Small-scale TELP-assisted rapid chromatin immunoprecipitation sequencing method

Abstract

The invention discloses a small-scale TELP-assisted rapid chromatin immunoprecipitation sequencing method. MNase digestion is adopted to replace ultrasonication, so that the problem of epitope masking possibly caused by cross-linking is avoided. Library construction is carried out by using a TELP method, and efficient capture is realized by using an anchor primer tailed by PolyC and labeled by biotin. Only 3 '-phosphoric acid is removed from the rSAP, preparation is made for a subsequent tailing reaction, thermal inactivation can be achieved, the purification step is omitted, a traditional terminal repair enzyme system is not needed, and TELP has high sensitivity to low-initial-quantity DNA and is suitable for trace DNA produced by ChIP-seq. And through streptavidin magnetic bead capture, all subsequent steps (washing and connecting) are performed on the magnetic beads, so that the sample transfer loss is greatly reduced. 3 '-OH is directly used for tailing, and the steps of tail end repairing and A tail adding which are most likely to cause loss in traditional library building are omitted. According to the method, histone modification can be detected only by using hundreds of cells.

Description

Technical Field

[0001] This invention relates to the field of biotechnology, specifically a small-scale TELP-assisted rapid chromatin immunoprecipitation sequencing method. Background Technology

[0002] Chromatin immunoprecipitation sequencing, also known as ChIP-seq, is based on the idea of ​​using antibodies to specifically enrich DNA fragments that bind to target proteins, and then using high-throughput sequencing to determine the location of these DNA fragments on the genome. By using specific antibodies to enrich chromatin associated with epigenetic modifications or chromatin regulation, and then employing next-generation sequencing, ChIP-seq has proven to be a valuable technique for studying protein-DNA interactions and identifying functional elements across the entire genome.

[0003] ChIP-seq is a powerful technique for detecting chromatin localization of proteins and epigenetic modifications. However, traditional ChIP-seq typically requires millions of cells, a daunting task for laboratories with limited experimental materials. Furthermore, this technique has the following drawbacks: 1. Antibody dependence: Antibody quality directly affects results (antibody specificity needs to be verified, such as through Western blotting or ChIP-qPCR); 2. Background noise: Non-specific binding can lead to false positive peaks (input DNA controls are required); 3. High cost: sequencing and data analysis are expensive. Summary of the Invention

[0004] To address the problems in existing CHIP techniques, this invention proposes an optimized ChIP-seq method – STAR (Small-scale TELP-assisted rapid) ChIP-seq. This method can detect histone modifications using only a few hundred cells, and it has been shown to be applicable to epigenomic analysis in embryos and cultured cells, as well as to studies in embryos.

[0005] The technical solution adopted in this invention is: a small-scale TELP-assisted rapid chromatin immunoprecipitation sequencing method, comprising the following steps:

[0006] (1) The cells to be tested were fragmented into DNA containing nucleosomes by cell lysis and MNase fragmentation, and were designated as IP samples;

[0007] (2) Immunoprecipitation: The IP sample obtained in step (1) is subjected to immunoprecipitation to obtain the IP sample bound to the magnetic beads;

[0008] (3) Magnetic bead washing: Wash the IP sample bound to the magnetic beads to remove non-specific binding;

[0009] (4) rSAP repair: Add rSAP to inactivate proteinase K and obtain pure DNA fragments without nucleosomes;

[0010] (5) TdT reaction: Add terminal transferase (TdT) to extend the polyC tail;

[0011] (6) Extension reaction: DNA is amplified in large quantities through PCR reaction;

[0012] (7) Magnetic bead binding: preparing streptavidin C1 magnetic beads and binding them to the sample;

[0013] (8) Connector connection: Obtain a sample connected to the connector;

[0014] (9) DNA elution: Elute DNA from the magnetic beads into EB buffer;

[0015] (10) DNA amplification: A large amount of DNA product is obtained through PCR;

[0016] (11) DNA purification: to obtain DNA products with high purity.

