Children brain injury detection marker and application thereof

By using 3'tiRNA-50-SerCGA-4 as a biomarker for pediatric brain injury, the problem of insufficient detection sensitivity in existing technologies has been solved, achieving highly sensitive non-invasive or minimally invasive detection, reducing detection costs, and providing new diagnostic and treatment pathways.

CN121428081APending Publication Date: 2026-01-30ZHEJIANG PHARMA COLLEGE +1
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511547496.9
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-10-28
Publication Date
2026-01-30

AI Technical Summary

Technical Problem

Existing technologies for detecting pediatric brain injury have low sensitivity, especially for mild brain injury, leading to a lack of early intervention and increasing the risk of long-term sequelae.

Method used

3'tiRNA-50-SerCGA-4 was used as a diagnostic biomarker for pediatric brain injury. The expression level of 3'tiRNA-50-SerCGA-4 in umbilical cord blood, whole blood, serum or cerebrospinal fluid was detected and classified in combination with matching test reagents.

Benefits of technology

It achieves highly sensitive detection of pediatric brain injury, provides non-invasive or minimally invasive detection methods, reduces discomfort for children, lowers detection costs, and opens up new pathways for subsequent molecular diagnosis, treatment, and prognosis.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121428081A_ABST
    Figure CN121428081A_ABST
Patent Text Reader

Abstract

The invention provides a child brain injury detection marker and application thereof, and belongs to the technical field of in-vitro diagnosis. The pediatric brain injury detection marker provided by the invention is 3 'tiRNA-50-SerCGA-4 which is a lysis product for transferring RNA in body fluid, the expression level of the 3' tiRNA-50-SerCGA-4 is confirmed to be related to pediatric brain injury for the first time, and the pediatric brain injury detection marker provided by the invention has the advantages of high specificity and high sensitivity, and can be used for detecting pediatric brain injury. The non-invasive or minimally invasive detection of the child brain injury can be realized, and the method has a wide application prospect.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of in vitro diagnosis, in particular to a pediatric brain injury detection marker and application thereof. BACKGROUND

[0002] Pediatric brain injury refers to central nervous injury caused by various perinatal high-risk factors, infection, trauma, accidental asphyxia, poisoning, cerebrovascular disease and the like during infancy, and the clinical manifestations are central motor disorders, cognitive disorders, language disorders, seizures, visual and auditory disorders, social interaction and psychological behavior disorders and the like. Among them, premature infants are more likely to induce brain injury due to the influence of hypoxia-ischemia, intrauterine infection and other high-risk factors, and the main pathological manifestations of brain injury are periventricular white matter softening (PVL) and periventricular-intraventricular hemorrhage (PVH-IVH). According to the degree of injury and clinical prognosis, brain injury can be divided into mild, moderate and severe brain injury.

[0003] At present, the detection means for pediatric brain injury in the clinic mainly relies on imaging examination, including B-ultrasound and magnetic resonance imaging (MRI). However, the test accuracy of B-ultrasound as a bedside screening tool is greatly influenced by the operator's technology, and the resolution ability of B-ultrasound for small lesions is limited. Although MRI has the advantage of high resolution, the patient needs to be deeply individualized sedated before MRI examination, and the vital signs of premature infants are unstable and difficult to tolerate the sedation process. In addition, although the current B-ultrasound and MRI examination have good specificity for moderate and severe pediatric brain injury, B-ultrasound and MRI still have the defect of low detection sensitivity for mild pediatric brain injury, and cannot accurately detect mild pediatric brain injury, which will lead to the lack of early intervention of mild pediatric brain injury and aggravate the long-term sequelae risk of mild pediatric brain injury.

[0004] Therefore, it is necessary to develop a high-sensitivity pediatric brain injury detection method. SUMMARY

[0005] The technical problem to be solved by the present application is how to improve the detection sensitivity of pediatric brain injury.

[0006] To solve the above technical problems, the present application provides a pediatric brain injury detection marker in the first aspect, and the pediatric brain injury detection marker is 3'tiRNA-50-SerCGA-4. The nucleotide sequence of 3'tiRNA-50-SerCGA-4 is shown in SEQ ID No. 1.

