Endothelium corneum gigeriae galli formula fermentation product for promoting nutrient absorption of children and application thereof

Abstract

According to the invention, lactobacillus rhamnosus UP180 with relatively strong cellulase activity and lactobacillus paracasei ID001 with relatively strong protease activity are combined to prepare composite probiotic powder, the composite probiotic powder is used for jointly fermenting the endothelium corneum gigeriae galli formula, and meanwhile, a polypeptide capable of improving the digestive enzyme activity of Caco-2 cells is found from a fermentation product. The compound strain fermentation effectively decomposes macromolecular proteins in the endothelium corneum gigeriae galli formula and converts the macromolecular proteins into small molecular peptides, effective active ingredients in the formula are fully released, and the conversion effect is obviously superior to that of single strain fermentation. Besides, the endothelium corneum gigeriae galli composition leavening prepared by the invention can improve nutrient absorption of the rats by improving enzyme activity and metal ion chelation in intestinal tracts of the rats in the weaning period and promote growth of the rats in the weaning period, and has a potential application prospect in the field of nutrient absorption of children.

Description

Technical Field

[0001] This invention belongs to the field of probiotics, specifically relating to a fermented chicken gizzard lining formula that promotes nutrient absorption in children and its application. Background Technology

[0002] Poor nutrient absorption efficiency in children is a core problem restricting their growth and development, stemming from the unique physiological characteristics of their digestive system. Studies have shown that pancreatic amylase activity in children under 3 years old is only 10%-25% of that in adults, significantly limiting their ability to break down complex carbohydrates (such as resistant starch) and large protein molecules (such as rice protein). This results in an in vitro digestibility of only 35.7±2.1% for starch in traditional rice flour. Simultaneously, the immature intestinal barrier function and poor gut microbiota stability further reduce the absorption rate of trace elements such as iron and zinc. These factors contribute to the high incidence of malnutrition in children, further exacerbating recurrent diarrhea, iron-deficiency anemia, and growth retardation.

[0003] Currently, the technologies used to promote nutrient absorption in children mainly focus on three aspects:

[0004] 1. Increase the nutritional density of the product;

[0005] 2. Add fortified supplements to the product;

[0006] 3. Reduce the sterilization intensity of the product.

[0007] However, all three points mentioned above have certain risks and limitations. Firstly, high-protein / high-calcium formulas can increase digestive stress in children, leading to bloating and constipation. Secondly, the fortifiers added to iron and zinc supplements can easily irritate children's gastrointestinal tract, causing diarrhea and vomiting. Finally, sterilization methods are not always complete; UHT sterilization (143℃ / 4s) destroys heat-sensitive nutrients (e.g., vitamin C loss >40%), but reducing sterilization intensity increases the risk of contamination by other microorganisms. Therefore, to overcome the challenges of children's nutrient absorption, the following points need to be addressed:

[0008] 1. Pre-digest macromolecules into smaller molecules that can be directly absorbed;

[0009] 2. Use probiotics and prebiotics to repair the integrity of the intestinal barrier in children;

[0010] 3. To establish a stable gut microbiota dominated by Bifidobacteria in children.

[0011] In the field of children's nutritional absorption, food-medicine homologous substances have become a key breakthrough due to their natural safety and physiological regulatory functions: Chicken gizzard lining effectively resolves the accumulation of starchy foods by activating pepsinogen and enhancing gastric motility (increasing starch digestibility by more than 40%), and its gastric hormones can enhance the transport efficiency of intestinal villi for trace elements such as iron and zinc; Hawthorn is rich in citric acid and malic acid, which can chelate metal ions, increasing the iron dissolution rate to 2.3 times that of traditional methods, while also promoting calcium and phosphorus deposition; β-glucan in Poria cocos reduces nutrient loss caused by pathogen invasion by regulating intestinal immune response (increasing sIgA secretion by 35%). However, the application of these substances has long been limited by anti-nutritional factors (such as the bitter taste caused by tannins in chicken gizzard lining) and large molecular structures (Poria cocos polysaccharides are difficult to absorb directly), and the release rate of functional components is less than 30% under traditional decoction or physical pulverization processes. The introduction of fermentation technology may effectively solve the above problems, and the synergy between food-medicine homologous substances and fermentation technology can break through the traditional limitations of children's nutritional intervention.

[0012] Patent CN201811360596.0 discloses a method for preparing chicken gizzard enzyme. Human trials show that the fermented chicken gizzard enzyme liquid has a laxative effect. However, this fermentation method uses multiple strains in a three-step combined fermentation process, with a time cycle of up to 105 days. Patent CN202311508961.9 uses probiotics to ferment traditional Chinese medicinal materials, preparing a mixed bacterial powder containing probiotics and fermentation liquids of chicken gizzard, Poria cocos, yam, and hawthorn. However, it only uses the extract after decocting the medicinal materials and does not fully utilize the medicinal materials. Summary of the Invention

[0013] This invention addresses existing technologies by designing a set of herbal formulas for regulating children's spleen and stomach based on the principles of traditional Chinese medicine. The formulas include chicken gizzard lining, astragalus, American ginseng, and hawthorn. The formulas are fermented using compound probiotics (Lactobacillus rhamnosus UP180 and Lactobacillus paracasei ID001).

[0014] The first objective of this invention is to provide a polypeptide that can enhance the digestive enzyme activity of Caco-2 cells.

[0015] A second object of the present invention is to provide a fermentation product comprising the said polypeptide.

[0016] A third object of the present invention is to provide an application of the fermented product.

[0017] A fourth objective of this invention is to provide a method for preparing the fermented product.

[0018] The fifth objective of this invention is to provide a probiotic compound preparation comprising the fermented product that promotes nutrient absorption. This invention is achieved through the following technical solution:

[0019] A polypeptide having the amino acid sequence Leu-Val-Pro-Gly-Tyr-Phe.

[0020] A fermentation product comprising the aforementioned polypeptide, the fermentation product being obtained by fermenting chicken gizzard lining, astragalus, hawthorn and American ginseng by Lactobacillus rhamnosus UP180 and Lactobacillus paracasei ID001.

[0021] One application of the fermentation product is in the preparation of pharmaceuticals or foods that upregulate the expression of intestinal AMY2, LPL, and PRSS1 genes; or

[0022] Used in the preparation of pharmaceuticals or foods that promote the absorption of metal mineral ions in the intestine; or

[0023] It can be used to prepare drugs or foods that enhance the activity of intestinal digestive enzymes.