[0017] Furthermore, step (1) specifically includes:

[0018] Place the cells in a 200 μL DNA low-binding tube, rotate rapidly to remove as much liquid as possible, and lyse each sample with 19 μL of lysis buffer.

[0019] Place the test tube on ice for 5 minutes, add 19 μL of MNase working buffer, and mix gently.

[0020] Add 2 μL of diluted 0.01 U / μL MNase, gently tap the test tube to mix, and then transfer the test tube to a 37°C metal bath and heat for 5 min.

[0021] Add 5 μL of stop buffer to terminate the reaction, gently vortex, and wait at room temperature for 2 min;

[0022] Add 45 μL of pre-cooled 2×RIPA buffer and 2 μL of 100× protease inhibitor, and vortex thoroughly; rotate at maximum speed for 10 minutes at 4 °C, and transfer the supernatant to a new test tube.

[0023] Furthermore, the immunoprecipitation in step (2) includes:

[0024] Each step IP sample was incubated with 1-1.5 μg of anti-histone modified antibody overnight at 4°C.

[0025] On the second day, wash the Dynabeads several times with 100 μL RIPA buffer. Each IP sample requires 100 μg of Protein A Dynabeads. Place the test tube on a magnetic rack and remove the supernatant. Repeat this step once.

[0026] Dynabeads were resuspended in 10 μL of RIPA buffer to obtain pre-washed beads;

[0027] Add 10 μL of pre-washed microbeads to the IP sample, mix thoroughly by suction transfer, and incubate at 4 °C for 2 hours by rotation.

[0028] Furthermore, the rSAP repair in step (4) includes:

[0029] Add 1 μL of proteinase K to the sample obtained in step (3), mix well, transfer the test tube to ThermoMixer, and shake at 1400 rpm for 2 h at 55 ℃.

[0030] Centrifuge, transfer the supernatant to a new test tube, and incubate at 72 °C for 40 minutes;

[0031] Add 1 μL of rSAP and incubate in a block at 37 °C for 1 hour;

[0032] Place the test tube in a 65 °C block for 15 min to inactivate rSAP.

[0033] Furthermore, the TdT reaction in step (5) includes:

[0034] Add 1 μL of 1 mM dCTP to the sample, vortex to mix, incubate at 95 °C for 3 min to denature the DNA, and then immediately cool rapidly on ice for 1 min.

[0035] Add 1 μL of terminal transferase (TdT) and incubate at 37 °C for 35 min to extend the polyC tail;

[0036] Add 1 μL of 1 mM dATP, vortex to mix, and incubate at 37 °C for 5 minutes;

[0037] Place the test tube at 75 °C to inactivate TdT.

[0038] Further, the PCR reaction system in step (6) is as follows: the following substances are added to the mixture after the reaction in step (5): 6.2 μL of double-distilled water, 12 μL of 5×KAPA buffer A, 4.8 μL of 2.5mM dNTP, 6 μL of 2uM MP24-G9, and 0.8 μL of KAPA 2G polymerase; the reaction program is as follows: Step 1: 95℃, 3 minutes; Step 2: 47℃, 1 minute; Step 3: 68℃, 2 minutes; Step 1 to Step 3 are cycled 16 times; Step 4: 72℃, 10 minutes; the MP24-G9 is biotin-labeled.

[0039] Furthermore, the magnetic bead bonding in step (7) includes:

[0040] To prepare streptavidin C1 magnetic beads, wash 8 μL of magnetic beads with 100 μL of 1 B&W buffer for each sample, aspirate and transfer several times, place on a magnetic rack, and remove the supernatant; repeat once.

[0041] Resuspend the magnetic beads in 10 μL of 1 B&W buffer;

[0042] Add 22 μL of 4 B&W to 68 μL of total reaction mixture and transfer the entire mixture to a 1.5 mL LoBind tube containing pre-washed streptavidin beads.

[0043] Transfer the tube to the ThermoMixer and shake at 1400 rpm for 30 min at 23 °C;

[0044] After binding, place the test tube on a magnetic rack and remove the supernatant;

[0045] Wash the tube several times with 100 μL of 1 B&W buffer, place it on a magnetic rack, and remove the supernatant.

