MaRIN4 gene promoter responding to fusarium oxysporum stress in bananas and application of MaRIN4 gene promoter
By cloning and constructing the MaRIN4pro promoter of the banana wilt pathogen, the problem of variety monopoly and disease-resistant variety breeding caused by banana wilt pathogen infection was solved. It also achieved effective regulation of gene expression under FocTR4 stress and improved the disease resistance of plants.
Patent Information
- Application Number
- CN202511821939.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-05
- Publication Date
- 2026-01-27
AI Technical Summary
The fungus wilt of banana (FocTR4) has a wide range of infection, resulting in a single main banana variety and difficulty in breeding disease-resistant varieties. Existing constitutive promoters have side effects and instability, making it difficult to effectively regulate gene expression.
A promoter for the MaRIN4 gene, MaRIN4pro, in bananas that responds to Fusarium wilt stress was provided. PCR amplification primers were designed and a plant recombinant expression vector p1300-MaRIN4pro:GUS was constructed. Tobacco and bananas were transformed using Agrobacterium-mediated transformation to verify the promoter activity under FocTR4 stress.
The MaRIN4 gene promoter is significantly activated under FocTR4 stress, driving GUS gene expression. Transgenic tobacco showed resistance, suggesting that it can be used to improve banana resistance to Fusarium wilt, providing a theoretical basis for breeding disease-resistant varieties.
Smart Images

Figure CN121406641A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of plant molecular biology, specifically to a mechanism in bananas that responds to stress from Fusarium wilt pathogens. MaRIN4 Gene promoters and their applications. Background Technology
[0002] Banana (Musa spp.) is an important tropical and subtropical economic crop, and its industry is severely affected by Fusarium wilt. Banana Fusarium wilt, also known as Panama disease, is caused by Fusarium oxysporum (Fusarium oxysporum). Fusarium oxysporum f.sp. cubense , Foc Vascular bundle diseases caused by Cuban-specific strains. Foc It can be divided into 4 physiological races, among which tropical race 4 (TR4) is the most widespread and damaging fungus that causes banana wilt.
[0003] The main banana varieties are parthenocarpic, meaning they can only be propagated asexually through division or tissue culture. This results in a limited variety of main banana species and makes it difficult to develop disease-resistant varieties. Since most main varieties are triploid with low female flower fertility, it is difficult to efficiently breed new varieties through hybridization. With the development of transgenic technology, using it to develop new varieties resistant to banana wilt disease has become an important approach.
[0004] Promoters are the most important cis-elements in gene expression regulation. They interact with trans-acting factors such as RNA polymerase and other protein cofactors to regulate gene expression at the transcriptional level. In short, gene transcription cannot be completed without a promoter. Based on their mode of action, promoters can be classified into constitutive promoters and specific promoters. Constitutive promoters can consistently regulate the expression of structural genes at a certain level, such as the CaMV35S promoter of cauliflower mosaic virus. However, the use of constitutive promoters has certain limitations and may lead to some side effects. Furthermore, researchers have pointed out that repeatedly using a single constitutive promoter to drive the expression of two or more exogenous genes may cause gene expression rearrangements and instability.
[0005] Promoters used in biotechnology applications are mainly classified into four types: constitutive promoters, tissue-specific promoters, inducible promoters, and synthetic promoters. Tissue-specific promoters can drive the expression of target genes at specific stages, enabling them to participate in the growth and development of specific plant tissues or organs. This avoids the unpredictable polymorphic effects that may occur in transgenic plants when using constitutive promoters. Tissue-specific promoters can be further divided into tissue-specific expression promoters and inducible expression promoters. Tissue-specific expression promoters enable gene expression in specific tissues, mainly manifested in their regulation of gene expression showing clear tissue and organ specificity, regulated by plant organ development. Under normal circumstances, inducible expression promoters basically do not initiate gene transcription or have low transcriptional activity. Only when the plant is stimulated by external factors do they initiate the large-scale expression of response genes within the plant, ultimately leading to physiological and biochemical responses. These promoters include light-induced promoters, ethanol-induced promoters, stress-induced promoters (such as the rd29A promoter), and pathogen-induced promoters (such as the PR promoter). Therefore, selecting appropriate tissue-specific promoters in plants can effectively regulate the expression of target genes, thereby improving crop traits. The use of tissue-specific promoters plays an important role in breeding disease-resistant banana varieties. Summary of the Invention
[0006] The purpose of this invention is to overcome the shortcomings of the prior art and provide a method for responding to Fusarium wilt stress in bananas. MaRIN4 Gene promoters and their applications.
