Recombinant human fibronectin and its preparation method and application
By developing a method for preparing recombinant human fibronectin, the problems of complex and costly extraction of natural human fibronectin have been solved, achieving low-cost, high-efficiency production and improved wound healing.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2026-01-04
- Publication Date
- 2026-03-24
AI Technical Summary
In existing technologies, the extraction process of natural human fibronectin is complex, costly, and carries the risk of pathogen contamination, making it difficult to meet the needs of large-scale production.
The recombinant human fibronectin was prepared by constructing a recombinant plasmid by synthesizing an amino acid sequence, followed by PCR amplification and enzyme digestion and ligation. The plasmid was then transformed into Escherichia coli and Pichia pastoris cells, and fermentation parameters were optimized for efficient expression and purification of the recombinant human fibronectin.
It has enabled low-cost and high-efficiency production of recombinant human fibronectin, which significantly improves wound healing efficiency.
Smart Images

Figure CN121426934B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of bioengineering technology, specifically to a recombinant human fibronectin, its preparation method, and its applications. Background Technology
[0002] Fibronectin is a multifunctional glycoprotein that is widely distributed in animals, including the extracellular matrix and body fluids. It has attracted much attention because of its key role in physiological processes such as tissue repair. Human fibronectin, as a naturally occurring fibronectin in the human body, also plays an important role in tissue repair and regeneration.
[0003] Although human fibronectin has important biological functions, it has many limitations. In terms of source, natural human fibronectin is mainly extracted from human plasma. However, plasma sources are limited, the extraction process is complex and costly, and there is a risk of pathogen contamination in plasma, posing certain safety hazards. Furthermore, the yield and quality of natural human fibronectin are greatly affected by individual differences in donors, making it difficult to meet the needs of large-scale production. Therefore, finding a safe, efficient, and controllable method for producing human fibronectin is of great practical significance. Summary of the Invention
[0004] The purpose of this invention is to provide a recombinant human fibronectin, its preparation method, and its application, in order to solve the problems raised in the prior art.
[0005] To achieve the above objectives, the present invention provides the following technical solution:
[0006] A recombinant human fibronectin, with the amino acid sequence shown in SEQ ID NO.1 and the nucleotide sequence shown in SEQ ID NO.2;
[0007] A method for preparing recombinant human fibronectin includes the following steps:
[0008] S1: The gene sequence corresponding to the artificially synthesized amino acid sequence SEQ ID NO.1 was obtained, and the nucleotide sequence as shown in SEQ ID NO.2 was obtained. A recombinant plasmid was constructed and used as a template for PCR amplification. The PCR amplification product was recovered. The PCR amplification product was ligated with the linearized enzyme digestion product using a Mix enzyme to obtain the ligation product.
[0009] S2: Transform the ligation product into competent E. coli cells, culture and pick single colonies, and extract linearized expression plasmids;
[0010] S3: The linearized expression plasmid was transformed into GS115 competent cells, positive monoclonal recombinant strains were screened, inoculated and fermented for induction, and finally the protein was extracted and purified.
[0011] Preferably, the pUC19 vector is used to obtain the recombinant plasmid in step S1.
[0012] Preferably, the PCR amplification system in step S1 includes the following components in the following volumes: 2×Buffer 25μL, dNTP 10μL, forward primer F 1.5μL, reverse primer R 1.5μL, KOD enzyme 1μL, template 1μL, and ddH2O 11μL.
[0013] The sequence of the forward primer F is 5'AGCTTACGTAGAATTCATGAAGTCTAGTCATCATCC3';
[0014] The sequence of the reverse primer R is 5'ATTAATTCGCGGCCGCTTAAATCAAACCAGAAACAA3';
[0015] Preferably, the PCR amplification program in step S1 is as follows: after amplification at 95-98℃ for 4-5 min, amplification is performed at 92-94℃ for 10-15 ses, at 55-58℃ for 30-40 sec, and at 65-68℃ for 1-2 kb / min for 30 cycles. After the cycles, amplification is performed at 65-68℃ for 5-8 min and the PCR amplification is ended at 12-16℃.
