Application of detection reagent in vascular targeted drug screening kit and screening method

Abstract

The invention belongs to the technical field of medical biology, and particularly relates to application of a detection reagent in a vascular targeted drug screening kit and a screening method. The detection reagent comprises a first detection reagent for detecting Rho GTP enzyme in experimental samples and a second detection reagent for detecting Rho kinase 2 in the experimental samples, the experimental samples comprise a first experimental sample and a second experimental sample, the first experimental sample comprises vascular endothelial cells highly expressed by Rho kinase 2, and the second experimental sample comprises vascular endothelial cells highly expressed by Rho kinase 2. The second experimental sample comprises hepatic stellate cells with high expression of Rho kinase 2; the blood vessel targeting drug is an anti-hepatic fibrosis drug taking a blood vessel as a target spot. The ROCK2 capable of targeting vascular endothelial cells and hepatic stellate cells at the same time can be effectively screened out, the anti-hepatic fibrosis medicine with the blood vessel as the target spot is further screened out, and a new thought is provided for screening of the anti-hepatic fibrosis medicine.

Description

Technical Field

[0001] This invention relates to the field of pharmaceutical biotechnology, specifically to the application and screening method of a detection reagent in a vascular targeted drug screening kit. Background Technology

[0002] The liver is capable of self-repair after injury. Liver repair reportedly relies on the proliferation of hepatocytes and the activation of non-parenchymal cells such as stellate cells, vascular endothelial cells (ECs), and immune cells. However, this process is often disrupted by chronic injury or metabolic stress, leading to abnormal activation of non-parenchymal cells. Activated hepatic stellate cells (HSCs) differentiate into myofibroblasts and produce excessive matrix proteins such as collagen, thus causing liver fibrosis. Liver fibrosis is a characteristic histological feature of many liver diseases, including the globally prevalent non-alcoholic steatohepatitis [NASH]. Furthermore, liver fibrosis can progress to fatal cirrhosis and liver cancer. Despite numerous clinical trials evaluating the efficacy of anti-fibrotic drug candidates, treatment for liver fibrosis remains limited. For example, treatments targeting pro-fibrotic molecules such as lysyl oxidase-2 (LOXL2) have shown poor efficacy in patients with liver fibrosis.

[0003] Therefore, there is an urgent need to develop anti-fibrotic treatment strategies based on new targets to address liver diseases. Summary of the Invention

[0004] To solve the aforementioned technical problems, the present invention specifically adopts the following technical solution: A first aspect of the present invention is to provide an application of a detection reagent in the preparation of a screening kit for vascular-targeted drugs.

[0005] In some embodiments, the vascular-targeting drug refers to an anti-liver fibrosis drug that targets blood vessels.

[0006] In some embodiments, the detection reagent includes a first detection reagent for detecting Rho GTPase in experimental samples and a second detection reagent for detecting Rho kinase 2 (Rho-associated protein kinase 2, ROCK2) in experimental samples.

[0007] In some embodiments, the experimental samples include a first experimental sample and a second experimental sample.

[0008] In some embodiments, the experimental sample may be in the form of a cell culture or a slice.

[0009] In some embodiments, the first experimental sample comprises vascular endothelial cells highly expressing Rho kinase 2, and the second experimental sample comprises hepatic stellate cells highly expressing Rho kinase 2. This invention has experimentally demonstrated that ROCK2 is selectively upregulated in vascular endothelial cells and hepatic stellate cells of human fibrotic liver and promotes liver fibrosis, and that the expression of ROCK2 protein in vascular endothelial cells and hepatic stellate cells increases in stages in fibrotic liver. Therefore, this invention selects the aforementioned first and second experimental samples as experimental samples.

[0010] It should be understood that the first and second experimental samples mentioned above can be derived from fibrotic livers (e.g., through isolation) or from commercially available cell lines, as long as ROCK2 expression is high. Furthermore, the ROCK2 expression levels in the first and second experimental samples can be adjusted according to actual experimental needs. For example, when the experimental requirement is to screen for liver fibrosis at a specific fibrosis stage (e.g., F4), the first and second experimental samples with ROCK2 expression levels can be selected.

[0011] It should be noted that the vascular targeted drug screening kit is used to detect the expression of the Rho / ROCK signaling pathway formed by RhoGTPase and Rho kinase2 in the experimental samples, that is, RhoGTPase is used as the upstream regulatory molecule and Rho kinase2 is used as the downstream effector molecule.

[0012] In some embodiments, when the vascular-targeted drug screening kit detects a change in the expression of the signaling pathway in the experimental sample under the action of the candidate drug (i.e., when the expression levels of Rho GTPase and Rho kinase 2 are downregulated compared to the experimental sample before the action of the candidate drug), the candidate drug is evaluated as a potential anti-hepatic fibrosis drug targeting blood vessels.

[0013] In some embodiments, the detection reagent further includes a third detection reagent for detecting the expression level of LGALS3 protein in the experimental sample. LGALS3 (galactolectin 3) is an important member of the galactolectin family and is a widely expressed soluble β-galactoside-binding protein that regulates various physiological and pathological processes such as cell adhesion, proliferation, and apoptosis by recognizing and binding to glycoconjugates (such as glycoproteins and glycolipids) on the cell surface or inside the cell.

[0014] In some embodiments, the first detection reagent includes Rhotekin. Rhotekin can be used as a RhoGTPase detection reagent; it is a downstream effector protein that interacts with Rho proteins (including RhoA, RhoB, and RhoC). The RBD domain of Rhotekin can specifically recognize and bind to activated Rho proteins but not to resting Rho proteins; therefore, the Rhotekin-RBD recombinant protein can be used to detect activated Rho proteins. Based on the specific binding and precipitation of activated Rho proteins using Rhotekin-RBD agarose gel (active Rho-binding agarose gel), the activation level of Rho proteins can then be detected by Western blot, thereby enabling the detection of Rho GTPase in the experimental sample. In some embodiments, the specific steps for activity verification may include: 1) Collect cells by centrifuging at 250×g at room temperature for 5 minutes, wash once with TBS pre-cooled at 4℃, and then aspirate the residual liquid; gently vortex to disperse as much as possible; add 100-200μL of lysis buffer containing inhibitors pre-cooled at 4℃ at a ratio of 500,000-1,000,000 cells. 2) This invention generally sets up a control group, an input group, a GppNHp treatment group (positive control group), and a GDP treatment group (negative control group); Recombinant human RhoA (10 ng / μL) is used as a positive control for Western blot detection. Two additional groups of samples are prepared for each experiment, and GppNHp or GDP is added to make all Rho proteins in the lysis buffer either in an activated state (positive control) or a resting state (negative control). 3) Add 20 μL of active Rho-binding agarose gel washed with cell lysis buffer to 200 μL of cell or tissue lysis sample. Place on a side-shake or rotary mixer and incubate at 4°C for 1-2 hours. Centrifuge at 6000×g at 4°C for 30 seconds, carefully remove the supernatant, add 250 μL of pre-cooled 4°C washing buffer, resuspend the gel by inverting, centrifuge at 6000×g at 4°C for 30 seconds, carefully remove the supernatant, repeat three times, add 50 μL of SDS-PAGE sample loading buffer, and heat at 95°C for 5 minutes. The sample can be directly loaded onto an SDS-PAGE gel for electrophoresis. 4) Use Rho-GTP antibody for WB detection.

[0015] In some embodiments, the second detection reagent includes a Rho kinase 2 inhibitor, Rho kinase 2, a Rho kinase 2 substrate, and an ATP mixture.

[0016] In some embodiments, the second detection reagent can be a ROCK2 kinase activity detection reagent, and can measure ADP produced during the kinase reaction based on luminescent kinase detection technology. Rho kinase (ROCK) substrates include myosin light chain phosphatase (MLCP), actin-binding protein, etc., and phosphorylation regulates cell contraction and migration. The detection principle includes: after the kinase reaction is completed, the remaining ATP is consumed. ADP is converted into ATP. Using the reaction of luciferase and luciferin, the newly synthesized ATP is converted into a light signal for quantitative detection; the light signal is positively correlated with ADP content and kinase activity.

