes. Briefly, MC38-p luciferase cells were seeded at 250,000 cells / well in 6-well plates and transfected according to the manufacturer's instructions. For a final plasmid concentration of 2.5 μg, 5 µl of Lipofectamine 3000 (catalog number: L300000, ThermoFisher) and 5 µl of p3000 reagent were used in 250 µl of phenol red-free Opti-MEM medium (Life Technologies-Gibco, Monza, Italy; #11058-021) per well, with a final volume of 2 ml RPMI complete medium. After 6 hours, the transfection medium was removed and replaced with fresh complete RPMI medium.

[0101] After 48 hours, cells were harvested and single-cell sorted. The selected gating strategy was solely for isolating GFP cells containing plasmids and subjected to TRIM28 knockdown. + Cells. Western blot analysis was used to fully test the TRIM28 knockdown in clones.

[0102] 4. Western blot (WB) analysis Under reducing conditions, 30 μg of total protein was separated on 7.5% SDS-PAGE and transferred to a nitrocellulose membrane. The membrane was incubated at room temperature in TBST (50 mM Tris, 150 mM NaCl, 0.1% Tween) containing 5% skim milk powder (Applichem) or 5% BSA (Sigma) to saturate nonspecific binding sites. After blocking for 1 hour, the membrane was incubated overnight at 4°C with primary antibody solution. Next, the membrane was washed with TBST for 10 minutes (three times) at room temperature and incubated with HRP-conjugated secondary antibody solution. After 1 hour at room temperature, the membrane was washed three times with TBST for 10 minutes each time. Finally, a chemiluminescent substrate (ECL, Biorad) was added and the signal was detected on a Chemidoc (Biorad) transilluminometer. TRIM28 (ab 10484, Abcam), 1:1000 dilution, 5% milk, 4°C, overnight; 1:1000 dilution, 5% BSA, 4°C, overnight; actin (Sigma-Aldrich). Secondary antibody list: goat-α-rabbit-HRP conjugate (7074S, Cell Signaling) and goat-α-mouse-HRP conjugate (7076S, Cell Signaling); 1:5000 dilution, room temperature, 1 hour. Density analysis was performed using ImageJ software (an open architecture system with a Java plugin) after images were acquired using the BioDoc-It imaging system (UPV, Upland, CA, USA).

[0103] 5. Flow cytometry analysis Prior to all experiments, cells were washed with physiological saline and dissociated using a trypsin-EDTA mixture (EuroClone). For each assay under both experimental conditions, 1 x 10⁻⁶ cells were used. 6 Cells were analyzed using flow cytometry (BD LSRFortessa™) with the following markers to validate cell proliferation, cell cycle progression, and apoptosis-necrosis: anti-human 488 Ki-67 (clone 16A8, Biolegend), DAPI (4',6-diamino-2-phenylindole) (#D1306, Life Technologies), annexin / PI kit (MyBiosource, MBS668896), anti-human p21 (Biolegend, PE, 326008), and anti-TIF1β (KAP-1, TRIM28) antibody (clone 20A1, Biolegend). The acquired flow cytometry data were analyzed using the Flowjo software program.

[0104] 6. Transfecting cells in vivo using siRNA In C57Bl6 / J mice aged 10–12 weeks (Charles River Laboratories; Calco, Italy), mouse siRNA targeting Trim28 was delivered in vivo in two colorectal cancer models (one primary and inflammation-associated, and one metastatic). Transfection with the mouse siRNA, and for in vivo experiments, was performed using a Lipofectamine 3000 lipid-based transfection reagent (Life Technologies-Invitrogen, Monza, Italy; #L3000-008) and Opti-MEM.

[0105] 6.1. In vivo administration of mouse TRIM28 siRNA (CAC model) Mice were given a single dose of the mutagen azomethane (AOM; SigmaAldrich, A5486) intraperitoneally (ip) at a dose of 10 mg / kg body weight. Subsequently, five days after administration of the genotoxic agent, mice were given free access to 2.5% dextran sulfate (DSS, MP Biomedicals, molecular weight: 40 kDa) for three cycles, each lasting five days. Mice were anesthetized by intraperitoneal administration of an equal volume of ketamine / xylazine mixture (ketamine 100 mg / kg - xylazine 20 mg / kg). Mice were divided into two experimental groups and treated three times a week, starting from week three, with either mouse siRNA at a dose equivalent to 5 μg / mouse or a disordered control. To prepare the liposome complex siRNA formulation, 2 μg of ipofectamine 3000 (Invitrogen) was mixed with 48 μl of OptiMEM and incubated for 5 minutes, according to the manufacturer's instructions. 5 μg of mouse siRNA was resuspended in 50 μl of OptiMEM and then added to the aforementioned mixture, and incubated at room temperature for 20 minutes. Mice were then treated with ketamine (100 mg / kg) / xylazine (20 mg / kg)... Anesthetize mice with a mixture of liposomal siRNA (mg / kg) administered according to their body weight. The solution was immediately administered to anesthetize the mice rectally. Starting from week 3 of the AOM / DSS experiment, mice were given the siRNA preparation or an associated scrambled control three times weekly. Each rectal administration consisted of 100 μl of liposomal siRNA solution, delivered in a 0.5 mL syringe at a concentration of 5 μg (34).