[0046] Wash the magnetic beads three times with 150 μL EBT buffer; resuspend the magnetic beads.

[0047] Furthermore, the DNA amplification PCR system is as follows:

[0048]

[0049] The PCR program was as follows: 3 min at 95°C; 30 s at 95°C; 30 s at 58°C; 1 min at 70°C; 3 min at 72°C.

[0050] Furthermore, the DNA purification was performed using magnetic AMPure beads.

[0051] The beneficial technical effects of this invention include:

[0052] 1. This invention requires only a few hundred cells to detect histone modifications.

[0053] 2. The entire process, from chromatin immunoprecipitation to library construction, requires almost no DNA purification steps. All reactions are carried out in the same low-adsorption tube, which greatly reduces sample loss and improves the success rate of experiments under low starting conditions.

[0054] 3. MNase digestion is used instead of ultrasonic disruption to avoid epitope masking problems that may be caused by cross-linking. Using natural (non-cross-linked) chromatin instead of cross-linked chromatin simplifies the process and improves recovery rate, making it more suitable for studying dynamic chromatin states and weakly binding proteins, while reducing experimental steps.

[0055] 4. Library construction is performed using the TELP method, achieving efficient capture through PolyC tailing and biotin-labeled anchoring primers. rSAP removes only the 3'-phosphate, preparing for subsequent tailing reactions, and is heat-inactivated, eliminating the need for purification steps and traditional end-repair enzyme systems. In addition, TELP has high sensitivity to low starting amounts of DNA, making it suitable for trace amounts of DNA produced by ChIP-seq.

[0056] 5. Extension is performed using biotin-anchored primers and captured by streptavidin magnetic beads. All subsequent steps (washing, ligation) are performed on the magnetic beads, greatly reducing sample transfer loss. Furthermore, tailing is performed directly using 3'-OH, bypassing the end repair and A-tailing steps that are most prone to loss in traditional library construction. Attached Figure Description

[0057] Figure 1 For quality control verification - Mnase and PK verification diagrams, a in the diagram represents agarose gel electrophoresis; b represents Coomassie brilliant blue staining;

[0058] Figure 2 For quality control validation - screening for appropriate MNase concentrations;

[0059] Figure 3 For quality control verification - IP: binding rate of antibody to Dynabeads;

[0060] Figure 4 Adjust the primer quantity chart;

[0061] Figure 5 For quality control validation - rSAP;

[0062] Figure 6 The designed MP24-G9-BIO primer sequence;

[0063] Figure 7For quality control verification - extension product connected to MP24-G9-BIO

[0064] Figure 8 For quality control verification - Beads;

[0065] Figure 9 For quality control verification - adapter TA, primer i501;

[0066] Figure 10 For quality control verification - whether DNA can be eluted from the beads;

[0067] Figure 11 Overall flowchart;

[0068] Figure 12 The sample is a library constructed after chromatin co-precipitation using H3K27ac antibody. Detailed Implementation

[0069] I. Cell lysis and MNase fragmentation

[0070] 1. Rinse the cells with 1 × PBS to remove any remaining MEM medium.

[0071] 2. Place the cells in a 200 μL low DNA binding tube, rotate rapidly to remove as much liquid as possible without touching the cells, and lyse each sample with 19 μL of lysis buffer, aspirating several times.

[0072] 3. Place the test tube on ice for 5 minutes.

[0073] 4. Add 19 μL of MNase working buffer and mix gently.

[0074] 5. Add 2 μL of diluted 0.01 U / μL MNase, gently tap the test tube to mix, and then transfer the test tube to a 37℃ metal bath and heat for 5 min.

[0075] 6. Add 5 μL of stop buffer to terminate the reaction, gently vortex, and wait for 2 min at room temperature.

[0076] 7. Add 45 μL of pre-cooled 2×RIPA buffer and 2 μL of 100× protease inhibitor, and vortex thoroughly.

[0077] 8. Rotate at maximum speed for 10 minutes at 4 ℃.