[0016] More preferably, the PCR amplification program in step S1 is as follows: after amplification at 98℃ for 5 min, amplification is performed at 94℃ for 10 ses, at 58℃ for 30 sec, and at 68℃ for 1 kb / min for 30 cycles. After the cycle, amplification is performed at 68℃ for 5 min and PCR amplification is ended at 16℃.
[0017] Preferably, the linearized enzyme digestion product is obtained by linearizing and recovering the pPIC9K vector through enzyme digestion; the enzyme digestion and linearization system includes the following components in the following amounts: EcoRI 1 μL, NotI 1 μL, 10×Buffer 5 μL, pPIC9K vector 2 μg, and ddH2O added to 50 μL;
[0018] Preferably, the ratio of Mix enzyme, PCR amplification product and linearized enzyme digestion product in the ligation product in step S1 is 1:2:2.
[0019] As a preferred option, the heat shock method is used for transformation in step S2. The specific operation steps are as follows: take competent E. coli cells, add ligation product, shake well and incubate in an ice bath for 30 min, then place in a 42℃ metal module for heat shock for 90 s and then transfer back to an ice bath to cool for 2 min.
[0020] Preferably, the transformation in step S3 is performed by electroporation. The specific steps are as follows: GS115 competent cells stored at -80℃ are thawed, linearized expression plasmids are added, and after two pipetting cycles, the cells are transferred to a pre-cooled electroporation cuvette. The electroporation parameters are: capacitance 25μF, resistance 200Ω, and voltage 2.0KV.
[0021] As a preferred embodiment, the specific operation steps of inoculation and fermentation in step S3 are as follows: the positive monoclonal recombinant strain is inoculated into BMGY liquid seed medium and cultured at 30℃ with shaking at 220-250 rpm until the OD600 (absorbance value of bacterial suspension at 600 nm) is 4-6 to obtain activated seed liquid. The activated seed liquid is inoculated into BMGY liquid seed medium and fermented continuously at 30℃, pH 5.5-6.0, oxygen saturation 30-50%, gas flow rate 1-2 vvm, and stirring rate 500-1000 rpm until dissolved oxygen surges. Aeration and stirring are carried out for 0.5-1 h.
[0022] As a preferred embodiment, the specific steps for methanol induction in step S3 are as follows: after adjusting the fermentation broth temperature to 28℃, methanol is added at an initial induction rate of 0.5-1 mL / L / h, the pH is maintained at 7.0, and the dissolved oxygen is maintained above 30% for 3-6 h to allow the cells to adapt to methanol metabolism, avoid toxicity accumulation, and lay the foundation for subsequent high-efficiency expression; then the methanol induction rate is adjusted to 3-5 mL / L / h, and methanol supply is stopped after continuous induction for 48-120 h, the cells are cooled to 10℃, and the stirring rate is reduced to terminate the induction.
[0023] The recombinant human fibronectin produced by this invention can be used to promote wound healing.
[0024] Compared with the prior art, the beneficial effects of the present invention are:
[0025] 1. The amino acid sequence of recombinant human fibronectin selected in this invention is used to synthesize the target sequence through pUC19, and pPIC9K is used as the final expression vector to achieve the induced expression of exogenous protein, taking into account low cost, high efficiency and high success rate.
[0026] 2. This invention provides a method for culturing NT based on Pichia pastoris fermentation, which is suitable for the expression of recombinant proteins with a methanol-inducible expression system. By optimizing parameters such as carbon source, inducer, pH, temperature and aeration rate during the fermentation stage, high-density yeast fermentation and efficient induced expression can be achieved.