[0106] 6.2. In vivo administration of mouse TRIM28 siRNA in an MC38pLuc colorectal cancer metastasis model C57Bl6 / J mice aged 10–12 weeks were randomly divided into two experimental groups. A colorectal cancer (MC38pLuc) metastasis model (metastasis to the liver after splenectomy) was established using injection into the spleen, and the anti-metastatic effect was assessed and confirmed in the liver. Ten minutes later, the spleens of the mice were removed, and the experiment was set to 30 days to allow for liver metastasis formation. Mouse siRNA or a randomized control was transfected using a Lipofectamine 3000 lipid transfection reagent (Life Technologies-Invitrogen, Monza, Italy; #L3000-008) and Opti-MEM. Briefly, 2 μl of lipofectamine 3000 (Invitrogen) was mixed with 48 μl of OptiMEM and incubated for 5 minutes according to the manufacturer's instructions. 25 μg of mouse siRNA was suspended in 50 μl of OptiMEM and then added to the aforementioned mixture, and incubated at room temperature for 20 minutes. This solution was immediately administered intravenously (orally) to anesthetized mice. All mouse siRNA or disordered control formulations were administered three times weekly. After 30 days, mice were given fluorescein and then sacrificed. Liver metastases were assessed using IVIS (The IVIS® SpectrumCT). Tumors from both experimental groups were digested. Briefly, tumor masses (removed from necrotic and vascularized areas) were digested with a solution of RPMI medium (Lonza) supplemented with DNase (ThermoFisher), collagenase (ThermoFisher), and calcium chloride (20–40 ml / tumor, homemade) and then incubated at 37°C for 30–40 min. The digestion reaction was then terminated by adding fetal bovine serum (Euroclone) and EDTA, and the tumor microenvironment, particularly inflammatory infiltration and stemness characteristics, was assessed (35).

[0107] 6.3. In vivo administration of TRIM28 mouse siRNA in an orthotopic mouse model of mesothelioma. The luciferase AB22 cell line (epithelialoid histology), expressing mouse mesothelioma luciferase, was generated in Balb / c mice by intraperitoneal injection of crocidolite asbestos fibers. Cells were cultured at 37°C in 5% CO2 in RPMI 1640 medium (Euroclone) supplemented with 10% FBS, 2 mM L-glutamine, and antibiotics. Eight-week-old female Balb / c mice were used to establish an orthotopic mouse model. Briefly, the AB22 cell line was injected intrathoracically into mice anesthetized with a ketamine / xylazine mixture and placed in the left lateral decubitus position. The chest area was shaved and disinfected with 70% ethanol. An 8–10 mm skin incision was made in the right chest, and 50,000 cells resuspended in 50 μl saline were injected between the third and fourth intercostal spaces, with the needle perpendicular to the thoracic cavity (29-gauge needle and 500 μl syringe, BD Becton, Dickinson). Following cell injection, mice were sutured and held under a warm lamp to allow them to recover from anesthesia. Tumor growth over time was quantified using in vivo imaging. D-fluorescein was injected intraperitoneally into mice. Ten minutes later, bioluminescence signals were acquired using an IVIS Illumina III instrument (ParkinElmer). Mice were anesthetized with a ketamine / xylazine mixture during acquisition. Tumor growth was examined 15 days post-injection to initiate treatment with either scrambled siRNA or mouse Trim28 siRNA, three times weekly for three weeks after treatment initiation. Transfection with mouse siRNA or scrambled controls was performed using Lipofectamine 3000 lipid transfection reagent (Life Technologies-Invitrogen, Monza, Italy; #L3000-008) and Opti-MEM. In short, 2 μl of lipofectamine 3000 (Invitrogen) was mixed with 48 μl of OptiMEM and incubated for 5 minutes, following the manufacturer's instructions. Resuspend 25 μg of mouse siRNA or a scrambled siRNA control in 50 μl of OptiMEM, then add it to the aforementioned mixture and incubate at room temperature for 20 minutes. Immediately administer the solution intravenously (orally) to anesthetized mice.

[0108] 6.4. In vivo administration of human TRIM28 siRNA3 (targeting ex_12) in a mouse xenograft model of pancreatic cancer (PANC1 human pancreatic cancer cell line). To ensure good tumor absorption in mice and promote exponential cell growth, PANC1 cells were collected in trypsin-EDTA, and then 5 million cells were resuspended in 100 μl of saline. Eight to ten-week-old male athymic Swiss nude mice were anesthetized with a ketamine / xylazine mixture, followed by a subcutaneous injection of the 5 million cells resuspended in 100 μl of physiological saline into the right flank. Mice were monitored daily to check for effective tumor implantation. Tumor volume was measured daily using calipers. Tumors were identified when they reached 50–100 mm in size. 3 Mice were treated with siRNA scrambled, siRNA3, or siRNA1 injected three times weekly for two weeks following the start of treatment. Transfection with siRNA3 or siRNA scrambled controls was performed using a Lipofectamine 3000 lipid-based transfection kit (Life Technologies-Invitrogen, Monza, Italy; #L3000-008) and Opti-MEM medium. Briefly, following the manufacturer's instructions, 2 μg of Lipofectamine 3000 (Invitrogen) was mixed with 48 μl of OptiMEM and incubated for 5 minutes. 25 μg of human siRNA3 or siRNA scrambled controls was resuspended in 50 μl of OptiMEM and incubated at room temperature for 20 minutes. This solution was immediately administered intravenously (intraocularly and retroocularly) to anesthetized mice. At the end of the experiment, mice were euthanized, tumors were removed and weighed. A portion of the tumor tissue was excised, processed, and embedded in paraffin for further histological analysis.