[0078] 9. Transfer the supernatant to a new test tube, making sure it doesn't touch the bottom, and place it on ice.

[0079] 10. Before adding the antibody, replenish each chromatin sample with 40 μL of RIPA buffer.

[0080] II. Immunoprecipitation

[0081] 1. Incubate the IP samples obtained in step one with 1-1.5 μg of anti-histone modified antibody. Place the test tubes on a tube rotator and incubate overnight at 4°C.

[0082] 2. Each IP sample requires 100 μg of Protein A Dynabeads. The next day, wash the Dynabeads several times with 100 μL RIPA buffer. Place the test tube on a magnetic rack and remove the supernatant.

[0083] 3. Repeat step 2 once.

[0084] 4. Resuspend Dynabeads in 10 μL RIPA buffer to obtain pre-washed beads.

[0085] 5. Add 10 μL of pre-washed microbeads to each IP sample, mix well by aspiration, and incubate at 4 °C for 2 hours by rotation.

[0086] III. Magnetic Bead Washing

[0087] 1. Place the sample processed in step two on a magnetic rack to precipitate the beads, and then discard the supernatant.

[0088] 2. Resuspend the magnetic beads in 150 μL of RIPA buffer, place the test tube on a tube rack at 4 °C for 5 min to wash away nonspecific binding, place the test tube on a magnetic rack, and remove the supernatant.

[0089] 3. Repeat step 2 more than twice.

[0090] 4. Resuspend the microbeads in 150 μL of LiCl washing buffer and place the test tube on a tube rotator at 4 °C for 5 min. Place the test tube on a magnetic rack and remove the supernatant.

[0091] 5. Quickly rotate the test tube to completely remove any remaining LiCl buffer. For each IP sample, resuspend the beads in 27 μL of EB buffer and 1 μL of 10 Ex Taq buffer.

[0092] IV. rSAP Repair

[0093] 1. Add 1 μL of proteinase K to the sample obtained in step 3, mix well, transfer the test tube to ThermoMixer, and shake at 1400 rpm for 2 h at 55 °C to digest the protein.

[0094] 2. Centrifuge the test tube rapidly, place it on a magnetic rack, transfer the supernatant to a new test tube, and incubate at 72 °C for 40 minutes to inactivate proteinase K.

[0095] 3. Add 1 μL of rSAP and incubate in a block at 37 °C for 1 hour.

[0096] 4. Place the test tube in a 65°C block for 15 minutes to inactivate rSAP.

[0097] V. TdT reaction

[0098] 1. Add 1 μL of 1 mM dCTP to each sample, vortex to mix, incubate at 95 °C for 3 min to denature the DNA, and then immediately cool rapidly on ice for 1 min.

[0099] 2. Add 1 μL of terminal transferase (TdT) to the sample and incubate the sample in a block at 37 °C for 35 min to extend the polyC tail.

[0100] 3. Add 1 μL of 1 mM dATP to each sample and vortex to mix. Incubate the samples at 37 °C for 5 minutes.

[0101] 4. Place the test tube in a 75 °C block for 20 min to inactivate TdT.

[0102] VI. Extension Reaction

[0103] 1. As shown in Table 1, the extension mixture was prepared using hot-start polymerase.

[0104] Table 1

[0105]

[0106] MP24-G9 is represented as: GTTCAGACGTGTGCTCTTCCGATCTGGGGGGGGGG.

[0107] 2. Add 29.8 μL of extension mixture to each sample, vortex to mix, and run the following program in the PCR instrument:

[0108] Step 1: 95℃, 3 minutes;

[0109] Step 2: 47℃, 1 minute;

[0110] Step 3: 68℃, 2 minutes;

[0111] Steps 1-3 constitute one cycle, repeat 16 times.

[0112] Step 4: 72℃, 10 minutes.

[0113] 3. To remove excess extension primers, add 2 μL of exonuclease I (Exo I) and 6 μL of its buffer to the above extension reaction, and then incubate at 37 °C for 1 hour.

[0114] 4. Place the test tube in a 72°C container for 15 minutes to inactivate the ExoI enzyme.