[0024] The method for preparing the fermented product includes the following steps:

[0025] S1: Mix chicken gizzard lining (5 parts by weight), astragalus root (2.5 parts by weight), hawthorn fruit (2 parts by weight), and American ginseng (1.5 parts by weight) to obtain the chicken gizzard lining formula;

[0026] S2: After activating Lactobacillus rhamnosus UP180 and Lactobacillus paracasei ID001 for three generations, adjust the OD value with physiological saline. 600 Mix 1 part to 1 part thoroughly.

[0027] S3: Add 20wt% of the chicken gizzard lining compound prepared in step S1 to the basal culture medium, adjust the pH to 6.5, and then autoclave at 121℃ for 15 min.

[0028] S4: Inoculate 5% of the composite bacterial solution prepared in step S2 under aseptic conditions, ferment at 37°C for 18 hours, and maintain a rotation speed of 150 rpm.

[0029] S5: After fermentation, heat at 85℃ for 30 minutes to sterilize, centrifuge at 3000 rpm for 10 minutes to collect the supernatant, concentrate by rotary evaporation at 55℃ to 20% of the original volume, freeze dry at -80℃ to prepare the chicken gizzard lining fermentation product.

[0030] The basal culture medium consists of 2% glucose, 2% peptone, 0.15% sodium acetate, 0.25% dipotassium hydrogen phosphate, and the remainder is water.

[0031] A probiotic complex preparation that promotes nutrient absorption comprises the following components in parts by weight:

[0032] The fermented product contains 1.2 parts of jujube powder, 1 part of prickly pear powder, 0.8 parts of yam powder, 0.8 parts of fructooligosaccharide, 0.3 parts of monk fruit powder, 0.2 parts of stachyose, 0.2 parts of isomaltooligosaccharide, 0.1 parts of GABA, 0.05 parts of casein phosphopeptide, and 0.05 parts of compound bacterial powder.

[0033] The compound bacterial powder includes Lactobacillus rhamnosus UP180 and Lactobacillus paracasei ID001;

[0034] The Lactobacillus rhamnosus UP180 is derived from patent CN 202411889236.5 Lactobacillus rhamnosus, probiotic preparations for promoting growth and development and their preparation methods, with accession number CGMCC No.32109;

[0035] The Lactobacillus paracasei ID001 is derived from patent CN 202510035856.0 Lactobacillus paracasei, probiotic preparations that enhance immunity and their preparation methods, with accession number CGMCC No.32951;

[0036] The number of live bacteria in the compound bacterial powder is 500 billion per gram.

[0037] The preparation method of the compound microbial powder includes the following steps:

[0038] S1: Take out the cryopreserved glycerol tubes of Lactobacillus rhamnosus UP180 and Lactobacillus paracasei ID001, streak them in MRS solid medium to activate them, and after single colonies grow, pick out single colonies and inoculate them into liquid medium. Subculture every 24 hours, repeating the subculture three times.

[0039] S2: The activated Lactobacillus rhamnosus UP180 and Lactobacillus paracasei ID001 were inoculated into a fermenter containing MRS medium at an inoculation rate of 2%, fermented at 37℃ for 20h, centrifuged at 4000g for 10min, and the bacterial sludge was collected.

[0040] S3: Under aseptic conditions, the bacterial sludge and freeze-drying protectant were mixed evenly at a ratio of 1:1, freeze-dried at -80℃ until dehydrated and ground evenly to prepare Lactobacillus rhamnosus UP180 bacterial powder and Lactobacillus paracasei ID001 bacterial powder, respectively.

[0041] S4: Mix Lactobacillus rhamnosus UP180 bacterial powder and Lactobacillus paracasei ID001 bacterial powder at a mass ratio of 1:1 to prepare a compound bacterial powder.

[0042] The MRS culture medium consists of: 10.0 g / L casein digest, 10.0 g / L beef extract, 4.0 g / L yeast extract, 20.0 g / L glucose, 2.0 g / L triammonium citrate, 2.0 g / L dipotassium hydrogen phosphate, 5.0 g / L sodium acetate, 0.2 g / L magnesium sulfate, 0.05 g / L manganese sulfate, 1.0 g / L Tween, with the remainder being water.

[0043] The MRS solid culture medium is prepared by adding 20 g / L agar to the above components.

[0044] The freeze-drying protectant for freeze-dried Lactobacillus rhamnosus consists of 10% skim milk powder, 8% trehalose, 2% mannitol, 0.1% Tween 80, 1% monosodium glutamate, 0.05% vitamin C, and the remainder is water.

[0045] The freeze-drying protectant for *Lactobacillus paracasei* consists of 10% skim milk powder, 8% trehalose, 5% maltose, 2% mannitol, and the remainder is water.

[0046] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0047] 1. This invention has discovered a hexapeptide rich in hydrophobic amino acids from the fermentation product of chicken gizzard lining, with the sequence Leu-Val-Pro-Gly-Tyr-Phe, which has the function of participating in the regulation of digestive enzyme activity.

[0048] 2. This invention provides a fermented product obtained from the fermentation of chicken gizzard lining, which is prepared by fermentation of *Lactobacillus rhamnosus* UP180 and *Lactobacillus paracasei* ID001. The large protein molecules in this fermented product are effectively broken down into small peptide molecules, improving bioavailability. The fermentation effect of the combined strain is significantly better than that of commercially available *Lactobacillus rhamnosus* GG.

[0049] 3. The fermented product provided by this invention has the function of strengthening the spleen and stomach and promoting children's nutrient absorption. It is a formula of chicken gizzard lining, a substance that is both food and medicine.

[0050] 4. The chicken gizzard lining fermentation formula provided by this invention promotes the increase of body length and body size in weaning rats by enhancing the activity of intestinal digestive enzymes and the coupling of metal ions such as calcium, iron, and zinc. Its effect on promoting nutrient absorption in weaning rats is significantly better than that of Sijunzi Decoction. Attached Figure Description

[0051] Figure 1 The relative expression levels of the Lactobacillus rhamnosus UP180 and Lactobacillus paracasei ID001 genes are shown.

[0052] Figure 2 The enzyme activities of Lactobacillus rhamnosus UP180 and Lactobacillus paracasei ID001 are shown.

[0053] Figure 3 The molecular structure of LVPGYF is shown.

[0054] Figure 4 The effect of LVPGYF on Caco-2 cell viability was shown.

[0055] Figure 5 The effects of LVPGYF on the expression of digestive enzyme genes in Caco-2 cells were shown.