[0109] result The silencing efficiency of designed siRNAs (siRNA1-siRNA2-siRNA3-siRNA4) was tested in Caco2 cells (a cell line of primary human colon adenocarcinoma). After assessing actual TRIM28 expression in this tumor cell line by RT-PCR and Western blot, Caco2 cells were silenced with individual siRNAs pre-loaded into lipid cages generated using the Lipofectamine 3000 kit. After validating TRIM28 silencing of all four siRNA sequences, RT-PCR and Western blot analysis confirmed that each of the four siRNA sequences exhibited efficient downregulation (over 50%) of both transcripts and target proteins compared to the disordered control group. Figure 3 AB). After determining that siRNA3 was the optimal sequence for downregulating TRIM28 expression, we retransfected Caco2 cells and the highly metastatic colorectal cancer cell line SW620 with siRNA3 for 24h-48h-72h. Figure 4 and5 After determining the effectiveness of downregulating TRIM28, we investigated how TRIM28 silencing affected cell proliferation (detected by expression of the nuclear proliferation marker Ki67), cell death (assessed by annexin / PI staining), and cell progression during cell cycle phases (DAPI nuclear staining) using flow cytometry analysis.

[0110] In the case of the primary human cell line Caco2, cells treated with siRNA3 showed no difference in cell proliferation compared to their corresponding control. Figure 4 C). However, analysis of apoptosis (i.e., programmed cell death) showed that, in percentage terms, cells treated with siRNA3 were more prone to programmed cell death than cells treated with a disordered control. Figure 4 D).

[0111] Furthermore, cell cycle analysis showed that Caco2 cells treated with disordered control siRNA mostly underwent regular cell cycle progression at 48h and 72h, accumulating in the S phase. The S phase is the stage in the cell cycle where active replication of genetic material occurs, including cells progressing towards proliferation. Figure 4 GH).

[0112] For the SW620 metastatic cell line, cells treated with siRNA3 appeared to have lower proliferation rates than the control, in percentage terms. Figure 5 C), and apoptosis (C) Figure 5 D) and necrosis ( Figure 5 E) More. In contrast, SW620 cells treated with siRNA disordered sequences had a higher percentage entering the S phase of the cell cycle, indicating that they were more prone to mitosis (E). Figure 5 GH).

[0113] TRIM28 has been extensively studied in non-immune cells across various cancers, exhibiting pro- or anti-tumor functions depending on the type (36). The tumor-suppressive activity of TRIM28 is associated with the regulation of DNA repair mechanisms and epigenetic stability (37), regulated by phosphorylation of its Ser473 and / or Ser824. Given this, we found that both TLR ligands and inflammatory cytokines can induce TRIM28 S473p, and we explored the effects of inflammation on TRIM28-dependent DNA damage responses and the resulting susceptibility to tumor transformation in intestinal epithelial cells (IECs). To investigate the role of IEC-specific TRIM28 ablation in CAC development, TRIM28 was used... flox / flox and TRIM28 Villin-Cre Mice. In short, TRIM28 flox / flox(B6.129S2(SJL)- Trim28 tm1.1Ipc Both the / J) and Villin-Cre (B6.Cg-Tg(Vil1-cre)997Gum / J) mice were purchased from Jackson Laboratories and were crossbred to produce progeny with IEC-specific TRIM28 ablation. TRIM28 mice were then treated with azomethane (AOM) and three-round DSS. flox / flox and TRIM28 Villin-Cre Mice. Although we confirmed that TRIM28 mice responded to the first DSS treatment. Villin-Cre The mice experienced increased weight loss, but both groups showed similar flare-ups after subsequent rounds of DSS administration. However, gross analysis of the colon revealed that TRIM28... Villin-Cre The tumor lesions in mice decreased dramatically. Figure 2 These results indicate that the absence of TRIM28 in IEC enhances resistance to CAC development without affecting the overall degree of intestinal inflammation. In conclusion, our findings suggest that the absence of TRIM28 in intestinal epithelial cells in a preclinical model of CRC is the basis for conferring drug resistance to CAC tumors, indicating that TRIM28 is a novel regulator of cancer-related inflammation.

[0114] It has been confirmed that gene silencing of Trim28 in intestinal epithelium inhibits tumor development induced by AOM / DSS treatment. Figure 2 We validated the ability of siRNA targeting the mouse Trim28 transcript to repeat this result and inhibit tumor development. Therefore, we assessed the on-target potential of TRIM28 silencing during the development of colitis-related cancers. In short, C57Bl / 6 male mice were divided into two experimental groups and treated with a combination of the carcinogen azomethane (AOM) and trichloromethane sulfate (DSS). Figure 6 A). Each round of DSS treatment consisted of 5 days of adding 2.5% DSS to drinking water, followed by 16 days of free access to regular water. Then, starting from the third round of DSS, mice were administered 5 μg of mouse siRNA or a scrambled control rectally three times a week. At the end of the experiment, mice were sacrificed and the rectum was dissected ( Figure 6 A) Used for analysis. Gross and histological analysis of the rectum showed that, compared with the control group, mice treated with Trim28 siRNA had significantly reduced tumor lesions, indicating that siRNA-mediated downregulation of Trim28 in vivo enhanced resistance to CAC development, thus confirming that Trim28 is a novel regulator of tumor development under chronic inflammatory conditions. Figure 6Next, we investigated whether Trim28 silencing interfered with tumor dissemination in a metastatic colorectal cancer model. Male C57Bl / 6 mice were divided into two experimental groups, and the spleen was injected with the highly metastatic colon cancer cell line MC38pluc to induce liver metastasis (38). Subsequently, 25 μg / mouse of liposome-encapsulated mouse siRNA or the same amount of disordered siRNA control was administered intravenously three times a week for four weeks (BC). Figure 7 A) Mouse treatment. After four weeks, the mice were euthanized and their livers, blood, and bone marrow were collected for analysis. Figure 7 As shown in B, mice treated with mouse siRNA exhibited reduced liver metastasis burden, thus its formation was almost entirely absent. Figure 7 BC).