[0007] In the technical scheme provided by the present application, the 3'tiRNA-50-SerCGA-4 in the body fluid, especially in the umbilical cord blood, can be used as a diagnostic biomarker for pediatric brain injury. The molecule is a specific cleavage product of serine tRNA (codon CGA), and the present application first confirms that the cleavage product can be used as a detection marker for pediatric brain injury, and has the advantages of high specificity and high sensitivity.

[0008] The second aspect of the present application provides an application of the pediatric brain injury detection marker of the first aspect, and the application is that the 3'tiRNA-50-SerCGA-4 is used for detection and typing of pediatric brain injury.

[0009] Preferably, the 3'tiRNA-50-SerCGA-4 is derived from umbilical cord blood, whole blood, serum, plasma or cerebrospinal fluid.

[0010] The third aspect of the present application provides a pediatric brain injury detection product, which comprises a 3'tiRNA-50-SerCGA-4 detection reagent.

[0011] Preferably, the 3'tiRNA-50-SerCGA-4 detection reagent comprises an upstream primer shown in SEQ ID No. 2 and a downstream primer shown in SEQ ID No. 3.

[0012] Preferably, the pediatric brain injury detection product further comprises a control gene detection reagent.

[0013] Preferably, the control gene detection reagent comprises a housekeeping gene detection reagent.

[0014] Preferably, the pediatric brain injury detection product further comprises any one or more of an RNA extraction reagent, a cDNA synthesis reagent and a PCR premix.

[0015] Compared with the prior art, the present application has the following beneficial effects: 1. The present application first confirms that 3'tiRNA-50-SerCGA-4 can be used as a diagnostic marker for pediatric brain injury, and at the same time, the expression level of 3'tiRNA-50-SerCGA-4 is positively correlated with the degree of brain injury. Combined with the matching detection reagent provided by the present application, the quantitative typing of pediatric brain injury can be realized, which provides a new idea for the detection and typing of pediatric brain injury. 2. The pediatric brain injury detection biomarker 3'tiRNA-50-SerCGA-4 provided by this invention can be found in umbilical cord blood. By detecting the expression level of 3'tiRNA-50-SerCGA-4 in umbilical cord blood, non-invasive detection of pediatric brain injury can be achieved. By detecting the expression level of 3'tiRNA-50-SerCGA-4 in the blood or cerebrospinal fluid of the child, minimally invasive detection of pediatric brain injury can be achieved. Compared with the sedation method of MRI detection, the detection method of the pediatric brain injury detection biomarker provided by this invention is gentler, reducing the detection threshold and minimizing the discomfort of the child. 3. The pediatric brain injury detection biomarkers provided by this invention can be prepared into detection products such as reagent kits. The products have a high degree of integration. While promoting mutual recognition of pediatric brain injury detection, they can significantly reduce detection costs compared to MRI examinations. 4. This invention reveals for the first time the strong correlation between 3'tiRNA-50-SerCGA-4 and pediatric brain injury, which opens up a new path for the molecular diagnosis, treatment and prognosis of pediatric brain injury. Attached Figure Description

[0016] Figure 1 The results of the analysis of the relative expression levels of 3'tiRNA-50-SerCGA-4 in healthy infants and children with brain injury; Figure 2 The results are from logistic regression combined with ROC analysis. Detailed Implementation

[0017] To make the above-mentioned objects, features, and advantages of the present invention more apparent and understandable, specific embodiments of the present invention are described in detail below. It should be noted that the following embodiments are only used to illustrate the implementation methods and typical parameters of the present invention, and are not intended to limit the parameter range described in the present invention. Reasonable variations derived therefrom are still within the protection scope of the present invention.

[0018] It should be noted that the endpoints and any values ​​of the ranges disclosed herein are not limited to the precise ranges or values, and these ranges or values ​​should be understood to include values ​​close to these ranges or values. For numerical ranges, the endpoint values ​​of the various ranges, the endpoint values ​​of the various ranges and individual point values, and individual point values ​​can be combined with each other to obtain one or more new numerical ranges, which should be considered as specifically disclosed herein.

[0019] As described in the background section, existing methods for detecting pediatric brain injury suffer from drawbacks such as insufficient specificity and sensitivity, and significant invasiveness.

[0020] In view of this, a specific embodiment of the present invention provides a biomarker for detecting pediatric brain injury. Specifically, the biomarker for detecting pediatric brain injury is 3'tiRNA-50-SerCGA-4, the nucleotide sequence of which is shown in SEQ ID No.1.