[0027] 3. The recombinant human fibronectin prepared by this invention effectively improves wound healing efficiency in practical applications. Attached Figure Description
[0028] Figure 1The image shows an electrophoretic image of the target protein prepared in the example; M in the image is the protein molecular weight marker, and lane 1 is the purified recombinant human fibronectin;
[0029] Figure 2 The results of experiments showing that recombinant human fibronectin promotes wound healing in mice;
[0030] Figure 3 Images of mouse wounds taken on days 0, 3, 5, 7, and 10 of the drug administration test. Detailed Implementation
[0031] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.
[0032] In this implementation plan, the purchase channels and models / item numbers / serial numbers of each raw material are as follows:
[0033] pUC19 vector was purchased from Sangon Biotech (Shanghai) Co., Ltd., with the serial number A339043;
[0034] pPIC9K vector was purchased from Sangon Biotech (Shanghai) Co., Ltd., product number B540194;
[0035] LB liquid culture medium was purchased from Sangon Biotech (Shanghai) Co., Ltd., product number A507002;
[0036] LB agar plates containing the corresponding antibiotics were purchased from Sangon Biotech (Shanghai) Co., Ltd., with the serial number B530112.
[0037] The SD / -His screening plate was purchased from Sangon Biotech (Shanghai) Co., Ltd., item number B530118;
[0038] The liquid recovery kit was purchased from Tiangen Biotech (Beijing) Co., Ltd., product number DP205-02;
[0039] KOD enzyme was purchased from TOYOBO CO.,LTD., model number KOD-401;
[0040] EcoRI restriction endonuclease was purchased from New England Biolabs, catalog number R3101V;
[0041] NotI restriction endonuclease was purchased from New England Biolabs, catalog number R3189V;
[0042] Escherichia coli competent cells were purchased from Beijing TransGen Biotech Co., Ltd., product number CD501-02;
[0043] GS115 competent cells were purchased from Shanghai Weidi Biotechnology Co., Ltd., catalog number PE1001S;
[0044] The 6×loading buffer was purchased from Shanghai Beyotime Biotechnology Co., Ltd., part number D0071;
[0045] The agarose gel recovery kit was purchased from Tiangen Biotech (Beijing) Co., Ltd., product number DP209-02;
[0046] The plasmid mini-prep kit was purchased from Tiangen Biotech (Beijing) Co., Ltd., product number DP106.
[0047] The yeast extract was purchased from Sangon Biotech (Shanghai) Co., Ltd., product number A610961;
[0048] Peptone was purchased from Sangon Biotech (Shanghai) Co., Ltd., product number A650217;
[0049] YNB was purchased from Sangon Biotech (Shanghai) Co., Ltd., with part number B540132;
[0050] Glycerin was purchased from Sangon Biotech (Shanghai) Co., Ltd., product number A362460;
[0051] The Ni-NTA column was purchased from Sangon Biotech (Shanghai) Co., Ltd., with part number C600033.
[0052] SDS-PAGE gel was purchased from Sangon Biotech (Shanghai) Co., Ltd., product number C651301;
[0053] Example: This example provides a recombinant human fibronectin and its preparation method.
[0054] 1. The amino acid sequence of recombinant human fibronectin is shown in SEQ ID NO.1, and the nucleotide sequence is shown in SEQ ID NO.2;
[0055] 2. Construct the expression carrier, the specific steps are as follows:
[0056] (1) The sequence corresponding to the amino acid described in SEQ ID NO.1 was synthesized at Sangon Biotech (Shanghai) Co., Ltd. and inserted into the pUC19 vector to obtain a recombinant plasmid. Using the synthesized recombinant plasmid as a template, PCR amplification was performed using KOD enzyme. The amplification primers are shown in Table 1:
[0057] Table 1
[0058]
[0059] The PCR amplification system is shown in Table 2:
[0060] Table 2
[0061]
[0062] The PCR amplification procedure is shown in Table 3:
[0063] Table 3
[0064]
[0065] Among them, amplification procedures two through four require 30 cycles before procedure five can be performed;
[0066] (2) Electrophoresis detection: Prepare a 1% nucleic acid electrophoresis gel. After the gel cools, take 5 μL of PCR amplification product, mix it with 3 μL of 6× loading buffer, add it to the sample well, and electrophoresis at 120V for 25 min.