[0056] Figure 6 The expression levels of digestive enzyme-related genes in the intestinal tissue of weaning rats in each group were shown. Detailed Implementation

[0057] Example 1

[0058] Enzyme activity assay of Lactobacillus rhamnosus UP180 and Lactobacillus paracasei ID001

[0059] (1) Extraction of strain mRNA

[0060] After three generations of activation, *Lactobacillus rhamnosus* UP180 and *Lactobacillus paracasei* ID001 were centrifuged at 4000g to collect bacterial sludge. The bacterial precipitate was gently washed 1-2 times with pre-chilled PBS buffer, and the supernatant was discarded. Immediately after washing, 1 mL of TRIZOL was added, and the mixture was pipetted and vortexed until the solution and bacterial sludge were thoroughly mixed to ensure complete lysis. The mixture was then allowed to stand at room temperature (26℃) for 5 min. 0.2 mL of chloroform was added to the homogenized lysis buffer, and the mixture was vigorously shaken for 15-20 s to ensure complete emulsification. After standing at room temperature for 2-3 min, the colorless aqueous phase was aspirated and transferred to an enzyme-free centrifuge tube. An equal volume of pre-chilled isopropanol was added to the aqueous phase, and the mixture was allowed to stand at room temperature for 10 min. The mixture was then centrifuged at 12000g at 4℃ for 10 min, the supernatant was discarded, and 1 mL of pre-chilled 75% ethanol was added. The mixture was then centrifuged again at 8000g at 4℃ for 10 min, the ethanol was discarded, and the centrifuge tube was inverted and allowed to air dry under sterile conditions.

[0061] (2) Detection of cellulase, pectinase and protease gene family expression in strains

[0062] Transcriptomic analysis of gene families in the strains revealed high expression levels of GH1, GH7, and PL3 genes in *Lactobacillus rhamnosus* UP180, while high expression levels of GH6, PL1, and S8 genes were observed in *Lactobacillus paracasei* ID001. The GH gene family regulates cellulose hydrolysis, breaking it down into monosaccharides to promote bioavailability. The PL gene family is a major regulator of pectin cleavage, primarily responsible for cleaving pectin chains and releasing active components from the pectin structure. The S8 gene family is a classic serine protease regulator, hydrolyzing proteins into more readily absorbed small peptides and amino acids. These results suggest that *Lactobacillus rhamnosus* UP180 may be better at hydrolyzing cellulose into small monosaccharides during fermentation and cleaving pectin chains to improve absorption and utilization, while *Lactobacillus paracasei* ID001 may have a greater advantage in protein degradation into small peptides and amino acids. To verify whether the gene expression of the strain was consistent with the transcriptomics results, qPCR was used to determine the mRNA expression level of the strain. The most representative genes from the aforementioned gene family were selected for expression level determination, with commercially available *Lactobacillus rhamnosus* GG as a control. Results are as follows: Figure 1 As shown, the results of PCR assays are initially consistent with transcriptomics. The gene expression results of UP180 and ID001 indicate that they are more advantageous in hydrolyzing cellulose and protein, respectively, and are significantly superior to rhamnose GG.

[0063] Table 1 Primers for qPCR analysis

[0064]

[0065] (3) Enzyme activity assay of strains

[0066] Cellulase activity was detected using the DNS method (sodium carboxymethyl cellulose substrate), pectinase activity was detected using the DNS method (pectin substrate), and protease activity was detected using the Folin-Ciocalteu method (casein substrate). A commercially available *Lactobacillus rhamnosus* GG strain was used as a control. Results are as follows: Figure 2 The cellulase activity of *Lactobacillus rhamnosus* UP180 was significantly higher than that of ID001 and GG, while the protease activity of *Lactobacillus paracasei* ID001 was significantly higher than that of UP180 and GG. No significant difference was observed in pectinase activity between the two strains. This demonstrates that the functional focus of *Lactobacillus rhamnosus* UP180 and *Lactobacillus paracasei* ID001 strains is respectively on hydrolyzing cellulose and protein. The combination of these two strains can produce a richer and more comprehensive enzyme system in the fermentation broth, effectively hydrolyzing not only cellulose but also efficiently degrading large protein molecules. Therefore, *Lactobacillus rhamnosus* UP180 and *Lactobacillus paracasei* ID001 were subsequently used to prepare composite bacterial solutions and composite bacterial powders for synergistic fermentation of chicken gizzard lining formulations.

[0067] Example 2

[0068] Preparation of compound microbial powder of Lactobacillus rhamnosus UP180 and Lactobacillus paracasei ID001

[0069] (1) Activation of strains

[0070] Remove the glycerol cryovials of *Lactobacillus rhamnosus* UP180 and *Lactobacillus paracasei* ID001 from the -80°C cryopreservation freezer and immediately thaw them rapidly in a 37°C water bath to avoid repeated freezing damage that could reduce bacterial activity. Using an inoculation loop, streak the thawed bacterial solution onto the surface of MRS solid medium in an aseptic worktable. Incubate anaerobically at 37°C for at least 24 hours to allow the strains to fully recover their activity. Select typical single colonies (milky white with neat edges) and inoculate them into MRS liquid medium. Incubate statically at 37°C for 18 hours. Repeat the subculturing for three generations, examining each generation under a microscope to confirm the consistency of bacterial morphology.

[0071] (2) High-density fermentation

[0072] Take the third-generation activated bacterial culture, centrifuge at 4000g for 10 minutes and discard the supernatant. Resuspend the bacterial sludge in sterile physiological saline and inoculate it into the fermenter at a 2% inoculum (v / v). Ferment at 37℃±0.5℃, pH 6.8, and dissolved oxygen 20% for 20 hours. Centrifuge the fermentation broth at 4000g for 10 minutes (4℃), discard the supernatant to obtain wet bacterial sludge, and wash twice with pre-cooled physiological saline to remove residual metabolic products from the culture medium.

[0073] (3) Preparation of bacterial powder

[0074] Under aseptic conditions, the bacterial sludge and freeze-drying protectant were mixed evenly at a 1:1 ratio, freeze-dried at -80℃ until dehydrated, and then ground evenly to prepare Lactobacillus rhamnosus UP180 bacterial powder and Lactobacillus paracasei ID001 bacterial powder.

[0075] The above-mentioned components of the Lactobacillus rhamnosus freeze-drying protectant are: 10% skim milk powder, 8% trehalose, 2% mannitol, 0.1% Tween 80 (liquid), 1% monosodium glutamate, 0.05% vitamin C, and the remainder is water.

[0076] The above-mentioned Lactobacillus paracasei freeze-drying protectant consists of: 10% skim milk powder, 8% trehalose, 5% maltose, 2% mannitol, and the remainder being water.

[0077] (4) Preparation of compound bacterial powder

[0078] Weigh out UP180 bacterial powder (4.7 × 10⁻⁶ live bacteria count) precisely at a 1:1 mass ratio. 11 CFU / g) and ID001 bacterial powder (5.1×10⁻⁶ live bacteria count) 11 Mix (CFU / g) in a V-type mixer at low speed (25 rpm) for 30 minutes to ensure uniformity and prepare a compound bacterial powder.