[0017] In some embodiments, ROCK2 kinase, substrate, ATP, and ROCK2 inhibitor are diluted in a kinase buffer. In some embodiments, specific steps for activity validation include: 1) Add the following substances to the wells of the 384-well low-capacity plate: 0.1 μL of ROCK2 inhibitor; 0.2 μL of ROCK2 kinase; 0.2 μL of substrate / ATP mixture; 2) Incubate at room temperature for 60 minutes; 3) Add 5 μL of ADP-Glo™ reagent and incubate at room temperature for 40 minutes; 4) Add 10 μL of kinase detection reagent; 5) Incubate at room temperature for 30 minutes; 6) Record the emission (time 0.5-1 second).

[0018] In some embodiments, the third detection reagent may be an ELISA assay reagent for detecting LGALS3 expression levels. In some embodiments, the specific steps for activity verification include: 1) Add 300 μL of 1× washing buffer to each well of the microplate and let it stand for 30 seconds; 2) Add standard: Add 100 μL of 2-fold serially diluted standard to the standard well, and add 100 μL of standard diluent to the blank well; 3) Add sample: Add 100 μL of pre-diluted sample to the sample well; 4) Add detection antibody: Add 50 μL of LGALS3 detection antibody working solution to each test well; 5) Incubation: Seal the plate with sealing film, shake at 100-300 rpm, and incubate at room temperature (25℃±3℃) for 2 hours; 6) Washing: Discard the liquid, add 300 μL of washing solution to each well and wash the plate 6 times; 7) Add enzyme: Add 100 μL of streptavidin working solution to each well; 8) Incubation: Shake at 100-300 rpm and incubate at room temperature (25℃±3℃) for 45 minutes; 9) Add substrate for color development: Add 100 μL of color development substrate to each well, protect from light, and incubate at room temperature (25℃±3℃) for 5-30 minutes; 10) Add stop solution: Add 100 μL of stop solution to each well, the color will change from blue to yellow; Detection readings: Within 30 minutes, use an ELISA reader to perform dual-wavelength detection, measuring the OD value at the maximum absorption wavelength of 450nm and the reference wavelength of 570nm or 630nm. The calibrated OD value is the measured value at 450nm minus the measured value at 570nm or 630nm.

[0019] In some embodiments, the kit further includes reagents for gene knockout and / or gene silencing of Rho kinase 2.

[0020] In some embodiments, the reagent for gene knockout and / or gene silencing of Rho kinase 2 includes shRNA. In some embodiments, the reagent for gene knockout and / or gene silencing of Rho kinase 2 is used to knock down the ROCK2 gene in the first experimental sample and / or the second experimental sample to obtain a third experimental sample. In some embodiments, the third experimental sample can serve as a control to verify the anti-liver fibrosis effect of the candidate drug, and can also be used to exclude candidate drugs with potentially adverse effects.

[0021] In some embodiments, the nucleotide sequence of the shRNA is shown in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3 or SEQ ID NO: 4.

[0022] In some embodiments, the reagents for gene knockout and / or gene silencing of Rho kinase 2 can be used in combination with an expression vector, such as the U6-shRNA-CMV-GFP-Puro vector.

[0023] A second aspect of the present invention provides a method for screening vascular-targeting drugs, comprising the following steps: S1: Add the candidate drug to the experimental sample to obtain the first mixture; In some embodiments, the experimental samples include a first experimental sample and a second experimental sample. In some embodiments, the first and second experimental samples may be derived from fibrotic livers (e.g., obtained through isolation) or may be commercially available cell lines, as long as ROCK2 is highly expressed.

[0024] S2: The first mixture was tested using a vascular targeted drug screening kit; In some embodiments, the kit includes detection reagents, the detection reagents including a first detection reagent for detecting Rho GTPase in the experimental sample and a second detection reagent for detecting Rho kinase 2 in the experimental sample.

[0025] In some embodiments, the first detection reagent includes Rhotekin.

[0026] In some embodiments, the second detection reagent comprises a Rho kinase 2 inhibitor, Rho kinase 2, a Rho kinase 2 substrate, and an ATP mixture. In some embodiments, the Rho kinase 2 inhibitor is TDI01, and the Rho kinase 2 substrate is MYPT.

[0027] S3: When the expression levels of Rho-GTP and Rho kinase 2 in the first mixture decrease, the candidate drug is evaluated as a potential vascular-targeting drug, which is an anti-hepatic fibrosis drug targeting blood vessels.

[0028] In some embodiments, the kit further includes reagents for gene knockout and / or gene silencing of Rho kinase 2, the reagents being used to knock down the expression level of Rho kinase 2 in the first experimental sample and / or the second experimental sample to obtain a third experimental sample.

[0029] In some embodiments, the method further includes a first efficacy verification step, which includes comparing the Rho kinase 2 expression level in the first mixture under the action of the potential vascular-targeting drug with the third experimental sample. When the Rho kinase 2 expression level in the first mixture is substantially the same (e.g., the same or similar) or lower than the Rho kinase 2 expression level in the third experimental sample, the potential vascular-targeting drug is evaluated as a first anti-liver fibrosis drug, i.e., a drug with strong anti-liver fibrosis ability.

[0030] In some embodiments, the method further includes a second efficacy verification step, which includes adding the potential vascular-targeting drug to the third experimental sample and detecting the expression level of Rho kinase 2 in the third experimental sample. When the expression level of Rho kinase 2 in the third experimental sample increases, the potential vascular-targeting drug is excluded.

[0031] In some embodiments, the detection reagent further includes a third detection reagent for detecting the expression level of LGALS3 protein. In some embodiments, S3 specifically includes: when the expression levels of Rho-GTP, Rho kinase 2, and / or LGALS3 in the first mixture decrease, the candidate drug is evaluated as a potential vascular-targeting drug.

[0032] In some embodiments, the potential vascular-targeting drug is the Rho kinase 2 inhibitor KD025 (MCE, HY-15307).

[0033] Beneficial technical effects: Experiments conducted according to this invention have confirmed that ROCK2 is upregulated in stages in vascular endothelial cells and perivascular hepatic stromal cells (HSCs) of non-parenchymal cells in human fibrotic liver. Inhibiting ROCK2 expression levels in ECs and HSCs of fibrotic liver can reduce the degree of liver fibrosis and damage. Based on this, this invention provides an application of a detection reagent in a vascular-targeted drug screening kit and a screening method to effectively screen for anti-hepatic fibrosis drugs that can simultaneously target ROCK2 in vascular endothelial cells and hepatic stellate cells, thereby targeting blood vessels. Compared to conventional drugs that target liver parenchymal cells or fibroblasts, the anti-hepatic fibrosis drugs screened by this invention have good targetability because hepatic blood vessels can directly enter through the circulatory system, making them more suitable for administration and exhibiting more potential anti-hepatic fibrosis effects, thus providing an effective strategy for combating liver fibrosis.

[0034] Furthermore, the screening results of this invention show that not all ROCK inhibitors (or ROCK2 selective inhibitors) can effectively target and inhibit the ROCK2 levels in vascular endothelial cells and hepatic stellate cells. In other words, the vascular-targeted drug screening kit and drug screening method provided by this invention can effectively visualize the anti-hepatic fibrosis effects of candidate drugs targeting blood vessels, and can be flexibly adjusted and validated according to specific experimental needs (e.g., the stage of liver fibrosis targeted) to screen for expected vascular-targeted drugs. This provides a new approach to the screening of anti-hepatic fibrosis drugs and has significant practical application value, especially in high-throughput screening. Attached Figure Description

[0035] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. In all the drawings, similar elements or parts are generally identified by similar reference numerals. The elements or parts in the drawings are not necessarily drawn to scale. Obviously, the drawings described below are some embodiments of the present invention, and those skilled in the art can obtain other drawings based on these drawings without any creative effort.