[0021] SEQ ID No. 1: AAATCCAATGGGGGTTTCCCCGCACAGGTTCGAATCCTGTTCGTGACGCCA.

[0022] The technical solution of the present invention is further described below through specific embodiments. Unless otherwise defined, all terms, symbols, and other scientific terms used herein are intended to have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. In some cases, terms having a conventional meaning are defined herein for clarification or ease of reference, and such definitions should not be construed as indicating a significant difference from the conventional understanding in the art. The technical methods described or referenced herein are generally well understood by those skilled in the art and have been employed by conventional methods. Unless otherwise stated, the use of commercially available kits, reagents, and instruments shall be performed according to the manufacturer's instructions and parameters.

[0023] Example 1 Biomarker validation Umbilical cord blood was collected from healthy infants and children diagnosed with brain injury. After centrifugation, total RNA was extracted from the umbilical cord blood using TRIzol reagent. The mass of the final purified total RNA was measured to be 1-2 μg using fluorescence method.

[0024] Pre-test cDNA synthesis of small RNAs (tRFs and tiRNAs) using the rtStar™ tRFs & tiRNAs and the rtStar™ First-Strand cDNA Synthesis Kit (Arraystar, Rockville, MD, USA) includes the following steps: 3'-terminal deacetylation treatment: Prepare the reaction solution as shown in Table 1: Table 1 After vortexing the system shown in Table 1, incubate at 37°C for 40 min, then add 19 µL of Deacylation Stop Buffer, vortex mix, and incubate at room temperature for 5 min to terminate the deacetylation reaction.

[0025] Removal of 3'-cP and addition of 5'-P: Place the deacetylation reaction solution on ice and add the reagents shown in Table 2 in sequence: Table 2 After vortex mixing, incubate at 37°C for 40 min, then terminate the reaction by incubating at 70°C for 5 min. Extract total RNA from the reaction solution again using TRIzol reagent to obtain Input RNA.

[0026] Demethylation treatment: Prepare the demethylation reaction solution according to Table 3: Table 3 Incubate the above reaction system at 37°C for 2 h, then add 40 µL of Nuclease-free Water and 10 µL of Demethylation Stop Buffer (5×) to terminate the demethylation reaction. Extract total RNA from the reaction solution again using TRIzol reagent to obtain sample RNA.

[0027] 3' adapter ligation: Prepare the following reaction system according to Table 4: Table 4 Incubate the reaction system shown in Table 4 at 70°C, then add the reagents shown in Table 5 to the reaction system: Table 5 Continue incubating the reaction system at 25°C for 1 h to complete the 3' adapter ligation reaction.

[0028] Reverse transcription primer hybridization: Add the reagents shown in Table 6 to the reaction system after completing the 3' adapter ligation reaction: Table 6 Incubate the reaction system shown in Table 6 at 75°C for 5 min, at 37°C for 15 min, and at 25°C for 15 min, respectively, to complete the reverse transcription primer hybridization step.

[0029] 5' adapter ligation: After incubation of the reaction system shown in Table 6 is completed, prepare the reaction system shown in Table 7: Table 7 Incubate the reaction system shown in Table 7 at 25°C for 1 h to complete the 5' adapter ligation reaction and obtain Adaptor Ligated RNA.

[0030] Reverse transcription reaction: Prepare the reaction system shown in Table 8: Table 8 The reaction system shown in Table 8 was incubated at 50°C for 1 hour to obtain cDNA, and the cDNA was temporarily stored on ice. The cDNA was 3'tiRNA-50-SerCGA-4 gene.

[0031] Due to the influence of RNA concentration quantitative error and RNA reverse transcription efficiency error, the content of cDNA in each sample at the same volume is not exactly the same. In order to correct this difference, the present application uses the housekeeping gene U6 as an internal reference. The value of the sample to be tested is divided by the value of the internal reference of the sample. The final ratio is the relative content of the sample to be tested.

[0032] The primer sequence, annealing temperature and product length of U6 gene and 3'tiRNA-50-SerCGA-4 gene are shown in Table 9: Table 9 The PCR reaction system was prepared according to the system shown in Table 10: Table 10 After the PCR system shown in Table 10 was mixed, the fluorescence quantitative PCR reaction was carried out. The PCR reaction program was (95°C pre-denaturation, 10 min) x 1 cycle + [(95°C, 10s) + (60°C annealing, 60s)] x 40 cycles. The fluorescence was collected during annealing to obtain PCR products.