[0007] To achieve the above objectives, the technical solution designed by the present invention is as follows: This invention provides a banana response to Fusarium wilt stress. MaRIN4 Gene promoter MaRIN4 pro, the MaRIN4 Gene promoter MaRIN4 The nucleotide sequence of pro is shown in SEQ ID NO:1.
[0008] The present invention also provides a method for preparing the above-mentioned... MaRIN4 Gene promoter MaRIN4 pro, this method is based on the MaRIN4 gene promoter. MaRIN4 PCR amplification primer pairs were designed based on the nucleotide sequence of pro. MaRIN4 pro - F / R; Using banana genomic DNA as a template, the promoter was amplified using the designed PCR primer pair.
[0009] Furthermore, the primer pair MaRIN4 pro - F / R is as follows: MaRIN4proF: GAGCGGATCTTTAGAAGCCTGCAAT, as shown in SEQ ID NO:2; MaRIN4 proR: TTGGATTGTAATGCATGACGCACTG, as shown in SEQ ID NO:3.
[0010] This invention also provides a plant recombinant expression vector p1300-MaRIN4pro:GUS, wherein the recombinant vector contains the above-mentioned... MaRIN4 Vectors for gene promoters.
[0011] The present invention also provides the above-mentioned MaRIN4 Application of gene promoters in regulating efficient gene expression in plants.
[0012] This invention also provides a plant recombinant expression vector p1300-MaRIN4pro-MaRIN4, wherein the recombinant vector contains the aforementioned MaRIN4 gene promoter and MaRIN4 The carrier of genes, among which, MaRIN4 The nucleotide sequence of the gene is shown in SEQ ID NO:4.
[0013] Furthermore, the vector is the plant expression vector p1300.
[0014] The present invention also provides a host cell containing the above-mentioned recombinant expression vector, wherein the host cell is GV3101.
[0015] The application of one of the following in the breeding of plant varieties resistant to Fusarium wilt, wherein it includes: (1) The above-mentioned plant recombinant expression vector p1300-MaRIN4pro:GUS; (2) The host cells mentioned above.
[0016] Furthermore, the plant is tobacco or banana.
[0017] The beneficial effects of this invention are: This invention relates to MaRIN4 The gene was analyzed in depth. Using Agrobacterium-mediated transformation, this gene was transformed into tobacco to obtain stably expressed transgenic lines. Disease resistance was evaluated, and the results showed that the transgenic tobacco exhibited resistance to Fusarium wilt, suggesting that this gene plays a role in banana resistance to Fusarium wilt. MaRIN4 The gene promoter was cloned and constructed upstream of the GUS reporter gene to drive GUS gene expression studies. Foc The response of TR4 was observed. The activity of this promoter was verified in banana roots using an Agrobacterium-mediated method, and it was found that in uninoculated bananas... FocTR4 banana root system MaRIN4 Gene promoter activity is low, while inoculation Foc After TR4, MaRIN4 This gene promoter exhibits high activity, comparable to that of the 35S promoter under normal conditions, and can serve as a promoter for bananas. Foc TR4-induced root-specific promoters provide an important tool for regulating gene expression using promoters to improve banana disease resistance and provide a theoretical basis for breeding Fusarium wilt resistant plant varieties. Attached Figure Description
[0018] Figure 1 for MaRIN4 pro clone diagram; Figure 2 for MaRIN4 Pro-active GUS staining image; Figure 3 for MaRIN4 pro GUS enzyme activity assay graph; Figure 4 This is a PCR detection image of genetically modified tobacco. In the figure, A is the PCR detection diagram of the screening marker hygromycin gene, and B is the PCR detection diagram of the MaRIN4 gene; Figure 5 Inoculate transgenic plants and wild-type tobacco seedlings with tobacco Foc Observation chart of symptoms after onset. Detailed Implementation
[0019] The present invention will now be described in further detail with reference to specific embodiments, so that those skilled in the art can understand it.