[0036] Figure 1 This is a pathway map of enriched pathway points in human fibrotic liver based on the RNA-seq dataset GSE193066 in this invention. Figure 2This is a pathway map of enriched pathway points in human fibrotic liver based on dataset GSE173735 in this invention. Figure 3 This is a schematic diagram illustrating the pattern of kinases ROCK1 and ROCK2 as downstream effector molecules activated by Rho-GTP in this invention. Figure 4 This is a schematic diagram illustrating the expression of ROCK2 in vascular endothelial cells and hepatic stellate cells in a single-cell transcriptome analysis based on non-parenchymal cells of healthy and fibrotic human livers, as described in this invention. Figure 5 This is a schematic diagram illustrating the stage-dependent upregulation of ROCK2 protein in vascular endothelial cells of fibrotic liver in this invention. Figure 6 This is a schematic diagram illustrating the expression of ROCK2 in hepatic stellate cells (HSCs) in a human liver sample described in this invention. Figure 7 This is a comparison diagram of normal human liver tissue and fibrotic liver tissue tested using the first detection reagent (Rho-GTP activity detection reagent) in this invention; Figure 8 This is a schematic diagram of co-staining ROCK2, the LSEC-specific marker LYVE1, and Galectin3, a key gene downstream of ROCK2, in a human liver sample described in this invention. Figure 9 This is a schematic diagram of the first detection reagent (Rho-GTP activity detection reagent) in this invention; Figure 10 This is a schematic diagram of the second detection reagent (ROCK2 kinase activity detection reagent) in this invention; Figure 11 This is a schematic diagram of the third detection reagent (LGALS3 detection reagent) in this invention; Figure 12 This is a schematic diagram of the vector used to knock down the ROCK2 gene in target cells in this invention. Figure 13 The following are the results of WB verification of the knockdown efficiency of endothelial and hepatic stellate cells after using the above gene knockdown strategy in this invention; (a) is the WB image of shROCK2 cells and normal cells; (b) is the quantitative result of WB verification of ROCK2; (c) is the quantitative result of WB verification of Galectin3. Figure 14 For the present invention Figure 14 The results of validating ROCK2 activity in vascular endothelial cells with knockdown of ROCK2 by 10 candidates selected from the screening process; Figure 15 For the present invention Figure 14 The results of validating LGALS3 activity in vascular endothelial cells with knockdown of ROCK2 by 10 candidates selected from the screening process. Figure 16 For the present invention Figure 14 The results of validating LGALS3 activity in hepatic stellate cells with ROCK2 knockdown using 10 candidates selected from the screening process. Figure 17 This is a flowchart of the human liver sample single-cell RNA sequencing (scRNA-seq) process in this invention; Figure 18 This section presents quality control information for all single-cell RNA samples in this invention; the left column shows the UMI count for each cell; the middle column shows the gene count for each cell; and the right column shows the proportion of mitochondrial genes. Figure 19 This is a dot plot that quantitatively displays the expression of marker genes for each cell type in this invention; Figure 20 The expression of ROCK1 in ECs and HSCs in healthy controls and fibrotic liver (without tumor) in this invention; Figure 21 The negative control image (without primary antibody) for multiplex immunohistochemical analysis of human liver samples in this invention is shown below; (a) shows cell nuclei labeled with Cyclic-480 fluorescent probe; (b) shows cell nuclei labeled with Cyclic-550 fluorescent probe; (c) shows cell nuclei labeled with Cyclic-630 fluorescent probe; (d) shows cell nuclei labeled with Cyclic-480, Cyclic-550, Cyclic-630 fluorescent probes and stained with DAPI. Figure 22 This is a diagram of single-cell RNA sequencing (scRNA-seq) analysis based on non-parenchymal cells (NPCs) from healthy and fibrotic human livers in this invention; Figure 23 This is a density map of scRNA-seq data (all individuals were tumor-free) based on healthy and fibrotic human livers in this invention. Figure 24 This is a schematic diagram illustrating the selective upregulation of ROCK2 in hepatic vascular endothelial cells and perivascular HSCs in this invention. Figure 25 The image shows the results of collagen deposition in Rock2^iΔEC / iΔEC mice after repeated CCl4 staining, compared with the control group Rock2^fl / fl; (a) shows ROCK2 flox mice; (b) shows endothelial cell knockout mice, and the yellow areas are all Sirius red. Figure 26This is a schematic diagram of liver collagen deposition in a CCl4-induced liver fibrosis model of Rock2^ΔHSC / ΔHSC mice compared to the control group in this invention; (a) is a ROCK2 flox mouse; (b) is a hepatic stellate cell knockout mouse; Figure 27 This is a schematic diagram of collagen deposition in Rock2^ΔHSC / ΔHSC mice after CCl4 injury compared to the control group in this invention; (a) is a ROCK2 flox mouse; (b) is an immune cell knockout mouse; Figure 28 The above diagram shows the comparison of liver collagen deposition and fat in Rock2^iΔEC / iΔEC mice and the control group in the NASH model of this invention using Sirius red staining; (a) is ROCK2 flox mice; (b) is endothelial cell strip knockout mice and is a NASH model. Figure 29 The above is a comparison of H&E staining results of liver collagen deposition and fat in Rock2^iΔEC / iΔEC mice and the control group in the NASH model of this invention; (a) is ROCK2 flox mice, (b) is endothelial cell knockout mice, HE staining of the NASH model, where purple is HE; Figure 30 The image shows the results of comparing liver collagen deposition in mice injected with Lrat-shRock2 AAV in the NASH model compared to the control AAV in this invention; (a) mice injected with AAV-crtl virus; (b) mice injected with Lrat-shROCK2 AAV virus, in which the mice also achieved the same knockdown of ROCK2 in hepatic stellate cells, NASH model. Figure 31 The image shows the results of fat degeneration in mice injected with Lrat-shRock2 AAV in the NASH model compared to the control AAV in this invention; (a) mice injected with AAV-crtl virus; (b) mice injected with Lrat-shROCK2 AAV virus, in which the mice also achieved the same knockdown of ROCK2 in hepatic stellate cells, NASH model. Detailed Implementation

[0037] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some, not all, of the embodiments of the present invention. All other embodiments obtained by those skilled in the art based on the embodiments of the present invention without creative effort are within the scope of protection of the present invention.

[0038] In this document, "and / or" includes any and all combinations of one or more of the listed related items.

[0039] In this article, "multiple" means two or more, that is, it includes two, three, four, five, etc.

[0040] As used in this specification, the term "about" typically means + / -5% of the value, more typically + / -4%, more typically + / -3%, more typically + / -2%, even more typically + / -1%, even more typically + / -0.5%.

[0041] In this specification, certain embodiments may be disclosed in a range-bound format. It should be understood that this "range-bound" description is merely for convenience and brevity and should not be construed as a rigid limitation on the disclosed range. Therefore, the description of a range should be considered as having specifically disclosed all possible subranges and the individual numerical values ​​within those ranges. For example, a description of the range 1-6 should be considered as having specifically disclosed subranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6, etc., and the individual numbers within those ranges, such as 1, 2, 3, 4, 5, and 6. This rule applies regardless of the breadth of the range.

[0042] Definition of the noun: ATP mixture: A liquid preparation with adenosine triphosphate (ATP) as the main active ingredient and other excipients or active substances. Recombinant Human RhoA: Recombinant human RhoA protein belongs to the Rho family of small GTPases; WB detection: Western blot detection; ADP-Glo™ reagent: A universal detection tool based on bioluminescence technology.

[0043] Example: Application of a detection reagent in a vascular-targeted drug screening kit. The detection reagent includes a first detection reagent for detecting Rho GTPase in experimental samples and a second detection reagent for detecting Rho kinase 2 in experimental samples. The experimental samples include a first experimental sample and a second experimental sample. The first experimental sample includes vascular endothelial cells with high expression of Rho kinase 2, and the second experimental sample includes hepatic stellate cells with high expression of Rho kinase 2. The vascular-targeted drug is an anti-hepatic fibrosis drug targeting blood vessels.

[0044] In this study, Rho GTPase is used as the upstream regulatory molecule and Rho kinase 2 is used as the downstream effector molecule. The Rho GTPase and Rho kinase 2 form the Rho / ROCK signaling pathway. The detection reagent screens for vascular-targeting drugs by detecting the expression of Rho GTPase and Rho kinase 2 in the signaling pathway of the experimental samples.

[0045] In some embodiments, the detection reagent further includes a third detection reagent for detecting the expression level of LGALS3 protein in the signaling pathway of the experimental sample.

[0046] In some embodiments, the first detection reagent includes Rhotekin.

[0047] In some embodiments, the second detection reagent comprises a Rho kinase 2 inhibitor, Rho kinase 2, a Rho kinase 2 substrate, and an ATP mixture. In some embodiments, the Rho kinase 2 inhibitor is TDI01, and the Rho kinase 2 substrate is MYPT.

[0048] In some embodiments, the third detection reagent includes an ELISA assay reagent.

[0049] In some embodiments, the experimental samples are derived from fibrotic livers.