[0067] (3) Recovery of PCR amplification products: Refer to the liquid recovery kit, and follow the specific steps as follows:
[0068] After PCR amplification, the product was transferred to a 1.5 mL centrifuge tube, and an equal volume of binding buffer was added. The mixture was gently mixed to obtain a pretreated membrane material. 500 μL of equilibration buffer was added to the adsorption column, and the column was placed in a collection tube. The column was centrifuged at 13000 rpm for 1 min to obtain the pretreated membrane material. The effluent was discarded, and the mixture was transferred to the adsorption column and centrifuged at 13000 rpm for 1 min. The effluent was discarded, and 600 μL of 75% ethanol was added as washing buffer. The column was centrifuged at 13000 rpm for 1 min, and the centrifugation and washing were repeated. The empty tube was then centrifuged, and the adsorption column was placed in a new 1.5 mL centrifuge tube. The column was incubated at 55 °C for 5 min, and 25 μL of RNase-free water preheated to 55 °C was added. The column was allowed to stand for 1 min, and then centrifuged at 13000 rpm for 2 min to purify the PCR amplification product.
[0069] (4) Linearization of the pPIC9K vector by enzyme digestion: The enzyme digestion system is shown in Table 4:
[0070] Table 4
[0071]
[0072] (5) Recovery of linearized enzyme digestion products: Refer to the agarose gel recovery kit, and follow the specific steps as follows:
[0073] The target DNA band was excised under UV transillumination and placed in a 1.5 mL centrifuge tube. An equal volume of gel solution was added, and the tube was heated in a 65 °C water bath for 5 min until the gel was completely dissolved. 500 μL of equilibration buffer was added to a DNA-specific adsorption column beforehand. After centrifugation at 13000 rpm for 1 min, the bottom liquid was discarded. The dissolved DNA solution was added to the column, and centrifuged at 13000 rpm for 1 min to bind the DNA to the column membrane. The filtrate was discarded, and 600 μL of 70% anhydrous ethanol was added. The tube was centrifuged again at 13000 rpm for 1 min, and then the speed was increased to 14000 rpm for 2 min. The column was then transferred to a clean 1.5 mL centrifuge tube and dried at 65 °C for 5 min to obtain the linearized enzyme digestion product.
[0074] (6) The PCR amplification product recovered in (3) was ligated with the linearized enzyme digestion product recovered in (5) using a Mix enzyme to obtain the ligation product. The composition of the ligation product is shown in Table 5.
[0075] Table 5
[0076]
[0077] (7) Transformation:
[0078] Frozen E. coli competent cells were placed on ice and allowed to thaw completely. 30 μL of E. coli competent cells were taken, 5 μL of ligation product was added, and the mixture was gently mixed and incubated in an ice bath for 30 minutes. The cells were then transferred to a 42°C metal module for heat shock for 90 seconds, and immediately transferred back to an ice bath for cooling for 2 minutes. 600 μL of antibiotic-free LB liquid medium was added, and the cells were placed in a 37°C shaking incubator and incubated at 220 rpm for 1 hour. After centrifugation at 4000 rpm for 2 minutes, the supernatant was carefully discarded. The precipitated bacterial clumps were resuspended evenly by pipetting and spread evenly on the surface of LB agar plates containing ampicillin. The plates were inverted and incubated in a 37°C constant temperature incubator for 24 hours to obtain single colonies.
[0079] Select the transformed single-clone colonies and perform PCR identification. The specific PCR identification steps are as follows:
[0080] 1) Prepare the PCR reaction system (taking a 20μL system as an example), using 2×Taq PCR Master Mix (Lambolid, T0211).