[0020] Example 1: Response of bananas to Fusarium wilt stress MaRIN4 Gene promoter cloning The sequence of the first 2000 bp of the start codon of this gene was searched in the banana genome database. The core region of the MaRIN4 gene promoter was found to be approximately 1198 bp in length using online software https: / / www.fruitfly.org / seq_tools / promoter.html. Primers were designed based on the sequence (primers are shown in Table 1).
[0021] Table 1 Primers used Using Brazilian banana root DNA as a template, PCR amplification was performed using a high-fidelity enzyme (amplification system is shown in Table 2; amplification conditions are shown in Table 3). The promoter fragment was obtained and ligated into the pMD18-T vector (ligation system is shown in Table 4). The ligation was carried out overnight at 16°C and transformed into DH5α Escherichia coli.
[0022] The specific transformation method for E. coli is as follows: (1) Take the competent DH5α out of the -80℃ freezer and quickly place it on ice. After the competent state melts, add the ligation product and mix well. Let it stand on ice for 25 min. (2) Heat shock in a 42℃ water bath for 45s, then quickly place on ice and let stand for 2min; (3) Add 700 μL of antibiotic-free sterile culture medium LB to the centrifuge tube, mix well, and place in a shaker at 37°C for 60 min at 200 r / min. (4) Centrifuge at 5000 r / min for 1 min to collect the bacterial cells, and keep about 100 μL of supernatant. Gently blow the bacterial block to resuspend the bacterial block in LB medium, and spread the bacterial solution on LB solid medium containing Amp resistance. (5) Invert the plate and incubate it overnight in a 37°C incubator.
[0023] Table 2 Full-length amplification PCR reaction system Single colonies were picked from LB agar plates and added to 500 µL of LB liquid medium containing 100 mg / L Amp. The plates were incubated overnight at 37°C with shaking at 220 rpm. Subsequently, PCR was performed to detect positive bacterial colonies. The PCR detection system is shown in Table 8. The PCR reaction conditions are shown in Table 3. The detected positive bacterial colonies were sent to Shanghai Bioengineering Co., Ltd. for sequencing.
[0024] Table 3 PCR reaction procedure Add 20 µL of the correctly sequenced bacterial culture to 20 mL of LB liquid medium containing 100 mg / L Amp, and incubate overnight at 37°C with shaking at 220 rpm. Extract the plasmid using the Omega plasmid extraction kit (refer to the product instruction manual for the method).
[0025] Table 4 pMD18-T vector linker system DNA was extracted from banana leaves and amplified by PCR using the DNA as a template. The PCR amplification was then detected by agarose gel electrophoresis. Figure 1 As shown in the figure, the size of the PCR amplification product is consistent with the predicted result, at 1198 bp. This indicates that the target gene was obtained in the Brazilian banana, representing the response of bananas to Fusarium wilt stress. MaRIN4 Gene promoter, and named MaRIN4 pro; its nucleotide sequence is shown in SEQ ID NO:1:
[0026] Example 2: Plant recombinant expression vector p1300-MaRIN4pro:GUS The plant expression vector p1300-MaRIN4pro:GUS was constructed using homologous recombination. Primers used are listed in Table 5. PCR amplification was performed. MaRIN4 Gene promoters were used to recover amplification products using the Omega purification and recovery kit (method as described in the product instruction manual).