[0050] In some embodiments, the first detection reagent is Rhotekin, i.e., a Rho GTPase detection reagent. Based on the specific binding and precipitation of activated Rho protein using Rhotekin-RBD agarose gel (active Rho-binding agarose gel), the activation level of Rho protein is then detected by Western blotting (WB). Rhotekin is a downstream effector protein that interacts with Rho proteins (including RhoA, RhoB, and RhoC). The RBD domain of Rhotekin can specifically recognize and bind to activated Rho protein, but not to resting Rho protein; therefore, the Rhotekin-RBD recombinant protein can be used to detect activated Rho protein. Specific steps for Rho GTPase activity verification include: 1) Collect cells by centrifuging at 250×g at room temperature for 5 minutes, wash once with TBS pre-cooled at 4℃, and then aspirate the residual liquid; gently vortex to disperse as much as possible; add 100-200μL of lysis buffer containing inhibitors pre-cooled at 4℃ at a ratio of 500,000-1,000,000 cells; gently tap the bottom of the tube or pipette appropriately to ensure that the lysis buffer is in full contact with the cells to fully lyse the cells; 2) This invention generally sets up a Control group, an Input group, a GppNHp treatment group (positive control group), and a GDP treatment group (negative control group); among which, the Control group is the group with only solvent added, and the Input group is the group with compound added; Recombinant Human RhoA (10ng / μL) is used as a positive control for Western blot detection. Two additional groups of samples are prepared for each experiment, and GppNHp or GDP is added respectively to make all Rho proteins in the lysis buffer in an activated state (positive control) or a resting state (negative control). 3) Add 20 μL of active Rho-binding agarose gel (Rhotekin-RBD Agarose) washed with cell lysis buffer to 200 μL of cell or tissue lysis sample. Place on a side-shaking shaker or rotary mixer and incubate at 4°C for 1-2 hours. Centrifuge at 6000×g at 4°C for 30 seconds, carefully remove the supernatant, add 250 μL of pre-chilled 4°C wash buffer, resuspend the gel by inverting, centrifuge at 6000×g at 4°C for 30 seconds, carefully remove the supernatant, repeat three times, add 50 μL of SDS-PAGE sample loading buffer (1X), heat at 95°C for 5 minutes; the sample can be directly loaded onto an SDS-PAGE gel for electrophoresis. 4) Use Rho-GTP antibody for WB detection.

[0051] In some embodiments, the second detection reagent (ROCK2 kinase activity detection reagent) comprises a mixture of Rho kinase 2 inhibitor, Rho kinase 2, Rho kinase 2 substrate, and ATP, and is used to measure ADP produced during the kinase reaction using luminescent kinase detection technology. Rho kinase (ROCK) substrates include myosin light chain phosphatase (MLCP), actin-binding protein, etc., which, upon phosphorylation, regulate cell contraction and migration. Detection principle: After the kinase reaction is completed, the remaining ATP is consumed. ADP is converted into ATP. Using the reaction of luciferase and luciferin, the newly synthesized ATP is converted into a light signal for quantitative detection. The luminescent signal is positively correlated with ADP content and kinase activity.

[0052] Dilute ROCK2 kinase, substrate, ATP, and ROCK2 inhibitor in kinase buffer; the kinase buffer formulation includes: 0.2 mg / ml BSA, 20 mM MgCl2, 5 mM MnCl2, 20 mM Tris-HCl at pH 7.4, 2 mM dithiothreitol (DTT), 1× protease inhibitor (HY-K0010, MCE) and 1× phosphatase inhibitor (B15001, Selleck).

[0053] The specific steps for verifying ROCK2 kinase activity include: 1) Add the following substances to the wells of the 384-well low-capacity plate: 0.1 μL of ROCK2 inhibitor; 0.2 μL of ROCK2 kinase; 0.2 μL of substrate / ATP mixture; 2) Incubate at room temperature for 60 minutes; 3) Add 5 μL of ADP-Glo™ reagent and incubate at room temperature for 40 minutes; 4) Add 10 μL of kinase detection reagent; 5) Incubate at room temperature for 30 minutes; 6) Record the emission (time 0.5-1 second).

[0054] In some embodiments, the third detection reagent (LGALS3 detection reagent) includes an ELISA assay reagent for detecting LGALS3 expression levels. Specific steps for LGALS3 activity validation include: 1) Add 300 μL of 1× washing buffer to each well of the microplate and let it stand for 30 seconds; discard the washing buffer and pat the microplate dry on absorbent paper; after washing, use the microplate immediately and do not let it dry. 2) Add standard: Add 100 μL of 2-fold serially diluted standard to the standard well, and add 100 μL of standard diluent to the blank well; 3) Add sample: Add 100 μL of pre-diluted sample to the sample well; 4) Add detection antibody: Add 50 μL of LGALS3 detection antibody working solution to each test well; 5) Incubation: Seal the plate with the sealing film, shake at 100-300 rpm (ensure that the solution in each well is not spilled and is fully mixed), and incubate at room temperature (25℃±3℃) for 2 hours. The sealing film should be sealed during incubation. 6) Washing: Discard the liquid, add 300 μL of washing solution to each well and wash the plate 6 times. After each wash, pat the plate dry on absorbent paper. To obtain ideal experimental performance, residual liquid must be completely removed. 7) Add enzyme: Add 100 μL of streptavidin working solution to each well; 8) Incubation: Seal the plate using a new sealing film. Shake at 100-300 rpm (ensure no spillage and thorough mixing), incubate at room temperature (25℃±3℃) for 45 minutes; 9) Add substrate for color development: Add 100 μL of color development substrate to each well, protect from light, and incubate at room temperature (25℃±3℃) for 5-30 minutes; 10) Add stop solution: Add 100 μL of stop solution to each well, the color will change from blue to yellow; Detection readings: Within 30 minutes, use an ELISA reader to perform dual-wavelength detection, measuring the OD value at the maximum absorption wavelength of 450nm and the reference wavelength of 570nm or 630nm. The calibrated OD value is the measured value at 450nm minus the measured value at 570nm or 630nm.

[0055] In some embodiments, the kit further includes reagents for gene knockout and / or gene silencing of Rho kinase 2.

[0056] In some embodiments, the reagent for gene knockout and / or gene silencing of Rho kinase 2 includes shRNA. In some embodiments, the reagent for gene knockout and / or gene silencing of Rho kinase 2 is used to knock down the ROCK2 gene in the first experimental sample and / or the second experimental sample to obtain a third experimental sample.

[0057] In some embodiments, the reagent for gene knockout and / or gene silencing of Rho kinase 2 can be used in combination with an expression vector, such as the U6-shRNA-CMV-GFP-Puro vector, to knock down the ROCK2 gene in target cells. A schematic diagram of the U6-shRNA-CMV-GFP-Puro vector for knocking down the ROCK2 gene in target cells is shown below. Figure 11 As shown.

[0058] A method for screening vascular-targeted drugs includes the following steps: S1: Add the candidate drug to the experimental sample to obtain the first mixture; In some embodiments, the experimental sample includes a first experimental sample and a second experimental sample. In some embodiments, the first experimental sample includes vascular endothelial cells highly expressing Rho kinase 2. In some embodiments, the second experimental sample includes hepatic stellate cells highly expressing Rho kinase 2. In some embodiments, the experimental sample is derived from a fibrotic liver.

[0059] S2: The first mixture was tested using a vascular targeted drug screening kit; In some embodiments, the kit includes detection reagents, the detection reagents including a first detection reagent for detecting Rho GTPase in the experimental sample and a second detection reagent for detecting Rho kinase 2 in the experimental sample.

[0060] In some embodiments, the second detection reagent comprises a Rho kinase 2 inhibitor, Rho kinase 2, a Rho kinase 2 substrate, and an ATP mixture. In some embodiments, the Rho kinase 2 inhibitor is TDI01, and the Rho kinase 2 substrate is MYPT.

[0061] S3: When the expression levels of Rho-GTP and Rho kinase 2 in the first mixture decrease, the candidate drug is evaluated as a potential vascular-targeting drug, which is an anti-hepatic fibrosis drug targeting blood vessels.

[0062] In some embodiments, the kit further includes reagents for gene knockout and / or gene silencing of Rho kinase 2, the reagents being used to knock down the expression level of Rho kinase 2 in the first experimental sample and / or the second experimental sample to obtain a third experimental sample.