[0079] Example 3

[0080] Preparation of a chicken gizzard membrane formula with spleen-strengthening, stomach-nourishing, and nutrient-absorbing functions for children

[0081] Chicken gizzard lining, made from raw materials free of mold and impurities, is rinsed separately with running purified water for 3 minutes along with astragalus, American ginseng, and hawthorn to remove surface impurities and pesticide residues. It is then spread out in a cool, ventilated place to dry until the moisture content is ≤12%. To prevent degradation of heat-sensitive components, it is crushed at low temperature using an ultra-micro pulverizer. After crushing, it is passed through an 80-mesh sieve to improve the dissolution efficiency of active ingredients. Strictly following the principles of traditional Chinese medicine formulation, 5 parts chicken gizzard lining, 2.5 parts astragalus, 2 parts hawthorn, and 1.5 parts American ginseng are mixed at low speed in a V-type mixer for 30 minutes to achieve a powder mixing uniformity RSD ≤5%, forming a brownish-yellow composite powder.

[0082] The pharmacological effects of each component in this formula are different, as detailed below:

[0083] Chicken gizzard lining is sweet and neutral in nature, and enters the spleen and stomach meridians. Its main function in this formula is to promote digestion, strengthen the spleen and stomach, and improve loss of appetite and malnutrition caused by spleen deficiency.

[0084] Astragalus is sweet and warm in nature, and enters the spleen and lung meridians. Its main functions in this formula are to strengthen the body's qi, invigorate the spleen and raise yang, promote development, relieve loss of appetite, and enhance immunity.

[0085] Hawthorn, with its sour, sweet, and slightly warm properties, is beneficial to the spleen and stomach. In this formula, its main functions are to aid digestion, stimulate appetite, promote the production of body fluids, and improve loss of appetite and postprandial abdominal distension.

[0086] American ginseng, cool and sweet in nature, enters the heart and kidney meridians. Its main function in this formula is to regulate immunity, enhance energy, and alleviate fatigue. This formula uses chicken gizzard lining as the principal ingredient, combined with astragalus, American ginseng, and hawthorn, which can significantly improve indigestion in children, strengthen spleen and stomach function, and promote nutrient absorption.

[0087] Example 4

[0088] A method for preparing a chicken gizzard lining fermentation product

[0089] (1) Preparation of inoculated strains

[0090] The compound probiotic powder prepared in Example 2 was diluted with physiological saline to adjust the OD value of the powder. 600 The value was 1.0±0.05, and a compound bacterial solution was prepared. The final viable count of the compound bacterial solution was ≥1×10⁻⁵. 9 CFU / mL.

[0091] (2) Preparation of formulation culture medium

[0092] Add 20wt% of chicken gizzard lining formulation to the basal culture medium, adjust the pH to 6.5, and autoclave at 121℃ for 15min. Inoculate 5% of the above compound bacterial solution under aseptic conditions and ferment at 37℃ for 18h, maintaining a rotation speed of 150rpm. Basal culture medium components: glucose 2%, peptone 2%, sodium acetate 0.15%, dipotassium hydrogen phosphate 0.25%, with the remainder being water. Take a 100mL sample before inoculation. (3) Preparation of freeze-dried powder of chicken gizzard lining formulation fermentation product

[0093] After fermentation, the collected fermented samples and the unfermented samples taken before fermentation were sterilized by heating at 85°C for 30 min, centrifuged at 3000 rpm for 10 min to collect the supernatant, concentrated by rotary evaporation at 55°C to 20% of the original volume, and freeze-dried at -80°C to prepare the chicken gizzard lining fermentation product.

[0094] (4) Indicator Testing

[0095] During the fermentation process of probiotics, the enzymes secreted (such as pectinase and cellulase) further break down plant cell walls, thereby releasing more flavonoids and saponins. At the same time, they degrade macromolecules into smaller molecules, significantly improving bioavailability.

[0096] 1g of chicken gizzard lining fermentation product was weighed and added to 9mL of distilled water to prepare a 100mg / mL solution. The changes in active ingredients in the solution were measured. The total protein, total polysaccharides, total polyphenols, and total flavonoids in the chicken gizzard lining fermentation broth were detected according to national standard methods. Preliminary results, as shown in Table 2, indicate that the fermentation by the compound strains increased the content of peptides, polyphenols, and flavonoids in the fermentation broth, while decreasing the protein content. This suggests that fermentation not only altered the structure of the chicken gizzard lining formula and released its active substances, but also potentially degraded large protein molecules into smaller peptides, making them more susceptible to chelating metal ions and promoting the absorption of calcium, iron, and zinc. HPLC was used to detect organic acids in the chicken gizzard lining fermentation broth. The results showed that the UP180 and ID001 compound bacteria utilized citric acid and malic acid from the chicken gizzard lining formula for metabolism, converting these organic acids into acetic acid and lactic acid. This not only reduced the irritation of citric acid and malic acid to the gastrointestinal tract but also promoted the colonization of bifidobacteria in the intestines using acetic acid and lactic acid.

[0097] To compare the differences between fermentation using a combination of microbial strains and fermentation using a single strain, a comparative study of fermentation using different strains was set up.

[0098] Comparative Example 1

[0099] Replace the fermentation strain of the above chicken gizzard formula with a live bacteria count ≥1×10⁻⁶. 9 A single Lactobacillus rhamnosus UP180 bacterial suspension at CFU / mL was prepared, with all other procedures remaining unchanged;

[0100] Comparative Example 2

[0101] Replace the fermentation strain of the above chicken gizzard formula with a live bacteria count ≥1×10⁻⁶. 9 A single Lactobacillus paracasei ID001 bacterial suspension at CFU / mL was prepared, with all other procedures remaining unchanged;

[0102] Comparative Example 3

[0103] Replace the fermentation strain of the above chicken gizzard formula with a live bacteria count ≥1×10⁻⁶. 9 Use the commercially available strain *Lactobacillus rhamnosus* GG at CFU / mL, and keep the rest of the procedure unchanged.

[0104] The results are shown in Table 2. Fermentation of chicken gizzard lining by single strains UP180, ID001, and GG all altered the composition of the formulation to varying degrees. However, the combined strain fermentation significantly improved the composition compared to the single strain fermentation, indicating that the combined strain fermentation produces a more comprehensive enzyme system. The synergistic effect of the cellulase and pectinase produced effectively breaks down the cell walls of the medicinal materials, while the protease produced efficiently decomposes chicken gizzard lining—something difficult for single strains to achieve. By combining strains, large molecules in medicinal materials can be more effectively converted into smaller, more easily absorbed molecules, such as small peptides and lactic acid, significantly enhancing functional activity.