[0081] The reaction system includes: 0.5 μL upstream primer F (TGAAGCTGTCATCGGTTACTCAG), 0.5 μL downstream primer R (GCAAATGGCATTCTGACATCC), 10 μL 2×Taq PCR Master Mix, 2 μL lysis buffer as template, and finally RNase-free ddH2O to bring the total volume to 20 μL.
[0082] 2) Pick a single colony:
[0083] Use a sterile toothpick to gently pick up a single colony, first spot it on a fresh LB agar plate containing ampicillin (for subsequent culture and preservation), and then dip the same toothpick into the PCR reaction system described above.
[0084] 3) Set up the PCR program (using Taq enzyme as an example):
[0085] Pre-deformation at 95°C for 3 min; followed by 30 cycles of deformation at 95°C for 30 sec, annealing at 55°C for 30 sec, extension at 72°C at 60 kb / sec, and finally extension at 72°C for 10 min, followed by holding at 4°C.
[0086] 4) PCR product analysis:
[0087] Take about 5 μL of PCR product, add 3 μL of loading buffer, mix well, and place in a 1.5% agarose gel electrophoresis tank for electrophoresis. Observe whether the target band is consistent with the expected insert size.
[0088] After the bacteria that have been sequenced and aligned completely correctly are preserved, the next step is to extract linearized expression plasmids: refer to the plasmid mini-prep kit;
[0089] 1) Pick a single colony and put it into 200 mL of the corresponding LB liquid medium containing ampicillin. Incubate it in a shaking incubator at 37°C and 220 rpm for 24 h. Take out 900 μL of the cultured bacterial solution in a clean bench and add it into a 2 mL centrifuge tube. Add 900 μL of 40% glycerol to preserve the bacteria.
[0090] 2) Divide the remaining bacterial culture into 4 equal portions using 50mL centrifuge tubes and centrifuge at 10000rpm for 10 minutes. After centrifugation, remove the supernatant. Add 1.5mL of P1 (protein removal solution) to the first precipitate tube and vortex until completely dissolved. Pour the solution into the second centrifuge tube and vortex again. Repeat this process until all the precipitate is dissolved. Then add 1.5mL of P2 (lysis buffer) to the centrifuge tube and gently invert to mix. Add 2.1mL of P3 (neutralization buffer) to the centrifuge tube and gently invert to mix. Finally, vortex the viscous material vigorously until homogeneous, aliquot it into 1.5mL centrifuge tubes, and centrifuge at 12000rpm for 2 minutes to obtain the supernatant.
[0091] 3) Add 500 μL of BL equilibration buffer to each of the three adsorption columns CB2, centrifuge at 12000 rpm for 1 min, add 700 μL of the supernatant obtained in step 2), centrifuge at 12000 rpm for 1 min, discard the filtrate, and repeat the above operation until all the supernatant obtained in step 2) has passed through the column, discard the filtrate, add PD, centrifuge at 12000 rpm for 1 min, discard the filtrate, add PW, centrifuge at 12000 rpm for 1 min, add PW again, centrifuge at 12000 rpm for 2 min; transfer the CA2 column to a new 1.5 mL centrifuge tube, incubate in a 65℃ oven for 5 min to allow the alcohol to evaporate completely; add 100 μL of ddH2O at 60℃ to the CB2 column, centrifuge at 12000 rpm for 2 min to elute the plasmid, measure the nucleic acid concentration of the extracted plasmid using a spectrophotometer, and record it;
[0092] (8) Transformed strains:
[0093] Prepare a 1M sorbitol solution and pre-cool it in an ice bath. Remove the electroporation cuvette and lid from the storage solution and place them on absorbent paper, upside down, for 5 minutes each to remove ethanol. Then, pre-cool them in ice for 5 minutes, keeping the top of the cuvette slightly above the ice surface. Thaw GS115 competent cells stored at -80℃ on ice, add 6μg of linearized expression plasmid, and immediately place them in ice. Gently pipette twice using a 200μL pipette tip (with the tip trimmed by 0.5cm) to remove air bubbles, then transfer the cells to the pre-cooled electroporation cuvette and gently shake to allow them to thaw. The liquid level is horizontal. Cover the cup and place it in ice for later use. Set the electroporation apparatus parameters to: capacitance 25μF, resistance 200Ω, and voltage 2.0kV. Remove the electroporation cup from the ice, wipe the surface dry, and place it in the electroporation tank for electroporation. Within 10 seconds after electroporation, immediately add 1mL of pre-cooled sorbitol to the cup, mix gently, and transfer to a centrifuge tube. After incubation at 30℃ for 3 hours, centrifuge at 4000rpm for 30s to collect the bacterial cells. Discard the supernatant but retain 50μL of residual liquid for resuspending the cells. Shake well to obtain the resuspended bacterial solution.