[0063] In some embodiments, the method further includes S4: using a reagent for gene knockout and / or gene silencing of Rho kinase 2 to knock down the expression level of Rho kinase 2 in the first experimental sample and / or the second experimental sample to obtain a third experimental sample.

[0064] In some embodiments, the method further includes a first efficacy verification step, which includes comparing the Rho kinase 2 expression level in the first mixture under the action of the potential vascular-targeting drug with the third experimental sample. When the Rho kinase 2 expression level in the first mixture is substantially the same (e.g., the same or similar) or lower than the Rho kinase 2 expression level in the third experimental sample, the potential vascular-targeting drug is evaluated as a first anti-liver fibrosis drug, i.e., a drug with strong anti-liver fibrosis ability.

[0065] In some embodiments, the Rho kinase 2 inhibitor KD025 (MCE, HY-15307) among the candidate drugs has been validated as a potential vascular-targeting drug and a first-line anti-liver fibrosis drug, further demonstrating the effectiveness of the present invention.

[0066] In some embodiments, the detection reagent further includes a third detection reagent for detecting the expression level of LGALS3 protein. In some embodiments, S3 specifically includes: when the expression levels of Rho-GTP, Rho kinase 2, and / or LGALS3 in the first mixture decrease, the candidate drug is evaluated as a potential vascular-targeting drug.

[0067] Unless otherwise specified, all devices used in the embodiments are conventional equipment or apparatus in the art. The following are the materials and methods used in this experiment: (1) Patient sample Human liver surgical or biopsy samples were obtained from patients at West China Hospital of Sichuan University, with informed consent obtained. Liver tissue from healthy controls was obtained from healthy donors, and the liver tissue tested negative for fibrosis. Fibrotic liver tissue used for single-cell RNA sequencing (scRNA-seq) analysis was obtained from patients who underwent sleeve gastrectomy and were diagnosed with NASH; different samples covered different stages of fibrosis. In addition, liver tissue from cirrhotic patients was obtained from individuals histologically diagnosed with stage F4 liver fibrosis, as well as some patients requiring liver transplantation. All patients signed informed consent forms for tissue collection. Patient demographic information for single-cell RNA sequencing and multiplex immunohistochemistry of liver NPCs (non-parenchymal cells) is shown in Table 1.

[0068] This study was approved by the Medical Ethics Committee of West China Hospital of Sichuan University and followed the principles of human research in the Declaration of Helsinki.

[0069] Table 1 shows the detailed information of the human liver samples used for single-cell RNA analysis. Among them, 4 healthy samples were from GSE136103, 6 healthy samples were from E-MTAB-10553, and the remaining samples were from surgically removed tissue.

[0070] Table 1. Detailed information on human liver samples used for single-cell RNA analysis. (2) Mice Experiments using C57BL / 6J mice were approved by the Institutional Animal Care and Use Committee (IACUC) of the China Laboratory Animal Center and conducted in accordance with the ARRIVE guidelines. Mice were housed in an SPF barrier facility under standard housing conditions. Wild-type C57BL / 6 mice (Rock2^fl / fl) were purchased from GemPharmatech. EC-specific Cre-inducible Cdh5 / VE-Cadherin-CreERT2 mice were provided by Dr. Ralf H. Adams. Vav1-2A-Cre mice (catalog number NM-KI-233228) and Lrat-2A-Cre mice (catalog number NM-KI-190097) were purchased from Shanghai Model Biotechnology Co., Ltd. When Rock2^fl / fl mice were mated with VE-Cadherin(Cdh5)-CreERT2 mice, CreERT2 could be induced by tamoxifen under the control of the EC-specific VE-Cadherin promoter, thereby specifically deleting Rock2 in ECs (Rock2^iΔEC / iΔEC). The deletion of Rock2 in ECs was induced by tamoxifen injection and verified. When Lrat-2A-Cre mice were mated with Rock2^fl / fl mice, Rock2 was specifically deleted in HSCs (Rock2^ΔHSC / ΔHSC). When Vav1-2A-Cre mice were mated with Rock2^fl / fl mice, Rock2 was deleted in hematopoietic cells (Rock2^ΔHC / ΔHC).

[0071] (3) Liver fibrosis model Methods for establishing a mouse NASH model: Eight-week-old wild-type control mice and Rock2^iΔEC / iΔEC mice were fed a diet containing 21.1% fat, 41% sucrose, and 1.25% cholesterol, supplemented with fructose (23.1 g / L) and glucose (18.9 g / L) solutions, and intraperitoneally injected with 20% CCl4 (2.5 μL / g) weekly for 12 weeks. Mice were sacrificed two days after the last CCl4 injection, and serum and liver samples were collected.

[0072] A mouse model of chronic liver injury was established by intraperitoneal injection of 40% CCl4 (2.5 μL / g) twice a week for 5 consecutive weeks. Mice were sacrificed two days after the last CCl4 injection, and serum and liver samples were collected.

[0073] (4) Separation of human NPCs Human liver tissue was minced and digested in a digestion mixture (DMEM containing 1 mg / mL collagenase I, 1 mg / mL collagenase II, 1 mg / mL Dispase II, and 10 U / mL DNase I) on a shaker at 37°C for 40 minutes. After filtration through a 70 μm cell sieve, the cell suspension was centrifuged at 300 g for 10 minutes and then treated in ACK lysis buffer for 8 minutes to remove red blood cells. After centrifugation, the cell pellet was resuspended in PBS and then further separated into NPCs by centrifugation at 50 g for 2 minutes.

[0074] (5) Single-cell RNA sequencing of human NPCs Human NPCs were resuspended in PBS for scRNA-seq. scRNA-seq was performed using the Singleton Matrix single-cell processing system and the GEXSCOPE single-cell RNA library kit. Single-cell processing steps included: GEM generation and barcoding, RNA reverse transcription, cDNA amplification, and library construction, followed by 150bp paired-end sequencing on an Illumina HiSeq X. Raw data were processed using CeleScope software.

[0075] (6) Single-cell RNA sequencing data processing Single-cell transcriptome data were processed using R (v.4.3.3) and Seurat (v.5.0.1). Unsupervised clustering and gene expression analysis were performed according to the Seurat guidelines. Genes and cells were excluded based on the following criteria: 1) genes detected in fewer than 5 cells; 2) cells with fewer than 500 or more than 6000 genes; 3) cells with a mitochondrial gene proportion exceeding 10%. From the human single-cell data, 13 healthy samples and 21 fibrotic samples were used for subsequent analysis. Harmony integration was used for NPC data to remove batch effects. After linear dimensionality reduction using principal component analysis (PCA), the top 40 principal components were selected for UMAP projection analysis, with a final resolution of 1. The "FindAllMarkers" function was used to identify specific marker genes for each cell cluster to aid cell identification. To identify gene-associated protein types, the "FindMarkers" function was first used to obtain significantly differentially expressed genes between the cirrhotic group and the control group in human liver endothelial cells. Protein types were classified according to the Human Protein Atlas website, and ggplot2 was used for plotting.

[0076] (7) Public data reuse This invention utilizes datasets GSE173735 (containing whole-liver RNA-seq data from NASH patients and healthy individuals) and GSE193066 (containing RNA-seq data from human fibrotic and non-fibrotic livers) from the GEO (Gene Expression Omnibus) database. Enrichment analysis was performed on differentially expressed genes using the clusterProfiler software package, comparing NASH with healthy livers (GSE173735) and fibrotic with non-fibrotic livers (GSE193066), and pathway enrichment analysis was conducted using the REACTOME database. Furthermore, four healthy liver NPC single-cell RNA-seq samples from GSE136103 were integrated with six healthy samples from E-MTAB-10553 for single-cell RNA sequencing analysis.

[0077] (8) Immunohistochemistry and immunofluorescence analysis For staining human liver sections, the paraffin sections were first dewaxed, hydrated, and antigen retrieval was performed. Background fluorescence was removed using the LUMNIRIS fluorescence quenching system (Cat#MH030101) and IRISKit HyperView quenching buffer (Cat#MH010301). Antigen fluorescent labeling was performed using the IRISKit HyperView multiplex immunostaining kit (Cat#MH010101).