[0115] Next, we examined the role of Trim28 silencing in regulating cancer development in a mouse mesothelioma model. Female Balb / c mice were intrathoracically injected with the AB22 cell line. Liposome treatment with siRNA-loaded mice began ten days after AB22-pLuc cell line injection, at which point all mice injected with AB22-pLuc had comparable tumor sizes. In short, mice were treated intravenously three times a week for four weeks with 25 μg / mouse liposome-encapsulated mouse siRNA or the same amount of disordered siRNA as a control. Throughout the experiment, tumor growth was monitored and measured in vivo by imaging following C-fluorescein administration. Figure 8 As shown, compared with the disordered control group ( Figure 8 Compared to A), mice treated with siRNA showed reduced tumor growth burden at 10–14–21 days after treatment initiation, characterized by a statistically significant reduction in tumor burden at 21 days after treatment initiation. Figure 8 B). This conclusion is also supported by the gross count of tumor lesions, as mice administered mouse siRNA showed a sharp reduction in tumor development (B). Figure 8 CD). All of these data confirm that TRIM28 is involved in the fundamental mechanisms supporting tumor progression.

[0116] Next, we selected a group of siRNAs that specifically target exons 4, 6, and 12. In particular, we determined that siRNA3, which targets exon 12, was the best-performing siRNA and could confer antitumor activity. Our aim was to demonstrate that siRNAs targeting exons 4, 6, and 12, which mediate TRIM28 downregulation, have an advantage in exerting antitumor activity compared to siRNAs designed for other exons (especially exon 3).

[0117] Therefore, we silenced the human pancreatic cancer cell line PANC1 using siRNAs generated targeting exons 4 (siRNA8), 6 (siRNA2), 12 (siRNA3), and 3 (siRNA1). We first validated the effectiveness of siRNA silencing by RT-PCR and flow cytometry, where siRNAs and related disordered controls were pre-loaded into lipid cages generated using the Lipofectamine 3000 kit. Data showed that, compared to the disordered control (…),… Figure 9 Compared to A), all siRNAs induced statistically significant reductions in Trim28 transcripts at 24h, 48h, and 72h, and these results were supported by corresponding specular reductions in Trim28 protein levels at 48h and 72h. Figure 9 B). To differentiate the effects of different exon-targeted siRNAs on Trim28 silencing, we harvested cells and counted the absolute number of viable cells. Compared to the corresponding disordered control, all siRNAs induced a decrease in cell viability at each predetermined time point. Considering the differences between all experimental conditions, PANC1 cells treated with siRNA3 and siRNA2 were characterized by a significant reduction in viable cells compared to siRNA1 (targeting exon 3). Furthermore, the siRNA8 (targeting exon 4) treatment group showed a trend towards a reduction in viable cells at 48 h compared to siRNA1 (targeting exon 3). Figure 9 C).

[0118] To determine whether siRNAs targeting exons 4, 6, and 12 can regulate cell death, particularly apoptosis and necrosis, PANC1 cell lines were treated with all siRNAs and corresponding disordered controls. Cell death was assessed by annexin V / PI staining using flow cytometry at 24 and 48 hours. The percentage of viable cells in PANC1 cells treated with siRNA3 was significantly lower than that from the disordered control and siRNA1 cells. Figure 10 (AB). These results also reflected a statistically significant increase in cell accumulation during both early and late apoptosis phases in the siRNA3 treatment group compared to other experimental groups. Considering siRNAs targeting exons 4 and 6, we found a significant accumulation of siRNA8-treated cells during late apoptosis phases compared to the disordered control and siRNA1-treated cells at 48 h.

[0119] All these data support the view that Trim28 silencing is positively correlated with promoting cell death, particularly apoptosis, especially when induced by siRNA3 targeting exon 12. Furthermore, to elucidate the molecular role of Trim28 silencing in regulating apoptosis, we analyzed p21 expression levels at 48 h and 72 h post-treatment. The results showed that p21 expression was significantly increased in the siRNA3-treated group at 72 h compared to the disordered control and siRNA1-treated groups. PANC1 cells treated with siRNAs targeting exons 4 or 6 also showed the same pattern, indicating that all siRNAs targeting exons 4, 6, and 12 can positively regulate p21 expression levels and apoptosis. Figure 10 C).