[0094] (9) Screening and cultivation:
[0095] The resuspended bacterial solution was evenly spread on SD / -His screening plates and inverted in a 30℃ constant temperature incubator for 4 days until colonies grew. Then, the single clonal colonies on the screening plate were streaked onto a 2g / L G418 plate. After they grew, they were transferred to a 4g / L G418 plate. Positive single clonal recombinant strains were then screened for induction expression test.
[0096] 3. Recombinant human fibronectin expression was induced, and the specific steps are as follows:
[0097] (1) Prepare raw materials:
[0098] Fermentation strain: Screened positive monoclonal recombinant strain GS115;
[0099] The preparation process for BMGY liquid seed culture medium (pH 6.0) is as follows:
[0100] 1) Prepare phosphate buffer: Weigh 13.8g NaH2PO4·H2O and 4.4g Na2HPO4 (anhydrous) and dissolve them in 800mL ddH2O. Stir thoroughly, adjust the pH to 7.0, and bring the volume up to 1L with ddH2O to obtain 100mM phosphate buffer.
[0101] 2) BMGY culture medium preparation steps (taking 1L as an example): Take a clean flask and add the following components: 10g yeast extract, 20g peptone, 13.4g YNB, 100mL 100mM phosphate buffer, 10mL glycerol. Finally, add ddH2O to make up to the final volume of 1L. Stir thoroughly to dissolve all components. Dispense into 500mL Erlenmeyer flasks, each no more than 1 / 3 of the total volume to facilitate aeration. Autoclave at 121℃ for 20min. After sterilization, store at 4℃ for short-term storage.
[0102] (2) Seed culture:
[0103] In a shake flask, 1% of the positive monoclonal recombinant GS115 bacteria was inoculated into 30 mL of BMGY liquid seed medium and cultured at 30 °C with shaking at 250 rpm for 28 h to obtain activated seed liquid.
[0104] (3) Fermentation tank culture:
[0105] The activated seed culture was inoculated into a fermenter containing BMGY liquid seed culture medium at an inoculation rate of 8%. The temperature was controlled at 30℃, pH at 6.0, oxygen saturation at 30%, gas flow rate at 2 vvm, and stirring rate at 1000 rpm. Fermentation continued until glycerol was depleted. The criterion for judgment was a sudden increase in dissolved oxygen (i.e., DO rises by more than 50%). Glycerol feeding was stopped, and aeration and stirring continued for 1 hour.
[0106] The fermentation broth temperature was adjusted to 28℃, and methanol was added in batches at an initial rate of 1 mL / L / h. The pH was maintained at 7.0 and the dissolved oxygen was maintained above 30%. After 4 hours, the methanol addition rate was adjusted to 5 mL / L / h and the induction was continued for 72 hours. After the induction was completed, the methanol supply was stopped, the mixture was cooled to 10℃ and the stirring rate was reduced to stop the fermentation.