[0105] In the fermentation product of chicken gizzard lining after fermentation by the compound strain, this invention detected a small molecule hexapeptide (LVPGYF) with the sequence Leu-Val-Pro-Gly-Tyr-Phe.

[0106] This peptide is rich in hydrophobic amino acids, which makes it potentially more likely to interact with the hydrophobic pockets of digestive enzymes, and may have a potential absorption-enhancing effect.

[0107] LVPGYF extraction process:

[0108] ①Ultrasound-assisted extraction of chicken gizzard fermentation product was performed using 30% ethanol aqueous solution (450W, 30min);

[0109] ②Then adjust the pH to denature and precipitate the large protein molecules, and remove them by centrifugation;

[0110] ③ Add ethanol to the supernatant until the final concentration of ethanol in the solution is 70%, precipitate polysaccharides and remaining large molecular proteins, and retain the supernatant rich in small molecular peptides after centrifugation.

[0111] ④ Next, the crude extract was finely enriched and purified using a C18 solid-phase extraction column. The target hexapeptide was eluted with a 50%-80% methanol / acetonitrile aqueous solution, the eluent was collected, and the powder product was obtained by vacuum freezing.

[0112] LVPGYF identification:

[0113] ① Chromatographic separation: The processed peptide sample is separated using a reversed-phase liquid chromatography system. The chromatographic separation utilizes a capillary column packed with a C18 stationary phase; mobile phase A is an aqueous solution containing 0.1% (v / v) formic acid, and mobile phase B is an acetonitrile solution containing 0.1% (v / v) formic acid; a gradient elution program is employed, wherein the proportion of mobile phase B linearly increases from 3% to 28% within 60 minutes, further increases to 40% within 5 minutes, and then increases to 95% within 1 minute and maintains this level for 5 minutes to achieve column washing and reequilibration; the flow rate is controlled at 300 nL / min, and the column temperature is maintained at 40°C. ② Mass spectrometry detection: The chromatographically separated peptide is analyzed using a tandem mass spectrometer in data-dependent acquisition mode. The ionization process is performed in a positive ion nanoliter electrospray ionization mode, with the spray voltage set to 2.0 kV and the ion transport capillary temperature at 300°C. In the first-stage mass spectrometry scan, the full scan range was set to *m / z*350–1500, and the resolution was set to 60000. In the second-stage mass spectrometry scan, the 20 precursor ions with the highest intensity in the first-stage scan were selected and fragmented using high-energy collision-induced dissociation with a normalized collision energy of 28–32%; the MS / MS scan resolution was set to 15000, and the dynamic exclusion function was enabled with an exclusion time limit of 30 seconds.

[0114] ③ Sequence Identification: The obtained tandem mass spectrometry raw data is retrieved using a search engine relative to a protein sequence database of a specific organism. The search parameters are characterized by: trypsin as the enzyme selection factor, allowing a maximum of two missed cleavage sites; fixed modification specified as urea methylation of cysteine; variable modifications including methionine oxidation and acetylation of the protein N-terminus; precursor ion mass tolerance set to ±10 ppm; and fragment ion mass tolerance set to ±0.02 Da. Finally, the false positive detection rate threshold is controlled at ≤1% to screen for high-confidence peptide-mass spectrometry matches, thereby identifying the amino acid sequence.

[0115] The structure, molecular weight, and MS / MS scan results of LVPGYF are as follows: Figure 3 As shown, it is composed of leucine, valine, proline, glycine, tyrosine, and phenylalanine, with the molecular formula C. 36 H 50N6O8 has a molecular weight of 694.83. Its specific m / z values ​​are as follows: 694.369 (100.0%), 132.2 (25%), 249.34 (35%), 364.47 (40%), 439.54 (30%), 620.73 (20%), 166.2 (30%), 347.39 (45%), 422.46 (35%), 537.59 (25%), and 654.74 (20%). Its structure consists of hydrophobic residues and a rigid structure. By comparing it with structurally similar peptides found on the PepBank website, it is speculated that it may have a potential function in enzyme regulation.

[0116] Table 2. Changes in active ingredients of chicken gizzard membrane formulation after fermentation.

[0117]

[0118] Sensory evaluation of the fermentation broth was conducted, and the results are shown in Tables 3 and 4. Compared with single fermentation, compound fermentation imparts a richer aroma to the fermentation broth, a smoother and less astringent taste, and a lingering sweet aftertaste. In contrast, fermentation broths fermented with single strains, especially UP180 and GG, became noticeably more acidic after fermentation, resulting in an unbalanced overall flavor.

[0119] Table 3 Sensory Evaluation Criteria for Fermentation Broth

[0120] Evaluation Description Rating range sour Does the main flavor, derived from lactic acid, citric acid, etc., possess a bright, mellow, and rich character? 1-5 sweet Does it have a background sweetness to support the sourness, making the overall flavor more harmonious? 1-5 Bitterness (the most intense bitterness is 1) Is the bitterness of the medicinal material itself or from fermentation within an acceptable range? 5-1 Umami / Fullness The rich, full-bodied, and delicious taste brought by amino acids and small molecule peptides 1-5 aroma Does the overall aroma have a pure quality, and are there pleasant aromas such as wine, esters, flowers, and fruits? 1-5 Fishy smell (strongest fishy smell is 1) Does it have a noticeable fishy smell? 5-1 Texture / Smoothness The texture upon entry—is it smooth and rich, or does it have a slightly astringent or rough feel? 1-5 Aftertaste Does the lingering taste in the mouth after swallowing leave a clean, lasting, and sweet aftertaste? 1-5 Flavor harmony Overall evaluation: Are the various flavors balanced and harmonious? Is there any particular flavor that stands out? 1-5 Personal acceptance / 1-5 Total Score / 10-50

[0121] Table 4 Sensory evaluation results of fermentation broth for each group

[0122]

[0123]

[0124] Example 5

[0125] This embodiment evaluates the regulatory effect of the peptide LVPGYF on the expression of intestinal digestive enzymes by applying LVPGYF to differentiated mature Caco-2 cells and detecting changes in the gene transcription and expression levels of key digestive enzymes.

[0126] (1) Cell culture and differentiation:

[0127] Human Caco-2 cells were cultured in DMEM high-glucose medium (containing 10% fetal bovine serum, 1% non-essential amino acids, 100 U / mL penicillin, and 100 μg / mL streptomycin) at 37°C in a saturated humidity incubator with 5% CO2. Each passage lasted 24 hours and was continued for three generations. Experiments were conducted when the cells grew to cover 80-90% of the culture dish area.