[0027] Table 5 Primers used P1300 carrier was respectively subjected to Spe I and BamH Double digestion with enzyme I (digestion system shown in Table 6) was performed at 37℃ for 12-18 h. The digestion products were subjected to 0.1% agarose gel electrophoresis, and the target fragment was recovered using an Omega gel extraction kit (method as per product instructions). The target fragment was ligated to the p1300 vector with homologous recombinase (ligation system shown in Table 7) to obtain the plant recombinant expression vector p1300-MaRIN4pro:GUS (abbreviated as p1300-MaRIN4pro:GUS vector). Ligation was performed overnight at 16℃ and transformed into DH5α Escherichia coli (transformation method, detection, sequencing, and plasmid extraction were performed according to the promoter cloning method). The p1300-MaRIN4pro:GUS vector and the pBI121 empty vector were transformed into Agrobacterium GV3101 strain using the freeze-thaw method for later use.
[0028] Table 6. Double enzyme digestion reaction system Table 7 Connection Reaction System The Agrobacterium-mediated transformation method is as follows: (1) Take GV3101 competent cells out of the -80℃ freezer and quickly place them on ice. After the bacteria thaw, add 0.5 μg of plasmid DNA and mix well. Then place them on ice for 5 min, in liquid nitrogen for 5 min, in a 37℃ water bath for 5 min, and in an ice bath for 5 min. (2) Add 700 μL of antibiotic-free YEP liquid medium and incubate at 28°C with shaking for 2-3 hours; (3) Centrifuge at 6000 r / min to collect the bacterial cells, and keep about 100 μL of supernatant. Gently pipette the bacterial cells to resuspend them in the culture medium. Spread the resuspended bacterial solution on YEP solid medium containing 50 mg / L Kan and 25 mg / L Rif, and invert it in a 28℃ incubator for 2-3 days.
[0029] Single colonies were picked from YEP plates and added to 5 mL of YEP liquid medium containing 50 mg / L Kan and 25 mg / L Rif. The medium was incubated at 28°C with shaking at 200 rpm for 48 h, followed by PCR detection for bacterial colony positivity. The PCR detection system is shown in Table 8. The PCR reaction conditions are shown in Table 3.
[0030] The bacterial culture that tested positive was streaked on YEP solid medium containing 50 mg / L Kan and 25 mg / L Rif, and incubated upside down in a 28°C incubator for 2-3 days. Once single colonies have grown, they were ready for use.
[0031] Table 8. Bacterial PCR Identification Reaction System Example 3 MaRIN4 Gene promoter activity identification 1. P1300-MaRIN4pro - The steps for culturing GUS vector and pBI121 Agrobacterium are as follows: (1) Pick a single colony and place it in 5 mL of YEP (containing Rif and Kan) liquid medium. Incubate on a shaker at 200 r / min and 28 °C until OD500 is reached. 600 =1.0; (2) The bacterial culture from (1) was diluted 1:50 in 50 mL of antibiotic-free YEP medium and cultured on a shaker at 200 r / min and 28 °C until OD was reached. 600 =0.8-1.0; (3) Transfer the bacterial culture to a 50 mL centrifuge tube in a clean bench, centrifuge at 3000 r / min for 5 min, collect the bacterial cells, resuspend the bacterial cells in 2-(N-morpholino)ethanesulfonic acid (MES) buffer, add 200 μmol / L acetylsuccinone to the suspension, let stand at room temperature for 2 h before use for infection.
[0032] 2. The method for instantaneous transformation of banana root systems is as follows: (1) Cut disease-free young banana roots on a clean bench, cut them into 1cm lengths and soak them in bacterial solution for 30 minutes; (2) Discard the bacterial solution, place the roots on filter paper to absorb the excess bacterial solution, and then place them on MS solid medium containing 200 μmol / L acetylsyringone; (3) The infected roots were placed in a dark place at 26℃ for 48 hours.