[0120] To further support these results, we replicated the same experiments using another cancer cell line. Specifically, we focused on HepG2, a human cell line derived from primary liver tumors. We compared the antitumor activity of Trim28 silencing induced by siRNA3, siRNA2, siRNA8, and siRNA1. We first validated the effectiveness of siRNA silencing by detecting downregulation of Trim28 protein levels using RT-PCR and flow cytometry. The data showed that siRNA3, targeting exon 12, demonstrated silencing efficiency at each predetermined time point that was not only more effective than the disordered control but also more effective than other siRNAs. Figure 11 A). In particular, in HepG2 cancer cells, siRNA1 showed limited effectiveness in achieving Trim28 mRNA silencing at 24h. Figure 11 A). These results were validated by flow cytometry analysis of Trim28 protein expression at 48 h and 72 h. In this analysis, Trim28 protein levels were significantly reduced at 48 h and 72 h under each experimental condition compared to the disordered control group. Furthermore, siRNA3 designed for exon 12 produced the most effective silencing at both the transcript and protein levels compared to other experimental groups. Figure 11 B). We further validated the effect of Trim28 downregulation on cell survival. Absolute cell counts were assessed by trypan blue staining, and the results showed that cells treated with siRNA targeting exons 4, 6, and 12 had significantly fewer viable cells at 24h–48h–72h compared to cells treated with siRNA1 (targeting exon 3) and related disordered controls. Figure 11 C). Crystal violet staining was performed at 24h, 48h, and 72h, and the absorbance of the experimental groups was compared to further confirm these data. Figure 11 D).

[0121] After confirming the effectiveness of downregulating TRIM28, we investigated how TRIM28 silencing affected cell death (assessed using annexin / PI staining) and p21 expression using flow cytometry. Figure 12 ).

[0122] Compared with those treated with scrambled controls and siRNA1, primary human HepG2 cells treated with siRNA3, siRNA2, and siRNA8 showed an increased percentage of apoptotic events. Figure 12 ABC). These data were also confirmed by increased p21 expression at 48h and 72h. Figure 12 D). Finally, compared with the corresponding controls, siRNA3 treatment showed a significant difference in cell proliferation rate, with significantly reduced Ki67 expression at 24-48h and 72h compared with those treated with the disordered control and siRNA1. This trend was also confirmed by siRNA2 and siRNA8, which target exon 3. Figure 12 E).

[0123] The crucial role of TRIM28 in regulating DNA damage has been well-established. To validate these mechanisms, we generated the MC38-p-luciferase TRIM28 KO cell line using CrispR / Cas9 technology. To examine whether TRIM28 silencing affects DNA damage in CRC (MC38 cells), as well as cancer cell biology and tumor progression, MC38 TRIM28 WT and KO cells were treated with 25 μM etoposide (Eto, a DNA damage inducer) for 1 h. Figure 13 A). Next, we assessed the levels of the DNA damage-associated biomarker αH2AX at 2-3 h using flow cytometry. The TRIM28 KO cell line accumulated higher levels of αH2AX compared to the TRIM28 control WT. To support these results, we also considered p53 expression levels, as DNA damage is expected to promote p53 activation (44). Compared to WT control cells, TRIM28 KO showed higher expression of the tumor suppressor gene p53 (i.e., 3 h after etoposide treatment), which is involved in the control of cell cycle and DNA repair mechanisms (40).

[0124] Since targeting DNA instability is an emerging anticancer strategy, this activity was compared with olaparib, a PARP-1 inhibitor currently under clinical development for the treatment of pancreatic, breast, and prostate cancer (41). For this purpose, WT and TRIM28 KO MC38-p luciferase-positive cells were pretreated with olaparib (10 μM) for 4 h to induce PARP inhibition, followed by treatment with etoposide for 1 h to induce DNA damage. Compared with the Wt counterpart, the accumulation of αH2AX in response to olaparib was significantly higher in TRIM28 KO cells, suggesting a possible synergistic effect between olaparib and siRNA targeting TRIM28. As shown in the figure, siRNA3 TRIM28 treatment induced αH2AX expression in PANC1 cells and enhanced the damaging effect of olaparib ( Figure 13 A, C, D), which are related to enhanced p53 activation ( Figure 13 B, F).

[0125] Finally, we investigated whether Trim28 silencing interfered with tumor growth in a pancreatic cancer (PANC1) xenograft model. Male Swiss nude mice were divided into two experimental groups, and human PANC1 cells were injected into the right flank. Figure 14 A). Subsequently, mice were treated intravenously three times a week for four weeks with liposomes loaded with siRNA3 (targeting exon 12), liposomes loaded with siRNA1 (targeting exon 3), or a control group containing scrambled siRNA at a dose of 25 μg / mouse. Two weeks after treatment began, mice were sacrificed, tumors were dissected, and weighed. Tumor samples were paraffin-embedded for further histological analysis. Compared with the control group treated with scrambled siRNA, the two groups of mice treated with siRNA1 and siRNA3 showed smaller tumor sizes ( Figure 14 ABC) and weight ( Figure 14 Both aspects (D) showed a significant reduction in tumor burden. These data highlight that, compared with siRNA1-treated mice, siRNA3-treated mice showed a sharp and significant reduction in tumor growth (D). Figure 14 (BC), indicating that siRNA targeting exon 12 of the TRIM28 gene has higher anti-tumor efficacy.