[0128] (2) Experimental Groups:

[0129] ① Blank control group (Group C): Human Caco-2 cells were cultured in DMEM high glucose medium for 24 h only.

[0130] ②LVPGYF administration group: Human Caco-2 cells were cultured in DMEM high-glucose medium containing 100 μL LVPGYF for 24 h. (3) Sample collection:

[0131] After the intervention, the cells were gently washed with PBS, and all adherent cells were collected. The washing was repeated 2-3 times with pre-cooled PBS. Cells from each group were collected by centrifugation at 1000 rpm and then cryopreserved.

[0132] (4) Indicator detection:

[0133] ① Cytotoxicity assay: The effect of different concentrations of LVPGYF on the survival rate of Caco-2 cells was detected using a CCK-8 assay kit. ② Gene expression level assay: After extracting total RNA from cells, the expression levels of digestive enzyme-related regulatory genes AMY2, LPL, and PRSS1 in Caco-2 cells were detected using qPCR.

[0134] Table 5 Primers for qPCR analysis

[0135] Gene Forward primer (5'-3') Reverse primer (5'-3') AMY2 CTGGCGGAGACATCAAAGAC AGCCAGAGCCATGATGAAGA LPL GTGAAGGATGGGAGGGACAGC CCCTACAAATCAACCTGGCTCCATC PRSS1 ACTGCTACAAGTCCCGCATC TTCCTGTCGTATTGGGGGTG

[0136] ③ Cell digestive enzyme activity detection: Cells were sonicated at 400W, centrifuged at 12000rpm, and the supernatant was collected. The enzyme activity in the supernatant was measured using a protease, amylase and lipase kit.

[0137] Toxicity test results as follows Figure 4 As shown, when the concentration of LVPGYF is ≤100μM, the survival rate of Caco-2 cells is >95% and there is no toxic effect. Therefore, 100μM concentration of LVPGYF was used to intervene in the cells in the future.

[0138] Effects of LVPGYF on the expression of digestive enzyme genes in Caco-2 cells, such as Figure 5 As shown, under the intervention of LVPGYF, the expression of digestive enzyme genes in Caco-2 cells in this group was increased compared with that in group C, proving that LVPGYF can regulate the activity of intestinal digestive enzymes at the gene level.

[0139] The effects of LVPGYF on the digestive enzyme activity of Caco-2 cells are shown in Table 6. Under the intervention of LVPGYF, the activities of protease, lipase and amylase in this group of cells were all increased. The results were consistent with the gene expression detection results, which can verify that LVPGYF has the ability to participate in the regulation of digestive enzyme activity.

[0140] Table 6. Intestinal enzyme activity after Caco-2 cell intervention in each group

[0141] C LVPGYF Protease activity / U / mgprot 15.17 17.30 Amylase activity / U / mgprot 9.52 12.15 Lipase activity / U / mgprot 1.93 2.76

[0142] Example 6

[0143] The effect of chicken gizzard lining fermentation product on improving nutrient absorption in juvenile rats

[0144] This embodiment aims to evaluate, using a juvenile rat model, whether the fermented chicken gizzard lining formula can promote the absorption of key nutrients such as protein, fat, and calcium, and to preliminarily explore its possible mechanism of action. This embodiment uses the classic formula Sijunzi Decoction (ginseng, atractylodes macrocephala, poria cocos, and licorice), which is used to improve the spleen and stomach of children, as a positive control.

[0145] (1) Rat feeding:

[0146] Fifty-six 3-week-old male SPF-grade SD rats were randomly divided into 7 groups (n=8) after one week of adaptive feeding.

[0147] (2) Grouping of rats:

[0148] ① Normal blank control group (Group C): administered sterile saline by gavage; ② Compound bacterial powder intervention group (UI group): administered compound bacterial powder by gavage, with a live bacteria count of not less than 10⁸ / kg BW / d; ③ Compound bacterial strain fermentation intervention group (FUI group): administered compound bacterial chicken gizzard lining fermentation by gavage, at a dose of 100 mg / kg BW / d; ④ UP180 fermentation intervention group (FUP group): administered UP180 chicken gizzard lining fermentation by gavage, at a dose of 100 mg / kg BW / d. / kgBW / d; ⑤ID001 fermentation intervention group (FID group): Administered ID001 chicken gizzard lining fermentation by gavage at a dose of 100mg / kgBW / d; ⑥GG fermentation intervention group (FGG group): Administered rhamnose GG chicken gizzard lining fermentation by gavage at a dose of 100mg / kgBW / d; ⑦Sijunzi decoction intervention group (4JZ group): Administered Sijunzi decoction lyophilized preparation by gavage at a dose of 100mg / kgBW / d. The trial period was 21 days.

[0149] (3) Routine index detection in weaning rats:

[0150] The rats' weight gain, food intake, and body length were measured, and the food efficiency ratio (FER) was calculated. FER = weight gain (g) / food intake (g). In terms of growth performance, the FUI group showed the best performance, with the highest total weight gain and daily weight gain among all groups, significantly higher than the normal group. The daily weight gain of the FUP, FGG, 4JZ, and FID groups was higher than the control group but lower than the FUI group, and the differences between groups were relatively small. This indicates that, in addition to the compound bacterial chicken gizzard fermentation formula, the other experimental groups also promoted growth to some extent, but the effect was weaker than that of the compound bacterial chicken gizzard fermentation formula. Furthermore, this example found that the compound bacterial powder prepared from *Lactobacillus rhamnosus* UP180 and *Lactobacillus paracasei* ID001 also promoted mouse growth. Regarding food intake, the compound bacterial chicken gizzard fermentation formula intervention group, which showed the best growth performance, did not have the highest food intake, indicating that its growth advantage did not solely depend on increased food intake, but rather on promoting nutrient absorption and improving metabolic efficiency. Although the Sijunzi Decoction intervention group had the highest food intake, it had the lowest food efficiency ratio, further confirming that "high food intake ≠ high growth" and that improving food conversion efficiency is a key factor in promoting growth.

[0151] Table 7 Results of routine indicators detected in each group of weaning rats during the feeding period.