[0115] VII. Magnetic Bead Combination

[0116] 1. During Exo I digestion, streptavidin C1 magnetic beads were prepared. Each sample was washed with 100 μL of 1 B&W buffer, and the beads were aspirated and moved up and down several times. The beads were then placed on a magnetic rack and the supernatant was removed.

[0117] 2. Repeat step 1 again.

[0118] 3. Finally, resuspend the beads in 10 μL of 1 B&W buffer.

[0119] 4. After Exo I treatment, add 22 μL of 4 B&W to 68 μL of total reaction mixture and transfer the entire mixture to a 1.5 mL LoBind tube containing pre-washed streptavidin beads.

[0120] 5. Transfer the tube to the ThermoMixer and shake at 1400 rpm (on for 10 seconds, off for 10 seconds) at 23 °C for 30 minutes.

[0121] 6. After combination, place the test tube on a magnetic rack and remove the supernatant.

[0122] 7. Rinse the tube several times with 100 μL of 1 B&W buffer, place the tube on a magnetic rack, and remove the supernatant.

[0123] 8. As described above, wash the beads three times with 150 μL of EBT buffer.

[0124] 9. Resuspend the beads in 8.4 μL of EB buffer and prepare the sample for adapter ligation.

[0125] 8. Connector Connection

[0126] 1. Prior to ligation, a 10 μM DNA adaptor was prepared by mixing 5 μL of 100 μM oligomer P1_TALK_A_p, 5 μL of 100 μM oligomer P1_TALK_B, 5 μL of annealing buffer, and 35 μL of water. The mixture was heated at 95 °C for 3 minutes and then gradually cooled to 37 °C over 1 hour.

[0127] 2. As shown in Table 2, establish a linkage reaction on ice.

[0128] Table 2

[0129]

[0130] 3. Connect the beads on a rotating wheel overnight (more than 15 hours) at 4 °C to prevent magnetic bead deposition.

[0131] ABclonal adaptor connector sequence:

[0132] Truncated UMIAdapterOligo 1 5'-ACACTCTTTCCCTACACGACGCTCTTCCGATCTNNN(S)T-3'

[0133] Truncated UMIAdaperOligo2 5'-(S)NNNAGATCGGAAGAGCACACGTCTGAACTCCAGTC-3'

[0134] 9. DNA elution

[0135] 1. The next day, allow the suspension to reach room temperature and let it stand on the table for 10 minutes.

[0136] 2. When the test tube is on the magnetic rack, remove the supernatant by aspiration.

[0137] 3. Rinse the tube several times with 100 μL of 1 B&W buffer, place it on a magnetic rack, and remove the supernatant.

[0138] 4. As described above, wash the beads three times with 150 μL of EBT buffer.

[0139] 5. In ThermoMixer, elute DNA in 30 μL EB buffer, set to 72 °C, and oscillate at 1400 rpm (10 s on, 10 s off) for 30 min.

[0140] 6. After elution, briefly centrifuge the bead suspension at 100 g for 10 s. Collect the DNA from the supernatant by aspiration on a magnetic rack, and then perform PCR amplification directly.

[0141] 10. DNA Amplification

[0142] 1. Prepare PCR mixtures as shown in Table 3:

[0143] Table 3

[0144]

[0145] The primer sequences for P1 and FL are:

[0146] P1 TALK_A_P:GACGCTTCTCCGATC*T[PHO]

[0147] P1TALK_B:[PHО]GATCGGAAGAGCGTCGTGTAGGGAAAGAGTG*T[PHO]

[0148] 2. Run the following PCR program:

[0149] Step 1: 3 min at 95°C;

[0150] Step 2: 30 seconds at 95 °C;

[0151] Step 3: Maintain 58°C for 30 seconds;

[0152] Step 4: 1 minute at 70°C;

[0153] Step 5: Maintain 72°C for 3 minutes.

[0154] XI. DNA Purification

[0155] 1. PCR reactions should be purified using methods suitable for NGS. In this protocol, magnetic AMPure beads are used for purification (e.g., add 50 μL of AMPure beads (1:1 ratio) to the PCR product).