[0126] References 1. Elbashir SM, Harborth J, Lendeckel W, Yalcin A, Weber K, andTuschl T. Duplexes of 21-nucleotide RNAs mediate RNA interference in culturedmammalian cells. Nature. 2001;411(6836):494-8. 2. Friedrich M, and Aigner A. Therapeutic siRNA: State-of-the-Art andFuture Perspectives. BioDrugs. 2022;36(5):549-71. 3. Arnold M, Sierra MS, Laversanne M, Soerjomataram I, Jemal A, andBray F. Global patterns and trends in colorectal cancer incidence andmortality. Gut. 2017;66(4):683-91. 4. Aghamiri S, Jafarpour A, Malekshahi ZV, Mahmoudi Gomari M, andNegahdari B. Targeting siRNA in colorectal cancer therapy: Nanotechnologycomes into view. J Cell Physiol. 2019;234(9):14818-27. 5. Chandramohan K, Balan DJ, Devi KP, Nabavi SF, Reshadat S,Khayatkashani M, et al. Short interfering RNA in colorectal cancer: is itwise to shoot the messenger? Eur J Pharmacol. 2023;949:175699. 6. Yang Y, Tan S, Han Y, Huang L, Yang R, Hu Z, et al. The role oftripartite motif-containing 28 in cancer progression and its therapeuticpotentials. Front Oncol. 2023;13:1100134. 7. Shen LT, Chou HE, and Kato M. TIF1beta is phosphorylated at serine473 in colorectal tumor cells through p38 mitogen-activated protein kinase asan oxidative defense mechanism. Biochem Biophys Res Commun. 2017;492(3):310-5. 8. Hu C, Zhang S, Gao X, Gao X, Xu X, Lv Y, et al. Roles of Kruppel-associated Box (KRAB)-associated Co-repressor KAP1 Ser-473 Phosphorylation inDNA Damage Response. J Biol Chem. 2012;287(23):18937-52. 9. Wang C, Ivanov A, Chen L, Fredericks WJ, Seto E, Rauscher FJ, 3rd,et al. MDM2 interaction with nuclear corepressor KAP1 contributes to p53inactivation. EMBO J. 2005;24(18):3279-90. 10. Tian C, Xing G, Xie P, Lu K, Nie J, Wang J, et al. KRAB-typezinc-finger protein Apak specifically regulates p53-dependent apoptosis. Nat Cell Biol.2009;11(5):580-91. 11. Zhang PP, Ding DZ, Shi B, Zhang SQ, Gu LL, Wang YC, et al.Expression of TRIM28 correlates with proliferation and Bortezomib-inducedapoptosis in B-cell non-Hodgkin lymphoma. Leuk Lymphoma. 2018;59(11):2639-49. 12. Qi ZX, Cai JJ, Chen LC, Yue Q, Gong Y, Yao Y, et al. TRIM28 as anindependent prognostic marker plays critical roles in glioma progression. J Neurooncol. 2016;126(1):19-26. 13. Li F, Wang Z, and Lu G. TRIM28 promotes cervical cancer growththrough the mTOR signaling pathway. Oncol Rep. 2018;39(4):1860-6. 14. Chen Y, Cheng H, and Long H. Tripartite motif containing 28(TRIM28) promotes the growth and migration of endometrial carcinoma cells byregulating the AKT / mTOR signaling pathway. Gen Physiol Biophys. 2021;40(3):245-52. 15. Yu C, Zhan L, Jiang J, Pan Y, Zhang H, Li X, et al. KAP-1 isoverexpressed and correlates with increased metastatic ability andtumorigenicity in pancreatic cancer. Med Oncol.2014;31(7):25. 16. Chen L, Munoz-Antonia T, and Cress WD. Trim28 contributes to EMTvia regulation of E-cadherin and N-cadherin in lung cancer cell lines. PLoS One. 2014;9(7):e101040. 17. Wei C, Cheng J, Zhou B, Zhu L, Khan MA, He T, et al. Tripartitemotif containing 28 (TRIM28) promotes breast cancer metastasis by stabilizingTWIST1 protein. Sci Rep. 2016;6:29822. 18. Deng B, Zhang S, Zhang Y, Miao Y, Meng X, and Guo K. Knockdown ofTripartite Motif Containing 28 suppresses the migration, invasion andepithelial-mesenchymal transition in ovarian carcinoma cells through down-regulation of Wnt / beta-catenin signaling pathway. Neoplasma. 2017;64(6):893-900. 19. Cheng B, Ren X, and Kerppola TK. KAP1 represses differentiation-inducible genes in embryonic stem cells through cooperative binding with PRC1and derepresses pluripotency-associated genes. Mol Cell Biol. 2014;34(11):2075-91. 20. Oleksiewicz U, Gladych M, Raman AT, Heyn H, Mereu E, ChlebanowskaP, et al. TRIM28 and Interacting KRAB-ZNFs Control Self-Renewal of HumanPluripotent Stem Cells through Epigenetic Repression of Pro-differentiationGenes. Stem Cell Reports. 2017;9(6):2065-80. 21. Miles DC, de Vries NA, Gisler S, Lieftink C, Akhtar W, Gogola E,et al. TRIM28 is an Epigenetic Barrier to Induced Pluripotent Stem CellReprogramming. Stem Cells. 2017;35(1):147-57. 22. Klimczak M, Czerwinska P, Mazurek S, Sozanska B, Biecek P,Mackiewicz A, et al. TRIM28 epigenetic corepressor is indispensable forstable induced pluripotent stem cell formation. Stem Cell Res. 2017;23:163-72. 23. Czerwinska P, Shah PK, Tomczak K, Klimczak M, Mazurek S, SozanskaB, et al. TRIM28 multi-domain protein regulates cancer stem cell populationin breast tumor development. Oncotarget. 2017;8(1):863-82. 24. Parker KA, Gooding AJ, Valadkhan S, and Schiemann WP. lncRNABORG:TRIM28 Complexes Drive Metastatic Progression by Inducing alpha6Integrin / CD49f Expression in Breast Cancer Stem Cells. Mol Cancer Res. 2021;19(12):2068-80. 25. Czerwinska P, Jaworska AM, Wlodarczyk NA, and Mackiewicz AA.Melanoma Stem Cell-Like Phenotype and Significant Suppression of ImmuneResponse within a Tumor Are Regulated by TRIM28 Protein. Cancers (Basel). 2020;12(10). 