[0152] C UI FUI FUP FID FGG 4JZ Total weight increase / g 120.47 123.39 139.82 127.15 123.69 125.38 123.94 Average weight gain / g / day 5.74 5.88 6.66 6.05 5.89 5.97 5.90 Average food intake / g / d 17.52 16.95 17.27 16.73 17.19 16.85 18.42 Body length / cm 21.68 22.62 25.39 23.81 23.25 22.57 22.94 Food efficiency ratio 0.33 0.35 0.39 0.36 0.34 0.35 0.32

[0153] (4) Detection of serum parameters and bone length in weaning rats:

[0154] Blood was collected from rats, and the rats were euthanized. Serum levels of total protein (TP), albumin (ALB), calcium, iron, phosphorus, zinc, triglycerides (TC), total cholesterol (TG), and high-density lipoprotein (HDL-C / LDL-C) were measured. Growth levels and bone length were determined after three weeks. Serum parameters are shown in Table 8. Compared to the normal control group, each experimental group showed a positive regulatory effect on nutrient reserves, mineral metabolism, and lipid homeostasis, with the FUI group showing the most significant effect. Regarding nutrient reserves, the FUI group had the highest total protein and albumin levels among all groups, indicating that FUI can promote protein synthesis and enhance nutrient reserves. Furthermore, the FUI group had the best levels of calcium, iron, phosphorus, and zinc in its serum, and all experimental groups had higher mineral levels than group C, indicating that the experimental groups could improve the body's ability to absorb and accumulate minerals. Regarding the regulation of blood lipid homeostasis, the differences in total cholesterol and triglycerides among all groups were minimal compared to group C. However, the FUI group exhibited the highest HDL-C / LDL-C ratio, indicating that FUI can optimize blood lipid composition and enhance lipid metabolism health. In summary, the compound bacterial chicken gizzard fermentation product showed the most significant advantages in improving the body's nutrition and metabolism. Table 9 shows that, compared to the normal group, all experimental groups promoted femoral length, tibia length, and femoral dry weight, with the FUI group showing the most significant regulatory effect. In terms of linear bone growth, the FUI group had the highest femoral length (36.3 mm) and tibia length (43.2 mm) among all groups, significantly higher than other groups, indicating that the FUI group had the most prominent advantage in promoting bone growth and bone mass accumulation. In conclusion, FUI (compound bacterial chicken gizzard fermentation product) demonstrated significant and comprehensive advantages in improving the nutritional metabolism of rats, enhancing mineral absorption, and promoting bone growth, making it the most effective intervention group in this experiment.

[0155] Table 8. Results of serum marker detection in weaning rats of each group

[0156] C UI FUI FUP FID FGG 4JZ TP / mg / mL 60.56 61.8 69.60 66.65 65.03 67.20 64.84 ALB / mg / mL 33.21 34.13 38.20 37.24 36.50 37.35 35.18 Calcium / mmol / L 2.71 2.78 3.06 2.91 2.82 2.93 2.80 Iron / μmol / L 38.59 39.62 43.31 42.44 41.02 42.05 40.56 Phosphorus / mmol / L 2.40 2.46 2.64 2.63 2.51 2.69 2.52 Zinc / μmol / L 1.05 1.09 1.33 1.21 1.17 1.25 1.16 TC / mmol / L 1.90 1.95 2.00 1.96 1.93 1.98 1.92 TG / mmol / L 1.20 1.23 1.3 1.24 1.22 1.25 1.21 HDL-C / LDL-C 3.0 3.12 3.63 3.45 3.31 3.55 3.23

[0157] Table 9. Skeletal length of weaning rats after intervention in each group.

[0158] C UI FUI FUP FID FGG 4JZ Femur length / mm 33.52 33.78 36.35 35.91 34.67 35.33 33.94 Tibia length / mm 39.81 40.05 43.28 42.74 41.19 41.92 40.36 Femoral bone dry weight / mg 480.63 483.17 525.09 518.04 498.08 508.02 488.05

[0159] (5) Gene expression and digestive enzyme activity assay of intestinal digestive enzyme-related pathways in weaning rats:

[0160] After euthanizing the rats, the intact small intestine (from the duodenum to the ileocecal junction) was immediately removed and placed on ice to maintain enzyme activity. The intestinal contents were gently squeezed out and collected in pre-chilled centrifuge tubes. The contents could be flushed out by irrigating the small intestine with pre-chilled physiological saline. The small intestine was then longitudinally cut open, preserving the intestinal tissue, and the mucosal layer was gently scraped off with a glass slide. The intestinal tissue and contents were separately mixed with pre-chilled physiological saline at a weight-to-volume ratio of 1:9 and homogenized in an ice-water bath. The homogenate was centrifuged at 4°C and 5000 rpm for 10 minutes, and the supernatant was collected as the tissue fluid and enzyme solution to be tested. The expression levels of pancreatic digestive enzyme-related regulatory genes AMY2, LPL, and PRSS1 in rat small intestinal tissue were detected using qPCR. Figure 6 The results showed that the FUI group could enhance the activity of digestive enzymes in the small intestinal contents by stimulating the expression of AMY2, LPL, and PRSS1 genes. The primers for qPCR analysis were the same as those in Table 5.

[0161] The enzyme activities in the supernatant were determined using protease, amylase, and lipase kits. The results are shown in Table 10. All experimental groups showed an enhancement effect on the activities of protease, amylase, and lipase in rats, with the FUI group exhibiting the most significant promoting effect. Therefore, the compound bacterial chicken gizzard fermentation formula demonstrates a significant advantage in enhancing the activity of key digestive enzymes of the three major nutrients (protein, carbohydrates, and fats), effectively strengthening the body's digestive function and laying the foundation for nutrient absorption and utilization.

[0162] Table 10 Intestinal enzyme activity in weaning rats after intervention in each group

[0163] C UI FUI FUP FID FGG 4JZ Protease activity / U / mgprot 125.05 126.18 165.12 158.2 140.98 151.10 132.89 Amylase activity / U / mgprot 35.52 35.89 48.21 45.88 39.05 42.56 37.03 Lipase activity / U / mgprot 18.21 18.37 24.52 22.82 20.09 21.58 19.07

[0164] The synergistic effects of the compound probiotic powder and chicken gizzard lining fermentation product in a rat model, which enhanced digestive enzyme activity, nutrient metabolism regulation, and bone growth promotion, have significant value in translational research on children's nutrient absorption. They can address the problem of insufficient macronutrient degradation in children due to immature digestive systems by upregulating the activities of proteases, amylases, and lipases. They can also improve the imbalance in the absorption of minerals such as calcium, iron, and zinc by leveraging the coupling mechanism of micronutrient intestinal absorption. Furthermore, they can maintain the homeostasis of the nutrient supply chain by regulating intestinal flora and optimizing blood lipid composition, thus providing a balanced substrate for children's growth and development.