[0156] 2. Mix thoroughly and incubate the sample at room temperature for 10 minutes.

[0157] 3. Place the test tube on a magnetic rack and wait for 1 minute until the solution becomes clear.

[0158] 4. Carefully remove and discard the supernatant.

[0159] 5. Add 200 μL of 80% ethanol to the test tube, wait for 1 min, and then remove the ethanol.

[0160] 6. Repeat step 5 again.

[0161] 7. Rinse the test tubes briefly and place them on a magnetic rack to remove any residual ethanol.

[0162] 8. Let the test tube stand to allow the microbeads to air dry for 2 minutes.

[0163] 9. Resuspend the microbeads in 30 μL of EB buffer.

[0164] 10. Mix vigorously with a pipette and incubate at room temperature for 1 min.

[0165] 11. Place the test tube on a magnetic rack, transfer the clear supernatant to a PCR tube, and the library can then be sequenced.

[0166] Interpretation of the attached image:

[0167] 1. Following the first step of cell lysis and MNase fragmentation, the functions of MNase and PK enzymes were verified. Figure 1 The conclusions can be drawn that: Mnase can cleave chromatin into individual nucleosomes (approximately 146 bp); PK can digest proteins.

[0168] 2. Take another 100,000 ordinary HeLa cells, lyse them, divide each half into five equal parts, treat each part with different concentrations of Mnase enzyme, and then uniformly add PK digestion solution. Based on the results... Figure 2 The conclusion is that the optimal concentration of Mnase is 0.04 U and the treatment time is 5 min.

[0169] 3. In step two, each IP sample requires 100 μg of Protein A Dynabeads; therefore, the binding rate between the antibody and Dynabeads needs to be determined. Magnetic beads were serially diluted with BSA and IgG, and then combined with the IP supernatant for Western blotting experiments. Figure 3 As shown, it can be concluded that 100 μL of protein binds 25-30 μg of IgG-Dynabeads, and 4 μL of protein binds 1 μg-1.2 μg of IgG-Dynabeads.

[0170] 4. During the experiment, it was found that the amount of primer might be too high, so the primer amount needed to be adjusted. After the cells were treated with Mnase 0.04U for 5 min in step one, they were incubated with H3K27ac and H3K9me3 antibodies at different cell cycle time points. Then, the incubated DNA was subjected to PCR with different concentrations of primer, followed by agarose gel electrophoresis. Figure 4 The results show that the optimal primer concentration is 0.1 μM (1 μL).

[0171] 5. rSAP (Shrimp Alkaline Phosphatase, a heat-sensitive recombinant alkaline phosphatase): Catalyzes the dephosphorylation of 5' and 3' phosphate monoesters in DNA and RNA, removing phosphate groups from substrate molecules through hydrolysis of phosphate monoesters, generating phosphate ions and free hydroxyl groups. Functional validation of the rSAP used in step five: Samples with added TdT adapters were subjected to agarose gel electrophoresis together with MNase-treated samples. Figure 6 The results showed that, compared with the samples treated with MNase alone, the strips of the samples with added TdT connectors shifted, proving that rSAP can play a role.

[0172] 6. Figure 6The designed MP24-G9-BIO primer sequence is represented as: GTTCAGACGTGTGCTCTTCCGATCTGGGGGGGGGG.

[0173] 7. Extend the mixture using MP24-G9-BIO primers, then perform agarose gel electrophoresis together with the bound supernatant. Figure 7 The results show that the beads moved to one side, proving that the extension product was linked to MP24-G9-BIO. Simultaneously, 1 μg of the PCR product was subjected to TDT-extension, and after binding with the beads, the amount of DNA bound to the beads was small. Therefore, the area marked by the blue box is not visible because the amount of DNA was too small.

[0174] 8. After the PCR products are bound to the beads, the supernatant and beads are subjected to agarose gel electrophoresis. Figure 8 The area marked by the red box shows a clear displacement of the strip after binding, which proves that the beads can function normally.