[0033] 3. The specific steps for GUS staining are as follows: (1) Prepare GUS staining working solution; add 20µL X to 1mL GUS buffer. GluC reagent should be prepared and used immediately. (2) After washing the culture medium off the roots that have been cultured for 48 h, place them in GUS staining solution, completely cover them, wrap them in aluminum foil, and incubate them overnight in an incubator at 37°C. (3) As the incubation time increases, the roots gradually turn blue; (4) Decolorize with anhydrous ethanol and take a picture.
[0034] 4. GUS enzyme activity was measured using a plant β-glucuronidase (β-GUS) ELISA kit. The specific steps are as follows: (1) After washing the culture medium off the banana roots that have been cultured for 48 hours, take 0.2g and grind them thoroughly in liquid nitrogen; (2) Add 400 μL of GUS extraction buffer, grind into a homogenate, place in a 1.5 mL centrifuge tube, shake for 5 min, centrifuge at 4 °C and 13000 rpm for 10 min to precipitate cell debris, and collect the supernatant for later use. (3) Sample addition: Set up blank wells, standard wells and sample wells respectively. Add 100 μl of sample diluent to the blank wells and add 100 μl of standard or sample to the remaining wells respectively. Avoid air bubbles, gently shake to mix, cover or cover the plate with a lid, and react at 37°C for 120 minutes. (4) Discard the liquid and shake dry; add 100 μl of detection solution A working solution to each well, cover the microplate with a membrane, and react at 37°C for 60 minutes; (5) After incubation for 60 minutes, discard the liquid in the wells, spin dry, wash the plate 3 times, soaking for 1-2 minutes each time, about 400 μl / well, and spin dry; (6) Add 100 μl of detection solution B working solution to each well, cover the microplate with a membrane, and react at 37°C for 60 minutes; (7) After incubation for 60 minutes, discard the liquid in the wells, spin dry, wash the plate 5 times, soaking for 1-2 minutes each time, 350 μl / well, and spin dry; (8) Add 90 μl of substrate solution to each well in sequence, cover the plate with a membrane and develop color at 37°C in the dark. The first 3-4 wells of the standard have a clear gradient of blue color, while the gradient of the last 3-4 wells is not obvious. Stop the process. (9) Add 50 μl of the stop solution to each well in sequence to stop the reaction. At this time, the blue color will immediately turn yellow. (10) Immediately use an ELISA reader to measure the optical density (OD value) of each well in sequence at a wavelength of 450 nm. (11) Calculation: Plot the standard curve on graph paper with the concentration of the standard as the x-axis and the OD value as the y-axis. Find the corresponding concentration from the standard curve based on the OD value of the sample. Then multiply by the dilution factor. Alternatively, use the concentration and OD value of the standard to calculate the linear regression equation of the standard curve. Substitute the OD value of the sample into the equation to calculate the sample concentration. Then multiply by the dilution factor to get the actual concentration of the sample.
[0035] The results showed that in the banana root system, MaRIN4 The pro's blue color is lighter than the 35S starter, and there is very little blue on the root system, indicating... MaRIN4 The pro promoter activity is weaker than that of the 35S promoter; inoculation Foc TR4 after MaRIN4 The pro promoter exhibits a blue color with the same degree of blue coloration as the 35S promoter. The GUS enzyme activity of the above samples was measured; the 35S promoter enzyme activity was 3.97 nmol·mg⁻¹·min⁻¹. MaRIN4 Gene promoter MaRIN4 The pro activity was 1.45 nmol·mg⁻¹·min⁻¹, after inoculation. Foc TR4 after MaRIN4 Gene promoter MaRIN4 The pro activity was 4.29 nmol·mg⁻¹·min⁻¹, indicating a significant increase in enzyme activity, consistent with the trend observed in GUS staining. This suggests that inoculation... Foc TR4 can activate MaRIN4 Gene promoter MaRIN4 The activity of pro ( Figure 2 and Figure 3 ).