[0078] In the first round of staining, ROCK2 (Abcam, Cat#ab125025, 1:200, 1h) and CD31 (HUABIO, Cat#M1511-8, 1:1000, 1h) were labeled sequentially, corresponding to the fluorescent probes Cyclic-480 and Cyclic-550. After acquiring the full-slide image, the fluorescence signal was quenched using the LUMNIRIS fluorescence quenching system and IRISKit HyperView quenching buffer, except for DAPI.

[0079] In the second round of staining, Desmin (Abcam, Cat#ab15200, 1:800, 1 h), LYVE1 (Abcam, Cat#ab219556, 1:1000, 20 min), and CD45 (HUABIO, Cat#IRS025, 1:1000, 20 min) were labeled sequentially, corresponding to the fluorescent probes Cyclic-480, Cyclic-550, and Cyclic-630. Images were acquired after staining. Unless otherwise specified, all operations were performed at room temperature. For image registration, the results from both rounds of imaging were aligned into a single 8-bit TIFF multichannel image for subsequent colocalization analysis.

[0080] In addition, the activities of ROCK2 and ROCK1 in human liver biopsy samples were assessed using pROCK2 (Abcam, Cat#ab228008, 1:1000, 20 min; Cyclic-480), ROCK2 (Abcam, Cat#ab125025, 1:1000, 20 min; Cyclic-480), ROCK1 (CST, Cat#4035S, 1:1000, 1 h; Cyclic-480) and pROCK1 (Bioss, Cat#bs-4630R, 1:1000, 20 min; Cyclic-550).

[0081] (9) Western blot To verify the Rock2 deletion in conditional EC-specific Rock2 gene knockout mice and the control group, ECs were isolated according to previous reports. HSCs were isolated according to literature methods. Total protein was extracted using RIPA lysis buffer (Beyotime Biotechnology, P0013B) with the addition of a mixture of protease inhibitors (Bimake, B14011) and a mixture of phosphatase inhibitors (Bimake, B15002). Antibodies used included β-Actin (1:3000; Sigma-Aldrich, Cat#A5441) and ROCK2 (1:1000, CST, Cat#9029; 1:1000, Abcam, Cat#ab228000).

[0082] The following experiments explore the screening system (kit), screening method, and application of the anti-hepatic fibrosis drug that simultaneously targets vascular endothelial cells and hepatic stellate cells, based on the present invention.

[0083] To identify molecular targets involved in the development of liver fibrosis, this invention performed transcriptomic analysis on samples of healthy and fibrotic liver tissue from human patients. For example... Figure 1 As shown, based on the RNA-seq dataset GSE193066, the "Rho GTPase cycle" signal was significantly enriched in NASH human liver tissue. Differentially enriched signaling pathways in human fibrotic livers compared to normal livers were analyzed using the REACTOME database. Sample size: n=164 human liver samples from the GSE193066 dataset. Results showed that compared to normal livers, Rho-GTP, ROCK2, and LGALS3 increased with increasing fibrosis. Differentially enriched genes in fibrotic livers were mainly concentrated in the Rho-GTPase cycle pathway, suggesting that fibrosis is related to Rho-GTP transmission.

[0084] A meta-analysis of another human liver transcriptome dataset, GSE173735, also showed that in patients with liver fibrosis, signals of "Rho GTPase effector molecules" and "Rho GTPase circulation" were significantly enriched (e.g., Figure 2 (As shown). Gene enrichment analysis was performed using the Reactome database. Sample size: n=6 per group.

[0085] Both "Rho GTPase effector molecules" and "Rho GTPase cycles" are closely related to the Rho-associated coiled-coil kinase (ROCK) family. ROCK consists of two isoforms, ROCK1 and ROCK2, and its main upstream regulator is RhoA (such as...). Figure 3 (As shown). Figure 3 In the spectrum, GEF stands for guanine nucleotide exchange factor; Rho GDP stands for Rho protein that binds to guanosine diphosphate; GTP Rho (activated) stands for Rho protein that binds to guanosine triphosphate (activated); ROCK1 stands for Rho-associated coil-and-coil forming protein kinase 1; and ROCK2 stands for Rho-associated coil-and-coil forming protein kinase 2. This suggests that ROCK kinases may be druggable targets for inhibiting the Rho GTPase signaling pathway enriched in fibrotic livers. Therefore, the expression of these two ROCK kinases in human liver was further investigated.

[0086] This invention describes the expression pattern of ROCK in the human liver. Non-parenchymal cells (NPCs) were isolated from healthy and fibrotic human liver tissues, and single-cell RNA sequencing (scRNA-seq) analysis was performed (e.g., Figure 17-19 (As shown). The flowchart is as follows: Figure 17 As shown, Figure 18 The left column shows the UMI number for each cell; the middle column shows the gene count for each cell; the right column shows the proportion of mitochondrial genes; and the quality control results for all collected samples before single-cell analysis. UMI represents the number of transcripts per cell, gene represents the number of genes per cell, and Mito represents the number of mitochondrial genes. Figure 19 The middle section displays marker genes for various cell types, used for single-cell grouping. From top to bottom, they are stellate cells, myeloid cells, lymphocytes, endothelial cells, and bile duct cells.

[0087] Analysis showed that, among non-parenchymal cells of the liver, ROCK2 was preferentially expressed in human liver endothelial cells (ECs) and hepatic stellate cells (HSCs); in contrast, ROCK1 was widely expressed in other cell types (e.g., Figure 22 and Figure 23 (As shown). Figure 22Midpoint plot shows the expression distribution of ROCK1 and ROCK2 in different cell types; Figure 23 Based on scRNA-seq data from healthy and fibrotic human livers (all individuals were tumor-free), density maps were used to illustrate the expression patterns of ROCK1 and ROCK2 in different hepatocyte types. The normal group (n=12) and the fibrotic group (n=21) were analyzed. Furthermore, scRNA-seq analysis revealed that, compared to normal livers, ROCK2 expression was significantly upregulated in ECs and HSCs of fibrotic livers, while ROCK1 expression remained largely unchanged (e.g., ...). Figure 4 As shown and Figure 20 (As shown). Among them, Figure 4 The dot plot shows the expression of ROCK2 in endothelial and hepatic stellate cells in single-cell transcriptome analysis based on non-parenchymal cells of healthy and fibrotic human livers. The results show that ROCK2 expression is increased in endothelial and hepatic stellate cells in fibrotic livers compared to normal human livers.

[0088] Figure 20 To analyze the expression levels of ROCK1 in endothelial cells and hepatic stellate cells using single-cell analysis, the left side represents the normal group, and the right side represents the fibrotic group. ECs represent endothelial cells, and HSCs represent hepatic stellate cells. The dot plot shows the expression of ROCK1 in ECs and HSCs in healthy controls and fibrotic livers (without tumors). Data were obtained from single-cell RNA sequencing (scRNA-seq) analysis. The healthy control group had n=13, and the fibrotic group had n=21. These results suggest that ROCK2 is selectively upregulated in ECs and HSCs of human fibrotic livers.

[0089] Next, this invention examined the expression of ROCK2 protein in human liver at different stages of fibrosis. Non-fibrotic livers (F0 stage) contained almost no ROCK2 protein, while its expression increased progressively in fibrotic livers (e.g., ...). Figure 5 , Figure 21 (As shown). To assess ROCK2 expression in the liver, co-staining with ROCK2 and the EC marker LYVE1 was performed on liver sections at specific fibrosis stages (F0-F4). Figure 5 F0 represents the normal group, while F1-F4 represent the fibrotic group. The staining indicators are ROCK2, CD31 for blood vessels, and LYVE1 for sinus endothelium, indicating that the expression level of ROCK2 in endothelial cells increases with the aggravation of fibrosis. Figure 21(a) through (d) are negative control results of immunofluorescence (without primary antibody). (a) shows cell nuclei labeled with Cyclic-480 fluorescent probe; (b) shows cell nuclei labeled with Cyclic-550 fluorescent probe; (c) shows cell nuclei labeled with Cyclic-630 fluorescent probe; and (d) shows cell nuclei labeled with Cyclic-480, Cyclic-550, Cyclic-630, and stained with DAPI. The results showed no signal in any of the channels except for those stained with DAPI. The proportion of ROCK2-positive ECs was quantified by the ratio of the area of ​​ROCK2-positive ECs to the area of ​​CD31 and LYVE1-positive LSECs. The proportion of ROCK2-positive LSECs increased with the progression of fibrosis.