[0175] 9. Primer i501 sequence: P1_TALK_A_p: GACGCTCTTCCGATC*T[PHO],

[0176] P1_TALK_B:[PHO] GATCGGAAGAGCGTCGTGTAGGGAAAGAGTG*T[PHO], after amplification of the PCR product, gel extraction was performed, followed by agarose gel electrophoresis, according to... Figure 9 The results confirm that the adapter and primer i501 are not the problem.

[0177] 10. To investigate DNA elution efficiency, the supernatant after binding, the buffer from intermediate washing, and the eluted DNA were subjected to agarose gel electrophoresis together. Figure 10 The results and the data in the table below clearly show that the DNA elution rate can reach 50%-60% recovery rate.

[0178]

[0179] 11. Following all the improved experimental methods and standard procedures mentioned above, obtain the agarose gel electrophoresis image after IP treatment of the sample with H3K27ac antibody.

[0180] Lane 1 is the positive control, and lanes 2 and 3 contain samples prepared for library construction using H3K27ac antibody chromatin co-precipitation. The i5 / i7 primers used in PCR are:

[0181] UDIPrimers1(P5): 5'-AATGATACGGCGACCACCGAGATCTACAC[i5 index]ACACTCTTCCTACACGA CGCTCTTCCGATCT-3'

[0182] UDIPrimers2(P7): 5'-CAAGCAGAAGACGGCATACGAGAT[i7index]GTGACTGGAGTTCAGACGTGTGCT CTTCCGATCT-3'

[0183] Figure 11 The image shows a gel image of histone-modified ChIP-seq obtained by the optimized method of the present invention before sequencing. It can be seen that the main band is clear and the DNA fragments are concentrated in size (mainly distributed in 300bp), which significantly increases the proportion of effective data in the final sequencing data.

[0184] The overall flowchart of this invention is as follows: Figure 12 As shown.

Claims

1. A small-scale TELP-assisted rapid chromatin immunoprecipitation sequencing method, characterized by, The method comprises the following steps: (1) The cells to be tested are subjected to cell lysis and MNase fragmentation to obtain fragmented DNA with nucleosomes, denoted as an IP sample; (2) Immunoprecipitation: The IP sample obtained in step (1) is subjected to immunoprecipitation to obtain an IP sample combined with magnetic beads; (3) Magnetic bead washing: The IP sample combined with magnetic beads is washed clean to remove non-specific binding; (4) rSAP repair: rSAP is added to inactivate proteinase K, and pure DNA fragments not carrying nucleosomes are obtained; (5) TdT reaction: Terminal transferase (TdT) is added to extend the polyC tail; (6) Extension reaction: DNA is amplified in large quantities through a PCR reaction; (7) Magnetic bead binding: Streptavidin C1 magnetic beads are prepared and combined with the sample; (8) Linker ligation: The sample combined with the linker is obtained; (9) DNA elution: DNA is eluted from the magnetic beads into EB buffer; (10) DNA amplification: A large amount of DNA product is obtained through PCR; (11) DNA purification: A DNA product with high purity is obtained.

2. The small-scale TELP-assisted rapid chromatin immunoprecipitation sequencing method according to claim 1, characterized in that: The step (1) specifically comprises: The cells are placed in 200 μL DNA low-binding tubes, and after rapid rotation, the liquid is removed as much as possible, and each sample is lysed with 19 μL lysis buffer; The test tube is placed on ice for 5 min, 19 μL MNase working buffer is added, and it is mixed gently; 2 μL of diluted 0.01 U / μL MNase is added, the test tube is mixed by flicking, and then the test tube is transferred to a 37℃ metal bath for heating for 5 min; 5 μL of termination buffer is added to terminate the reaction, it is vortexed gently, and it is left to stand at room temperature for 2 min; 45 μL of pre-cooled 2×RIPA buffer and 2 μL of 100×protease inhibitor are added, and it is vortexed thoroughly; it is rotated at the maximum speed at 4 ℃ for 10 min, and the supernatant is transferred to a new test tube.