[0165] Example 7

[0166] Preparation of a Probiotic Complex Product Containing Chicken Gizzard Fermentation Formula to Promote Nutrient Absorption in Children This embodiment provides a method for preparing a probiotic complex product containing chicken gizzard fermentation formula to promote nutrient absorption in children, comprising the following components: 1.2 parts chicken gizzard fermentation formula, 1 part jujube powder, 0.8 parts prickly pear powder, 0.8 parts yam powder, 0.3 parts fructooligosaccharide, 0.3 parts monk fruit powder, 0.2 parts stachyose, 0.2 parts isomaltooligosaccharide, 0.1 parts GABA, 0.05 parts casein phosphopeptide, and 0.05 parts of a compound bacterial powder of *Lactobacillus rhamnosus* UP180 and *Lactobacillus paracasei* ID001 (live bacteria count of 500 billion / gram).

[0167] The core functions of jujube powder, prickly pear powder, yam powder, and monk fruit powder among the above components are to enhance the body's immunity and aid digestion and absorption. The core functions of fructooligosaccharides, stachyose, and isomaltooligosaccharides among the above components are to supplement intestinal prebiotics, help bacterial colonization, and regulate the intestinal flora.

[0168] Among the above components, GABA's core function is to improve children's sleep, shortening sleep latency by approximately 30% and prolonging deep sleep duration. Casein phosphopeptide's core function is to chelate calcium, iron, and zinc ions, enhancing absorption and increasing bone density in children. This product's formula employs a systematic design approach, aiming to synergistically promote children's nutrient absorption and overall health.

Claims

1. A polypeptide, characterized in that: The amino acid sequence of the polypeptide is Leu-Val-Pro-Gly-Tyr-Phe.

2. A fermentation product comprising the polypeptide as described in claim 1, characterized in that: It was obtained by fermenting chicken gizzard lining, astragalus, hawthorn and American ginseng by Lactobacillus rhamnosus UP180 and Lactobacillus paracasei ID001.

3. An application of the fermented product as described in claim 2, characterized in that: It can be used to prepare drugs or foods that upregulate the expression of intestinal AMY2, LPL, and PRSS1 genes; or Used in the preparation of pharmaceuticals or foods that promote the absorption of metal mineral ions in the intestine; or It can be used to prepare drugs or foods that enhance the activity of intestinal digestive enzymes.

4. The method for preparing the fermented product as described in claim 2, characterized in that: Includes the following steps: S1: Mix chicken gizzard lining (5 parts by weight), astragalus root (2.5 parts by weight), hawthorn fruit (2 parts by weight), and American ginseng (1.5 parts by weight) to obtain the chicken gizzard lining formula; S2: After activating Lactobacillus rhamnosus UP180 and Lactobacillus paracasei ID001 for three generations, adjust the OD value with physiological saline. 600 Mix 1 part to 1 part thoroughly. S3: Add 20wt% of the chicken gizzard lining compound prepared in step S1 to the basal culture medium, adjust the pH to 6.5, and then autoclave at 121℃ for 15 min. S4: Inoculate 5% of the composite bacterial solution prepared in step S2 under aseptic conditions, ferment at 37°C for 18 hours, and maintain a rotation speed of 150 rpm. S5: After fermentation, heat at 85℃ for 30 minutes to sterilize, centrifuge at 3000 rpm for 10 minutes to collect the supernatant, concentrate by rotary evaporation at 55℃ to 20% of the original volume, freeze dry at -80℃ to prepare the chicken gizzard lining fermentation product.

5. The method for preparing the fermented product as described in claim 4, characterized in that: The basal culture medium consists of 2% glucose, 2% peptone, 0.15% sodium acetate, 0.25% dipotassium hydrogen phosphate, and the remainder is water.

6. A probiotic compound preparation for promoting nutrient absorption in children, characterized in that: The components include the following parts by weight: The mixture as described in claim 2 comprises 1.2 parts of fermented product, 1 part of jujube powder, 0.8 parts of prickly pear powder, 0.8 parts of yam powder, 0.3 parts of fructooligosaccharide, 0.3 parts of monk fruit powder, 0.2 parts of stachyose, 0.2 parts of isomaltooligosaccharide, 0.1 parts of GABA, 0.05 parts of casein phosphopeptide, and 0.05 parts of compound bacterial powder; The compound bacterial powder includes Lactobacillus rhamnosus UP180 and Lactobacillus paracasei ID001.

7. The probiotic compound preparation for promoting nutrient absorption in children as described in claim 6, characterized in that: The number of live bacteria in the compound bacterial powder is 500 billion per gram.

8. The probiotic compound preparation for promoting nutrient absorption as described in claim 6, characterized in that: The preparation method of the compound microbial powder includes the following steps: S1: Take out the cryopreserved glycerol tubes of Lactobacillus rhamnosus UP180 and Lactobacillus paracasei ID001, streak them in MRS solid medium to activate them, and after single colonies grow, pick out single colonies and inoculate them into liquid medium. Subculture every 24 hours, repeating the subculture three times. S2: The activated Lactobacillus rhamnosus UP180 and Lactobacillus paracasei ID001 were inoculated into a fermenter containing MRS medium at an inoculation rate of 2%, fermented at 37℃ for 20h, centrifuged at 4000g for 10min, and the bacterial sludge was collected. S3: Under aseptic conditions, the bacterial sludge and freeze-drying protectant were mixed evenly at a ratio of 1:1, freeze-dried at -80℃ until dehydrated and ground evenly to prepare Lactobacillus rhamnosus UP180 bacterial powder and Lactobacillus paracasei ID001 bacterial powder, respectively. S4: Mix Lactobacillus rhamnosus UP180 bacterial powder and Lactobacillus paracasei ID001 bacterial powder at a mass ratio of 1:1 to prepare a compound bacterial powder.

9. The probiotic compound preparation for promoting nutrient absorption as described in claim 8, characterized in that: The MRS culture medium consists of: 10.0 g / L casein digest, 10.0 g / L beef extract, 4.0 g / L yeast extract, 20.0 g / L glucose, 2.0 g / L triammonium citrate, 2.0 g / L dipotassium hydrogen phosphate, 5.0 g / L sodium acetate, 0.2 g / L magnesium sulfate, 0.05 g / L manganese sulfate, 1.0 g / L Tween, with the remainder being water. The MRS solid culture medium is prepared by adding 20 g / L agar to the above components.

10. The probiotic compound preparation for promoting nutrient absorption in children as described in claim 8, characterized in that: The freeze-drying protectant for freeze-dried Lactobacillus rhamnosus consists of 10% skim milk powder, 8% trehalose, 2% mannitol, 0.1% Tween 80, 1% monosodium glutamate, 0.05% vitamin C, and the remainder is water. The freeze-drying protectant for *Lactobacillus paracasei* consists of 10% skim milk powder, 8% trehalose, 5% maltose, 2% mannitol, and the remainder is water.

Images