[0090] These protein staining results indicate that ROCK2 is selectively upregulated in LSECs and perivascular HSCs of human fibrotic liver, a phenomenon that may provide a potential target for inhibiting fibrosis progression. Figure 24 As shown.

[0091] like Figure 6 As shown, F0 represents the normal group, and F1-F4 represent the fibrotic group. The staining marker is ROCK2. Desmin labeling of hepatic stellate cells indicates that the expression level of ROCK2 in hepatic stellate cells increases with the progression of fibrosis. Figure 21 The image shows the negative control results of immunofluorescence, indicating that no signal was detected in any channel except for the cell nuclei stained with dapi. Co-staining experiments with Lyve1, a specific marker of hepatic sinusoidal endothelial cells (LSECs), showed that ROCK2 is mainly expressed in LSECs, and ROCK2... + The proportion of LSECs is positively correlated with the severity of fibrosis, reaching nearly 80% in human cirrhosis (F4 stage).

[0092] like Figure 7 As shown, the Rho-GTP activity assay was performed on normal human liver tissue and fibrotic liver tissue, and the results showed that Rho-GTP activity was significantly increased in fibrotic liver.

[0093] like Figure 8 As shown, in the described human liver samples, fibrotic liver sections were co-stained with ROCK2, the LSEC-specific marker LYVE1, and Galectin3, a key gene downstream of ROCK2. The left side is the normal group, and the right side is the fibrotic group. LYVE1 is used to label sinusoidal endothelium, and galecin3 is a fibrosis marker, indicating that the expression level of Galectin3 is increased in fibrosis. The results show that Galectin and ROCK2 show the same expression trend, that is, their expression is increased in fibrotic livers.

[0094] To verify the role of ROCK2 in promoting liver fibrosis, this invention constructed mice lacking Rock2 in different cell populations, including ECs, HSCs, and hematopoietic cells, and tested them in a liver fibrosis model. Statistical differences were analyzed using unpaired Student's t-tests; both the Rock2iΔEC / iΔEC group and the Rock2fl / fl group had n=5. ns indicates no significant difference (p>0.05), **p<0.01, ***p<0.001. Both the Lrat-shRock2 AAV group and the control AAV group had n=5, ***p<0.001.

[0095] First, to construct inducible EC-specific Rock2 knockout mice (Rock2^iΔEC / iΔEC), mice carrying the fluxed Rock2 allele (Rock2^fl / fl) were crossed with EC-specific, tamoxifen-responsive CreERT2 (VE-Cadherin / Cdh5-CreERT2) mice. The resulting offspring were treated with 100 mg / kg tamoxifen to induce Rock2 deletion in the EC (Rock2^iΔEC / iΔEC). Subsequently, Rock2^iΔEC / iΔEC and control Rock2^fl / fl mice were used in a liver fibrosis model induced by repeated intraperitoneal injections of carbon tetrachloride (CCl4) for 5 weeks to induce liver fibrosis (A). The knockout efficiency of Rock2 in the liver EC was 80%-90%. This resulted in inducible endothelial cell-specific Rock2 knockout mice (Rock2^iΔEC / iΔEC). Mice carrying the fluxed Rock2 allele (Rock2^fl / fl) were crossed with mice carrying EC-specific tamoxifen-inducible Cre (Cdh5 / VE-Cadherin-CreERT2), and EC-specific Rock2 deletion (Rock2^iΔEC / iΔEC) was induced by tamoxifen administration. Exon 2 (containing an 82 bp coding sequence) of the Rock2-201 (ENSMUST00000020904.7) transcript was designed as the knockout region. To achieve efficient gene editing, the loxP site was strategically inserted into the non-coding sequences flanking exon 2, thereby facilitating Cre-mediated recombination and excision of the target exon.

[0096] The results showed that, compared with the control group, Rock2^iΔEC / iΔEC mice had significantly reduced liver fibrosis and liver damage, as evidenced by Sirius red staining (e.g., Figure 25As shown in (a) and (b) of the study, serum alanine aminotransferase (ALT) and aspartate aminotransferase (AST) levels, as well as liver tissue hydroxyproline (HYP) content, were significantly decreased. In the control group, ALT ranged from 91.44 to 135.47, AST from 183.47 to 249.44, and HYP from 211.41 to 320.79; in the treatment group, ALT ranged from 57.12 to 104.75, AST from 154.55 to 173.47, and HYP from 193.25 to 224.36. This indicates that upregulation of ROCK2 in ECs promotes liver fibrosis after chronic injury, and that specific knockout of Rock2 in ECs can reduce the degree of liver fibrosis and liver injury.

[0097] Next, HSC-specific Lrat-Cre mice were crossed with Rock2^fl / fl mice to construct HSC-specific Rock2-deficient mice (Rock2^ΔHSC / ΔHSC). Specifically, HSC-specific Lrat-2A-Cre mice were crossed with fluxed Rock2 mice to specifically knock out Rock2 in the HSC (Rock2^ΔHSC / ΔHSC). Control group Rock2^fl / fl and Rock2^ΔHSC / ΔHSC mice were tested in a CCl4-induced liver fibrosis model, with n=5 in each group. The knockout efficiency of Rock2 in the HSC was 82%-88%. In a CCl4-induced liver fibrosis model, Rock2^ΔHSC / ΔHSC mice showed reduced liver collagen deposition, decreased serum AST and ALT levels, and decreased HYP content. In the control group, ALT ranged from 99.45 to 125.75, AST from 182.25 to 243.85, and HYP from 211.38 to 319.44; in the treatment group, ALT ranged from 65.32 to 107.47, AST from 124.42 to 179.25, and HYP from 189.04 to 213.45. Figure 26 As shown in (a) and (b), Sirius red staining quantitative results show that specific knockout of Rock2 in HSCs can reduce the degree of liver fibrosis and liver damage.

[0098] This invention also tested hematopoietic cell-specific Rock2 deficiency mice (Rock2^ΔHC / ΔHC). These mice were obtained by crossing Vav1-2A-Cre mice with Rock2^fl / fl mice and were also used in a CCl4-induced liver fibrosis model. Compared to the control group Rock2^fl / fl, Rock2^ΔHC / ΔHC mice showed almost no improvement in liver fibrosis or liver injury (e.g., ...). Figure 27 As shown in (a) and (b) in the image).

[0099] Subsequently, to specifically knock down Rock2 in HSCs, wild-type mice were intravenously injected with adeno-associated virus (Lrat-shRock2 AAV) expressing HSC-specific Lrat promoter-driven Rock2 shRNA. Mice treated with Lrat-shRock2 AAV were compared with mice treated with control AAV. This invention further evaluated the pro-fibrotic role of ROCK2 in ECs and HSCs in a mouse NASH model. This model combined a Western diet (high fat, high fructose, and high cholesterol) with low-dose weekly intraperitoneal injections of CCl4. In this model, Sirius red staining quantification showed that EC-specific Rock2 deficiency reduced liver fibrosis by 66.4% compared to the control group (e.g., ...). Figure 28 As shown in (a) and (b) in the figure). Figure 29 As shown in (a) and (b), H&E staining results showed that Rock2^iΔEC / iΔEC mice exhibited reduced hepatic steatosis, decreased serum ALT and AST levels, and reduced hepatic HYP content. In the control group, ALT ranged from 99.45 to 125.75, AST from 182.25 to 243.85, and HYP from 211.38 to 319.44. In the treatment group, ALT ranged from 65.32 to 107.47, AST from 124.42 to 179.25, and HYP from 189.04 to 213.45.

[0100] Furthermore, this invention also selectively knocked down Rock2 in mouse HSCs by intravenous injection of adeno-associated virus type 9 (AAV9) (Lrat-shRock2), which encodes Rock2 shRNA driven by the Lrat promoter. Figure 30 As shown in (a) and (b) in the figure Figure 31 As shown in (a) and (b), the quantitative results of Sirius red staining and the H&E staining results showed that Lrat-shRock2 AAV injection reduced liver fibrosis by 28.4% (compared to mice injected with control AAV), accompanied by a reduction in steatosis, a decrease in serum ALT and AST levels, and a decrease in HYP content. In the control group, ALT was 95.36-125.74, AST was 204.21-244.41, and HYP was 210.12-318.56; in the treatment group, ALT was 64.28-105.44, AST was 135.25-197.06, and HYP was 192.44-223.56.