[0107] Collect the supernatant from the fermentation broth to obtain recombinant His-tagged protein:
[0108] After fermentation, the fermentation broth was centrifuged at 12000×g for 20 min at 4℃. The supernatant was collected and filtered through a 0.45 μm membrane to further remove minute impurities. Secretory His-tagged proteins were purified by affinity chromatography using a Ni-NTA column. The column was pre-equilibrated with 10 column volumes of equilibration buffer (50 mM Tris-HCl, 300 mM NaCl, pH=8.0). The supernatant (adjusted to pH=8) was loaded onto a nickel column and maintained at a flow rate of 1 mL / min. Impurities were removed with 30 mM Imidazole washing buffer, and the target protein was eluted with 500 mM Imidazole elution buffer. The protein eluent was collected.
[0109] Protein SDS-PAGE analysis and Coomassie Brilliant Blue staining:
[0110] Take 30 μL of protein eluate, add 6 μL of 6×SDS loading buffer, and heat in a 95°C water bath for 10 min to denature the protein. Use a commercial precast SDS-PAGE gel, with a sample loading volume of 10 μL. At the same time, add 1 well of pre-stained protein molecular weight Marker. Set the electrophoresis conditions: 80 V (concentrating gel) → 120 V (separating gel), and the electrophoresis time is 1.5 h.
[0111] After the electrophoresis is completed, place the gel in Coomassie Brilliant Blue staining solution for 60 min, and then use decolorizing solution (40% methanol + 10% glacial acetic acid) to decolorize until the background is clear and the target band is obvious, such as Figure 1 the target protein shown.
[0112] Detection experiment:
[0113] [[ID=The dressing for Group II of the drug administration used recombinant human fibronectin 1%*100ppm: accurately pipette 1.0ml of 100ppm recombinant human fibronectin solution into a 100ml volumetric flask, add an appropriate amount of water to dissolve, dilute to the mark with water, mix well, and the resulting solution is a 1%*100ppm recombinant human fibronectin solution.
[0120] Depend on Figure 2 The wound healing rate test results showed that 1%*100ppm of recombinant human fibronectin was significantly better than 0.5%*100ppm of recombinant human fibronectin. This result indicates that the wound healing effect of recombinant human fibronectin is significantly concentration-dependent, and 1%*100ppm can more effectively promote wound healing.
[0121] Depend on Figure 3 As can be seen from the actual images of mouse wounds, the wound healing effect of the drug II group on the fifth day was much better than that of the blank group on the tenth day. Recombinant human fibronectin effectively promoted wound healing, and the higher the concentration, the faster the healing.
[0122] It will be apparent to those skilled in the art that the present invention is not limited to the details of the exemplary embodiments described above, and that the invention can be implemented in other specific forms without departing from its spirit or essential characteristics. Therefore, the embodiments should be considered in all respects as exemplary and non-limiting, and the scope of the invention is defined by the appended claims rather than the foregoing description. Thus, all variations falling within the meaning and scope of equivalents of the claims are intended to be included within the present invention. No reference numerals in the claims should be construed as limiting the scope of the claims.
Claims
1. A recombinant human fibronectin, characterized in that, The amino acid sequence of the recombinant human fibronectin is shown in SEQ ID NO.1, and the nucleotide sequence is shown in SEQ ID NO.
2.
2. The method for preparing recombinant human fibronectin according to claim 1, characterized in that, Includes the following steps: S1: The gene sequence corresponding to the artificially synthesized amino acid sequence SEQ ID NO.1 was obtained, and the nucleotide sequence as shown in SEQ ID NO.2 was obtained. A recombinant plasmid was constructed and used as a template for PCR amplification. The PCR amplification product was recovered. The PCR amplification product was ligated with the linearized enzyme digestion product using a Mix enzyme to obtain the ligation product. S2: Transform the ligation product into competent E. coli cells, culture and pick single colonies, and extract linearized expression plasmids; S3: The linearized expression plasmid was transformed into GS115 competent cells, positive monoclonal recombinant strains were screened, inoculated and fermented for induction, and finally the protein was extracted and purified.