3. The small-scale TELP-assisted rapid chromatin immunoprecipitation sequencing method according to claim 1, characterized in that: The immunoprecipitation in step (2) comprises: The IP samples are respectively incubated with 1-1.5 μg of anti-histone modification antibody, and are left to stand overnight at 4℃; The next day, 100 μL of RIPA buffer is used to wash the Dynabeads up and down several times, 100 μg of protein A Dynabeads are required for each IP sample, the test tube is placed on a magnetic rack, and the supernatant is removed; this step is repeated once; The Dynabeads are resuspended in 10 μL of RIPA buffer to obtain pre-washed beads; 10 μL of pre-washed beads are added to the IP sample, and it is pipetted to mix, and is incubated at 4 ℃ for 2 hours.

4. The small-scale TELP-assisted rapid chromatin immunoprecipitation sequencing method according to claim 1, characterized in that: The rSAP repair in step (4) comprises: 1 μL of proteinase K is added to the sample obtained in step (3), it is mixed, the test tube is transferred to a ThermoMixer, and is shaken at 1400 rpm at 55 ℃ for 2 h; It is centrifuged, the supernatant is transferred to a new test tube, and is left to stand at 72 ℃ for 40 min; 1 μL of rSAP is added and is incubated at 37℃ for 1 h; The test tube is placed in a 65℃ block for 15 min to inactivate the rSAP.

5. The small-scale TELP-assisted rapid chromatin immunoprecipitation sequencing method according to claim 1, characterized in that: The TdT reaction in step (5) comprises: Add 1 μL 1 mM dCTP to the sample, vortex to mix, denature the DNA by incubating at 95 ℃ for 3 min, then immediately cool on ice for 1 min; Add 1 μL terminal transferase (TdT), incubate at 37 ℃ for 35 min to extend the polyC tail; Add 1 μL 1 mM dATP, vortex to mix, incubate at 37 ℃ for 5 min; Place the tube at 75 ℃ to inactivate TdT.

6. The small-scale TELP-assisted rapid chromatin immunoprecipitation sequencing method according to claim 1, characterized in that: The reaction system of the PCR reaction of step (6) is as follows: to the mixed solution after the reaction of step (5), add the following substances: double distilled water 6.2 μL, 5×KAPA buffer A 12 μL, 2.5 mM dNTP 4.8 μL, 2uM MP24-G9 6 μL, KAPA 2G polymerase 0.8 μL; the reaction program is as follows: first step: 95 ℃, 3 min; second step: 47 ℃, 1 min; third step: 68 ℃, 2 min; cycle 16 times for the first to third steps; fourth step: 72 ℃, 10 min; the MP24-G9 has a biotin label.

7. The small-scale TELP-assisted rapid chromatin immunoprecipitation sequencing method according to claim 1, characterized in that: The magnetic bead binding of step (7) comprises: Prepare streptavidin C1 magnetic beads, wash 8 μL of magnetic beads with 100 μL of 1 B&W buffer per sample, pipette up and down several times, place on a magnetic stand, and remove the supernatant; repeat 1 time; Resuspend the magnetic beads in 10 μL of 1 B&W buffer; Add 22 μL of 4 B&W to 68 μL of total reaction mixture, and transfer all to a 1.5 mL LoBind tube containing pre-washed streptavidin beads; Transfer the tube to a ThermoMixer and shake at 1400 rpm at 23 ℃ for 30 min; After binding, place the tube on a magnetic stand and remove the supernatant; Blow up and down several times with 100 μL of 1 B&W buffer, place the tube on a magnetic stand, and remove the supernatant; Wash the magnetic beads with 150 μL of EBT buffer three times; resuspend the magnetic beads.

8. The small-scale TELP-assisted rapid chromatin immunoprecipitation sequencing method according to claim 1, characterized in that: The DNA amplification PCR system is as follows: The PCR program is as follows: 95 °C for 3 min; 95 °C for 30 s; 58 °C for 30 s; 70 °C for 1 min; 72 °C for 3 min.

9. The small-scale TELP-assisted rapid chromatin immunoprecipitation sequencing method according to claim 1, characterized in that: The DNA purification is purified by magnetic AMPure beads.

Images