26. Porcnik A, Novak M, Breznik B, Majc B, Hrastar B, Samec N, et al.TRIM28 Selective Nanobody Reduces Glioblastoma Stem CellInvasion. Molecules. 2021;26(17). 27. Czerwinska P, Mazurek S, and Wiznerowicz M. The complexity ofTRIM28 contribution to cancer. J Biomed Sci. 2017;24(1):63. 28. Wu GJ, Pen J, Huang Y, An S, Liu Y, Yang Y, et al. KAP1 inhibitsthe Raf-MEK-ERK pathway to promote tumorigenesis in A549 lung cancercells. Mol Carcinog. 2018;57(10):1396-407. 29. Porta C, Ippolito A, Consonni FM, Carraro L, Celesti G, CorrealeC, et al. Protumor Steering of Cancer Inflammation by p50 NF-kappaB EnhancesColorectal Cancer Progression. Cancer Immunol Res. 2018;6(5):578-93. 30. Consonni FM, Bleve A, Totaro MG, Storto M, Kunderfranco P,Termanini A, et al. Heme catabolism by tumor-associated macrophages controlsmetastasis formation. Nat Immunol. 2021;22(5):595-606. 31. Bulbake U, Doppalapudi S, Kommineni N, and Khan W. LiposomalFormulations in Clinical Use: An Updated Review. Pharmaceutics. 2017;9(2). 32. Abraham S, Juel HB, Bang P, Cheeseman HM, Dohn RB, Cole T, et al.Safety and immunogenicity of the chlamydia vaccine candidate CTH522adjuvanted with CAF01 liposomes or aluminium hydroxide: a first-in-human,randomised, double-blind, placebo-controlled, phase 1 trial. Lancet Infect Dis. 2019;19(10):1091-100. 33. Davidson EM, Barenholz Y, Cohen R, Haroutiunian S, Kagan L, andGinosar Y. High-dose bupivacaine remotely loaded into multivesicularliposomes demonstrates slow drug release without systemic toxic plasmaconcentrations after subcutaneous administration in humans. Anesth Analg. 2010;110(4):1018-23. 34. Osborn MF, and Khvorova A. Improving siRNA Delivery In VivoThrough Lipid Conjugation. Nucleic Acid Ther. 2018;28(3):128-36. 35. Parashar D, Paingankar MS, Kumar S, Gokhale MD, Sudeep AB, ShindeSB, et al. Administration of E2 and NS1 siRNAs inhibit chikungunya virusreplication in vitro and protects mice infected with the virus. PLoS Negl Trop Dis. 2013;7(9):e2405. 36. Soldani C, and Scovassi AI. Poly(ADP-ribose) polymerase-1cleavage during apoptosis: an update. Apoptosis. 2002;7(4):321-8. 37. Nunes AS, Barros AS, Costa EC, Moreira AF, and Correia IJ. 3Dtumor spheroids as in vitro models to mimic in vivo human solid tumorsresistance to therapeutic drugs. Biotechnol Bioeng. 2019;116(1):206-26. 38. Dafflon C, Santamaria-Martinez A, and Ordonez-Moran P. AnIntrasplenic Injection Model for the Study of Cancer Stem Cell SeedingCapacity. Methods Mol Biol. 2020;2171:293-302. 39. Digifico E, Erreni M, Colombo FS, Recordati C, Migliore R,Frapolli R, D'Incalci M, Belgiovine C and Allavena P. Optimization of aLuciferase-Expressing Non-Invasive Intrapleural Model of MalignantMesothelioma in Immunocompetent Mice. Cancers 2020, 12(8):2136 40. Liu J,Zhang C,Wang X, Hu W, Feng Z Tumor Tumor suppressor p53cross-talk with TRIM28 proteins, Genes and Diseases, PMID: 34179310 PMCID:PMC8209353 41. Nannan Wang , Yan Yang , Dongdong Jin, Zhenan Zhang, Ke Shen,Jing Yang, Huanhuan Chen, Xinyue Zhao, Li Yang and Huaiwu Lu PARP inhibitorresistance in breast and gynecological cancer: Resistance mechanisms andcombination therapy strategies 42. Zhi Shan, Xinqiang Wu, Shengfen Zhen, yaru Wi, Zhe Hong, DingweiYe. A systematic pan-cancer analysis identifies TRIM28 as an immunologicaland prognostic predictor and involved in immunotherapy resistence. J Cancer2023; 14(15):2798-2810.doi:10.7150 / jca.86742 43. Zheng, Zhan,Chen, Weng, Rao and Fang. Machanism and currentprogress of Poly ADP-ribose Polymerase (PARP) inhibitors in the treatment ofovarian cancer. PMID 31931287; DOI: 10.1016 / .j.biopha.2019.109661 44. Yasser Abuetabh, H. Helena Wu, Chenseng Chai, Habib Al Yousef,Sujata Persad, Consolato M.Sergi and Roger Leng. DNA damage responserevisited: the p53 family and its regulators provide endless cancer therapyopportunities. Nature, Exprimental e molecular Medicine, 54, 1658-1669(2022). 45. Bouwmann P., Jonkers J. Molecular Pathways: How can BRCA-MutatedTumors Become resistant to PARP inhibitors? . Clinical CancerResearch.Molecular Pathways. doi.org. / 10.1158 / 1078-0432.CCR-13-0225. 46. Davis M.R., Manning L.S., Whitaker D., Garlepp M.J., RobinsonB.W. Establishment of a murine model of malignant mesothelioma. InternationalJournal Cancer, 1992. PMID: 1459729; DOI: 10.1002 / IJC.2910520609. 47. Tan M.H., Holyoke E.D., Goldrosen M.H. Murine ColonAdenocarcinomas: Methods for Selective Culture in vitro. Journal of thenational Cancer institute,1976. Volume 56, Issue 4, Pages 871-873. https: / / doi.org / 10.1093 / jnci / 56.4.871. 48. Lieber M., Mazzetta J., Nelson-Rees W., Kaplan M., Todaro G.Estamblishment of a continous tumor-cell line (panc-1) from a human carcinomaof the exocrine pancreas. Internationa Jounral Cancer, 1975. PMID: 1140870;DOI: 10.1002 / ijc.2910150505. 49. Zhou Y., Zhao S., Wu T., Zhang H. Comparison of Adverse ReactionCaused by Olaparib for DIfferent Indications. Frontiers in Pharmacology,2022. PMID: 35910367. doi:10.3389 / fphar.2022.968163.