3. The method for preparing recombinant human fibronectin according to claim 2, characterized in that, The PCR amplification system in step S1 includes the following components in the following volumes: 2×Buffer 25μL, dNTP 10μL, forward primer F 1.5μL, reverse primer R 1.5μL, KOD enzyme 1μL, template 1μL, ddH2O 11μL; wherein the sequence of forward primer F is 5'AGCTTACGTAGAATTCATGAAGTCTAGTCATCATCC3', and the sequence of reverse primer R is 5'ATTAATTCGCGGCCGCTTAAATCAAACCAGAAACAA3'.
4. The method for preparing recombinant human fibronectin according to claim 2, characterized in that, The PCR amplification program in step S1 is as follows: after amplification at 95-98℃ for 4-5 min, amplify at 92-94℃ for 10-15 ses, at 55-58℃ for 30-40 sec, and at 65-68℃ for 1-2 kb / min for a total of 30 cycles. After the cycle, amplify at 65-68℃ for 5-8 min, and end the PCR amplification at 12-16℃.
5. The method for preparing recombinant human fibronectin according to claim 2, characterized in that, In step S1, the ratio of Mix enzyme, PCR amplification product, and linearized enzyme digestion product in the ligation product is 1:2:
2.
6. The method for preparing recombinant human fibronectin according to claim 2, characterized in that, In step S2, heat shock is used for transformation. The specific steps are as follows: take competent E. coli cells, add ligation product, shake well and incubate in an ice bath for 30 min, then place in a 42℃ metal module for heat shock for 90 s, and transfer back to an ice bath to cool for 2 min.
7. The method for preparing recombinant human fibronectin according to claim 2, characterized in that, In step S3, the transformation was performed by electroporation. The specific steps were as follows: GS115 competent cells stored at -80℃ were thawed, linearized expression plasmids were added, and after two pipetting cycles, the cells were transferred to a pre-cooled electroporation cuvette. The electroporation parameters were: capacitance 25μF, resistance 200Ω, and voltage 2.0KV.
8. The method for preparing recombinant human fibronectin according to claim 2, characterized in that, The specific steps for inoculation and fermentation in step S3 are as follows: Inoculate the positive monoclonal recombinant strain into BMGY liquid seed medium and culture it at 30℃ with shaking at 220-250 rpm until the OD600 is 4-6 to obtain activated seed liquid. Inoculate the activated seed liquid into BMGY liquid seed medium and control the temperature at 30℃, pH at 5.5-6.0, oxygen saturation at 30-50%, gas flow rate at 1-2 vvm, and stirring rate at 500-1000 rpm for continuous fermentation until dissolved oxygen surges. Aerate and stir for 0.5-1 h.
9. The method for preparing recombinant human fibronectin according to claim 2, characterized in that, The specific steps for induction in step S3 are as follows: After adjusting the temperature of the fermentation broth to 28℃, methanol is added at an initial addition rate of 0.5-1 mL / L / h, the pH is maintained at 7.0, and the dissolved oxygen is maintained above 30%. After 3-6 hours, the methanol addition rate is adjusted to 3-5 mL / L / h. After continuous induction for 48-120 hours, the methanol supply is stopped, the temperature is cooled to 10℃, and the stirring rate is reduced to terminate the induction.
10. An application of the recombinant human fibronectin according to claim 1, characterized in that, Used to prepare drugs that promote wound healing.
Citation Information
Patent Citations
Protein and application of protein in wound repair and bacteriostasis
CN111423516A
Prokaryotic expression vector of medicinal-grade human fibroblast growth factor-18 as well as construction method, preparation method and application of prokaryotic expression vector
CN117417951A