[0036] Example 4 1. Constructing plant expression expression The GUS gene in pBI121 and the above-mentioned vectors was replaced with the MaRIN4 gene to construct pBI121-35S+MaRIN4 and the plant expression vector p1300-MaRIN4pro-MaRIN4, respectively. The vector construction method, E. coli transformation method, and Agrobacterium-mediated transformation method were the same as above. The nucleotide sequence of the MaRIN4 gene is shown in SEQ ID NO:4. atggctcaacgaggacacgtaccgcgtttcggtgattggaacgagaacgctgcctacacgatatgcttcgacacggcacgcaaggggaaagttgccggaggcaacatcgtcaacccaaatgatccagagcagagccctgagctccacaagcctgctgcaatggctgctgc agaaccccagcatcctaagcaaggccgcggggacaaggccgtggagttcaatatcgcgaatcagcatcatcagggagcaaattatgtcagggaagagaggagggaagagaggcaattccaaggatacccaagctgcaccgcagcctcgaggtagcggtggtcagagaa caggggcacgcaggaacccaggtgaagctggctatgtccggtctccatcgccggtaacacagggtagagcagcaaattctcgacaaaatgtcgctgggcgccaaagacccgcgacggtacccaagttcggcgaatgggatgcagcggacccgaaatcagcaggatacacg gtcatcttcaaccaggttaaagaggaaaagaagacagccgtcgcttgggtccccgcagttccggttcaacctgcacgatctccggccaccgagagggcgcaccacaatgattcgtactggattggggtatgcaccaagcttggtttcctgtattctccatgcgttacttga 2. Tobacco Conversion a. Tobacco transformation using Agrobacterium-mediated transformation, the steps are as follows: Sterile tobacco seedlings were obtained in 1.5 ml sterile centrifuge tubes. Tobacco seeds were soaked in 75% ethanol for 30-60 seconds and rinsed three times with sterile water; then soaked in 20% NaClO for 5 minutes and rinsed three times with sterile water; the seeds were resuspended in anhydrous ethanol and transferred to sterile filter paper; after drying, the seeds were sown on petri dishes containing MS medium using sterile toothpicks and incubated in the dark at 26°C for one week. When the tobacco seedlings grew to about 1.5 cm, they were transferred to tissue culture flasks for further culture.
[0037] b. Tobacco genetic transformation is performed using the leaf disc transformation method. The steps are as follows: (1) Cut sterile tobacco leaves into pieces about 0.5cm in size. 2Leaves were placed on a pre-culture medium and cultured for 2 days for later use. (2) Leaves that have been pre-cultured for 2 days are placed in the resuspended bacterial solution and soaked for 10 minutes, during which they are slowly shaken 2-3 times. (3) Remove the leaves, place them on sterile filter paper to absorb excess bacterial solution, and transfer the leaves to a co-culture medium for dark incubation for 2 days; (4) The leaves were transferred to the differentiation medium and cultured at 26°C for 8 hours under light and 24°C in the dark for 16 hours. The medium was changed every 2 weeks until callus and buds differentiated. (5) When the buds grow to a height of about 2cm, transfer them to a rooting medium to induce rooting; (6) Transplant the rooted plants into nutrient pots and place them in a greenhouse for cultivation.
[0038] 3. Positive identification of genetically modified tobacco PCR was used to detect the transformation of tobacco plants. Tobacco DNA was extracted using a plant genomic DNA extraction kit (Tiangen), following the manufacturer's instructions. Using transgenic tobacco DNA as a template, the full-length selection marker hygromycin gene and the target gene MaRIN4 were amplified, with wild-type tobacco DNA serving as a negative control. Hygromycin primer: HygF: CTGCCCGCTGTTCTACAACCGG, HygR:GGAGCATATACGCCCGGAGTC; Target gene primers: MaRIN4F:ATGGCTCAAAGAGGACACGT, MaRIN4R: TCAAGTAACGCATGGAGAAT.