Claims

1. A double-stranded small interfering RNA (siRNA) of at least 19 nucleotides in length that targets exons of the Trim28 gene mRNA having the nucleotide sequence shown in ENST000000253024.10, wherein the exons are selected from the group consisting of exon 3, exon 4, exon 6 and exon 12, and wherein the double-stranded siRNA is capable of inhibiting the TRIM28 protein.

2. The double-stranded siRNA according to claim 1, wherein the double-stranded siRNA is capable of inducing selective degradation of Trim28 transcripts containing one of exons 3, 4, 6 and 12.

3. The double-stranded siRNA according to claim 1 or claim 2, wherein the length of the double-stranded siRNA is between 19 and 29 nucleotides.

4. The double-stranded siRNA according to any one of the preceding claims, wherein the exon is selected from the group consisting of exon 4, exon 6 and exon 12, preferably exon 12.

5. The double-stranded siRNA according to any one of the preceding claims, wherein at least one strand of the double-stranded siRNA has a protruding end at the 3' end.

6. The double-stranded siRNA according to any one of the preceding claims, wherein the GC base content of the double-stranded siRNA is less than 52%.

7. The double-stranded siRNA according to any one of the preceding claims, wherein the GC base content of the double-stranded siRNA is greater than 36%.

8. The double-stranded siRNA according to any one of the preceding claims, wherein at least one strand of the double-stranded siRNA is melted at a temperature below 64 °C, wherein the free online software tool OligoEvaluator is used as disclosed. TM (Merck) measures the melting temperature.

9. The double-stranded siRNA according to any one of the preceding claims, wherein the sense strand of the double-stranded siRNA has a nucleotide sequence selected from SEQ ID No.: 1 to 4 and 21, and wherein the antisense strand has a sequence that is complementary to and opposite to that of the sense strand.

10. The double-stranded siRNA according to any one of the preceding claims, for the treatment and / or prevention of neoplastic diseases associated with abnormalities of the TRIM28 protein encoded by the Trim28 gene.

11. The double-stranded siRNA used according to claim 10, wherein the abnormality of the TRIM28 protein encoded by the Trim28 gene is the upregulation and / or hyperphosphorylation of the protein TRIM28.

12. The double-stranded siRNA used according to claim 10 or claim 11, wherein the neoplastic disease is primary cancer and / or metastatic cancer.

13. The double-stranded siRNA used according to any one of claims 10 to 12, wherein the neoplastic disease is selected from gastric cancer, pancreatic cancer, kidney cancer, ovarian cancer, melanoma, prostate cancer, testicular cancer, liver cancer, lymphoma, lung cancer, thyroid cancer, glioma, cervical cancer, gastric cancer, ovarian cancer, glioma, colorectal cancer, breast cancer, mesothelioma, and prostate cancer.

14. The double-stranded siRNA used according to any one of claims 10 to 13, for combination therapy with a poly(ADP-ribose) polymerase (PARP) inhibitor.

15. A pharmaceutical composition comprising at least one double-stranded siRNA according to any one of claims 1 to 9 and a pharmaceutically acceptable excipient.

16. The pharmaceutical composition of claim 15, for the treatment and / or prevention of neoplastic diseases associated with overexpression of the TRIM28 gene-encoded protein.

Images