[0101] The results from these cell type-specific Rock2 knockout / knockdown mice suggest that upregulation of Rock2 in ECs and HSCs promotes liver fibrosis following chronic injury and metabolic stress.

[0102] like Figure 9-11 The diagrams shown are schematics of the first test reagent, the second test reagent, and the third test reagent. For specific operation instructions, please refer to the usage method described above.

[0103] The ROCK2 gene knockdown strategy uses the U6-shRNA-CMV-GFP-Puro vector (e.g., Figure 12 As shown in the figure, the ROCK2 gene was knocked down in the target cells; for endothelial cells and hepatic stellate cells, the gene was knocked down using the U6-shRNA-CMV-GFP-Puro vector, and the knockdown efficiency was verified by Western blotting. Three shRNAs were constructed targeting the ROCK2 sequence, and the results are shown in the figure. Figure 13 As shown in (a) to (b), Figure 13 (a) shows the WB images of shROCK2 cells and normal cells; (b) shows the quantitative results of ROCK2 WB verification; (c) shows the quantitative results of Galectin3 WB verification. The results show that after ROCK2 knockdown, LGALS3 showed the same trend. Therefore, Rho-GTP, ROCK2, and LGALS3 can be used as gene indicators for detecting liver fibrosis.

[0104] The sequences of shRNAs used for gene silencing are shown in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, and SEQ ID NO: 4, respectively; specifically: The shRNA sequence of mouse ROCK2 is shown in SEQ ID NO: 1. SEQ ID NO: 1: GCATCTCTTGAAGAAACAAAT 1# The shRNA sequence of human ROCK2 is shown in SEQ ID NO: 2. SEQ ID NO: 2: CCTTGATGTCTGTCTATTATT 2# The shRNA sequence of human ROCK2 is shown in SEQ ID NO: 3. SEQ ID NO: 3: CCTTTCAAGATGATAGGTATC 3# The shRNA sequence of human ROCK2 is shown in SEQ ID NO: 4. SEQ ID NO: 4: CAGATGACATTGGACAGTAAA.

[0105] Inhibition rate % = (Positive control conversion rate reading) The conversion rate of the sample was calculated as (sample conversion rate reading) / (positive control conversion rate reading - negative control conversion rate reading) × 100%. The concentration log value was used as the X-axis, and the percentage inhibition rate as the Y-axis. A dose-response curve was fitted using the log(inhibitor) vs. response-variable slope function of GraphPad Prism5 software to obtain the IC50 value of the test substance on the enzyme activity.

[0106] Ten candidate compounds were used to validate ROCK2 activity and LGALS3 expression. These ten compounds were Y27632 (S6390, Selleck), Fasudil HCl (S1573, Selleck), GSK429286A (S1474, Selleck), RKI-1447 (S7195, Selleck), Belumosudil (KD025, S7936, Selleck), GSK269962A HCl (S7687, Selleck), Chroman 1 (E1261, Selleck), GSK269962A (S7512, Selleck), BAY-549 (S6636, Selleck), and HA-1100 (S8208, Selleck). Endothelial cells and hepatic stellate cells with ROCK2 knockdown were used as negative and positive controls, respectively. Results are as follows: Figure 14 , Figure 15 and Figure 16 As shown, all 10 compounds have a certain inhibitory effect on liver fibrosis. Among them, KD025 (MCE, HY-15307) has the strongest inhibitory effect (even better than knocking down ROCK2 at the gene level), and can be used as a candidate drug for the treatment of liver fibrosis. This further proves the effectiveness of the vascular targeted drug screening kit / screening method provided by the present invention.

[0107] In summary, the above data indicates that: 1) Compared with ROCK1, ROCK2 is induced to be expressed in hepatic ECs and perivascular ECs as fibrosis progresses; 2) ROCK2 is selectively upregulated in ECs and HSCs of human fibrotic liver and promotes liver fibrosis. 3) Inhibiting the expression level of ROCK2 in ECs and HSCs of fibrotic liver can reduce the degree of liver fibrosis and damage; 4) ROCK2's location in and around blood vessels facilitates drug access; 5) The vascular-targeted drug screening kit / screening method provided by this invention can effectively screen anti-liver fibrosis drugs that target blood vessels, achieving dual targeting of ECs and perivascular HSCs, thereby obtaining highly effective anti-liver fibrosis drugs.

[0108] It should be noted that, in this document, the terms "comprising," "including," or any other variations thereof are intended to cover non-exclusive inclusion, such that a process, method, article, or apparatus that comprises a list of elements includes not only those elements but also other elements not expressly listed, or elements inherent to such a process, method, article, or apparatus. Unless otherwise specified, an element defined by the phrase "comprising one..." does not exclude the presence of other identical elements in the process, method, article, or apparatus that includes that element.

[0109] The embodiments of the present invention have been described above with reference to the accompanying drawings. However, the present invention is not limited to the specific embodiments described above. The specific embodiments described above are merely illustrative and not restrictive. Those skilled in the art can make many other forms under the guidance of the present invention without departing from the spirit and scope of the claims. All of these forms are within the protection scope of the present invention.

Claims

1. The application of a detection reagent in a vascular-targeted drug screening kit, characterized in that, The detection reagents include a first detection reagent for detecting Rho GTPase in experimental samples and a second detection reagent for detecting Rho kinase 2 in experimental samples. The experimental samples include a first experimental sample and a second experimental sample. The first experimental sample includes vascular endothelial cells with high expression of Rho kinase 2, and the second experimental sample includes hepatic stellate cells with high expression of Rho kinase 2. The vascular-targeting drug is an anti-liver fibrosis drug targeting blood vessels.

2. The application according to claim 1, characterized in that, The detection reagent also includes a third detection reagent for detecting the expression level of LGALS3 protein.

3. The application according to claim 2, characterized in that, The first detection reagent includes Rhotekin; the second detection reagent includes a mixture of Rho kinase 2 inhibitor, Rho kinase 2, Rho kinase 2 substrate and ATP; and the third detection reagent includes an ELISA assay reagent for detecting LGALS3 expression levels.

4. The application according to claim 1, characterized in that, The kit also includes reagents for gene knockout and / or gene silencing of Rho kinase 2.

5. The application according to claim 1, characterized in that, The experimental samples were derived from fibrotic livers.

6. A method for screening vascular-targeted drugs, characterized in that, Includes the following steps: S1: The candidate drug is added to the experimental sample to obtain a first mixture; the experimental sample includes a first experimental sample and a second experimental sample, the first experimental sample includes vascular endothelial cells with high expression of Rho kinase 2, and the second experimental sample includes hepatic stellate cells with high expression of Rho kinase 2; S2: The first mixture is tested using a vascular targeted drug screening kit; wherein the kit includes detection reagents, the detection reagents including a first detection reagent for detecting Rho GTPase in the experimental sample and a second detection reagent for detecting Rho kinase 2 in the experimental sample; S3: When the expression levels of Rho-GTP and Rho kinase 2 in the first mixture decrease, the candidate drug is evaluated as a potential vascular-targeting drug, which is an anti-hepatic fibrosis drug targeting blood vessels.

7. The screening method according to claim 6, characterized in that, The kit also includes reagents for gene knockout and / or gene silencing of Rho kinase 2, which are used to knock down the expression level of Rho kinase 2 in the first experimental sample and / or the second experimental sample to obtain a third experimental sample.

8. The screening method according to claim 6, characterized in that, The method further includes a first efficacy verification step, which includes comparing the expression level of Rho kinase 2 in the first mixture under the action of the potential vascular-targeting drug with the third experimental sample. When the expression level of Rho kinase 2 in the first mixture is substantially the same as or lower than the expression level of Rho kinase 2 in the third experimental sample, the potential vascular-targeting drug is evaluated as a first anti-liver fibrosis drug.

9. The drug screening method according to claim 7, characterized in that, The method further includes a second effect verification step, which includes adding the potential vascular-targeting drug to the third experimental sample and detecting the expression level of Rho kinase 2 in the third experimental sample. When the expression level of Rho kinase 2 in the third experimental sample increases, the potential vascular-targeting drug is excluded.

10. The drug screening method according to claim 6, characterized in that, The first detection reagent includes Rhotekin; the second detection reagent includes a Rho kinase 2 inhibitor, Rho kinase 2, Rho kinase 2 substrate and ATP mixture.

Images