[0039] PCR products of approximately 480 bp and 680 bp were amplified in the genome of transgenic tobacco, respectively, and were the same size as the positive control PCR product using the vector plasmid as a template. Figure 4 No PCR products were amplified in the wild-type tobacco genome, and the preliminary results indicate that... MaRIN4 Genes are integrated into the tobacco genome.
[0040] 4. Tobacco disease resistance identification Wild-type lines, OE (Overexpression, OE)-35S-MaRIN4, and OE-MaRIN4pro-MaRIN4 transgenic tobacco plants with consistent growth status were selected and subjected to 1.0 × 10⁻⁶ PCR. 6 The concentration of spores in *Fusarium oxysporum* at condia / mL ( ) Fusarium oxysporum , FocSoak the roots in the bacterial solution for 2 hours, then discard the excess solution. Cultivate the roots under the following conditions: 26°C, 8 hours of light, 23°C, and 16 hours of darkness. Observe the symptoms of tobacco disease after half a month.
[0041] During vaccination Foc The growth status of the pre-transgenic and wild-type tobacco was basically the same. However, two weeks after inoculation, the wild-type plants showed significant yellowing and severe wilting of leaves, with some even dying completely. In contrast, the transgenic lines maintained good growth. The transgenic tobacco line overexpressing MaRIN4pro-MaRIN4 (OE-MaRIN4pro-MaRIN4 transgenic tobacco plants) was more resistant than the transgenic tobacco line overexpressing 35S-MaRIN4. Foc Strong ability ( Figure 5 ),illustrate MaRIN4 Pro can be used in bananas Foc The TR4-induced root-specific promoter provides an important tool for regulating gene expression and thus improving the disease resistance of bananas.
[0042] All other parts not described in detail are existing technologies. Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.
Claims
1. A banana response to Fusarium wilt stress MaRIN4 Gene promoters, characterized by: The MaRIN4 The nucleotide sequence of the gene promoter is shown in SEQ ID NO:
1.
2. A method for preparing the MaRIN4 gene promoter as described in claim 1 MaRIN4 pro, characterized in that, The method is MaRIN4 PCR amplification primer pairs were designed based on the nucleotide sequences of the gene promoter. MaRIN4 pro - F / R; Using banana genomic DNA as a template, the promoter was amplified using the designed PCR primer pair.
3. The method according to claim 2, characterized in that: The primer pair MaRIN4 pro - F / R is as follows: MaRIN4 proF:GAGCGGATCTTTAGAAGCCTGCAAT, MaRIN4 proR:TTGGATTGTAATGCATGACGCACTG。 4. A plant recombinant expression vector p1300-MaRIN4pro:GUS, characterized in that: The recombinant vector contains the components described in claim 1. MaRIN4 Vectors for gene promoters.
5. The one described in claim 1 MaRIN4 Application of gene promoters in regulating efficient gene expression in plants.
6. A plant recombinant expression vector p1300-MaRIN4pro-MaRIN4, characterized in that: The recombinant vector contains the components described in claim 1. MaRIN4 Vectors containing gene promoters and the MaRIN4 gene, among which, MaRIN4 The nucleotide sequence of the gene is shown in SEQ ID NO:
4.
7. The recombinant vector according to claim 6, characterized in that: The vector is the plant expression vector p1300.
8. A host cell containing the recombinant expression vector of claim 6, characterized in that: The host cell was GV3101.
9. The application of any one of the following in the cultivation of plant varieties resistant to Fusarium wilt, characterized in that: It includes: (1) The plant recombinant expression vector p1300-MaRIN4pro:GUS as described in claim 6; (2) The host cell as described in claim 8.
10. The application according to claim 9, characterized in that, The plant in question is either tobacco or banana.