[0033] After electrophoresis confirmed that the PCR products were single specific amplification bands, the concentration of the PCR products was set to 1, and the PCR products were diluted according to a 10-fold gradient. The lowest concentration was 1 x 10 -9

[0034] The diluted PCR products were taken to prepare the Realtime PCR reaction system shown in Table 11: Table 11 The system shown in Table 11 was placed in a 284-PCR hole plate, and the PCR reaction was carried out on a Realtime PCR instrument. The PCR reaction program was (95°C pre-denaturation, 10 min) x 1 cycle + [(95°C, 10s) + (60°C annealing, 60s)] x 40 cycles. The fluorescence was collected during annealing. After the amplification was completed, the melting curve generation program was run to generate a melting curve. The melting curve generation program was: [(95°C denaturation, 10s) + (60°C annealing, 60s) + (Ramp Rate 0.075°C / s to 95°C, 15s)] x n cycles to establish a melting curve.

[0035] ​The target gene and housekeeping gene for each sample were subjected to Real-time PCR reactions. Based on the plotted serially diluted DNA standard curves, the concentrations of the target gene and housekeeping gene for each sample were directly generated by the machine. The corrected relative content of this gene in each sample was calculated by dividing the target gene concentration by the housekeeping gene concentration.

[0036] Analysis of the relative expression levels of 3'tiRNA-50-SerCGA-4 in healthy infants (Control) and children with brain injury (Brain Injury) is as follows: Figure 1 As shown. By Figure 1 It was found that there was a statistically significant difference in the expression level of 3'tiRNA-50-SerCGA-4 between children with brain injury and healthy infants (Mann-Whitney U = 192.000, p = 0.001, two-tailed, Control = 2.55±0.79, brain injury group = 6.33±0.80, p = 0.002).

[0037] Figure 2 The results of logistic regression combined with ROC analysis are as follows: Figure 2 It is evident that the expression level of 3'tiRNA-50-SerCGA-4 exhibits extremely strong discriminatory power in brain injury grouping (AUC = 0.853, 95% CI: 0.704–1.000). At the critical point optimized by the Youden index, 3'tiRNA-50-SerCGA-4 achieves a sensitivity of 93.3% and a specificity of 73.3%, indicating that it possesses both a high true positive detection rate and a low false positive misclassification rate. The Wilcoxon test further confirmed that the distribution difference of 3'tiRNA-50-SerCGA-4 between the two groups was highly statistically significant (p = 0.001), demonstrating that 3'tiRNA-50-SerCGA-4 can serve as a reliable biomarker for brain injury classification.

[0038] Example 2 Correlation analysis of 3'tiRNA-50-SerCGA-4 expression level with clinical and physiological parameters: This embodiment aims to explore the potential association between the expression level of 3'tiRNA-50-SerCGA-4 and multiple clinical and physiological parameters of newborns and mothers, in order to comprehensively evaluate the biological significance of this biomarker and its indicative role under different physiological and pathological conditions.

[0039] First, we collected clinical and physiological data on healthy mothers and infants, as well as mothers and infants of children with brain injuries. Specifically, this included: Infant hypersensitive leukocyte count (hs-CRP), maternal pre-pregnancy weight, maternal height, maternal pre-pregnancy BMI, maternal weight gain, infant ROP (retinopathy of prematurity), infant BPD (bronchopulmonary dysplasia), infant NEC (necrotizing enterocolitis), neonatal late-onset sepsis, infant symptomatic PDA (patent ductus arteriosus), small for gestational age (SGA), infant three-month height, infant three-month weight, infant three-month head circumference, infant six-month height, infant six-month weight, infant six-month head circumference, infant six-month hemoglobin (HB), gestational age days, fetal weight (g), placental pathology acute chorioamnionitis occurrence, infant alanine aminotransferase (ALT), infant aspartate aminotransferase (AST), infant total bilirubin, infant direct bilirubin, infant indirect bilirubin, infant total protein, infant albumin, infant urea nitrogen, infant creatinine, infant blood potassium, infant blood sodium, infant blood chloride, infant blood calcium, infant blood magnesium, infant blood phosphorus, infant creatine kinase (CK), infant total cholesterol, infant triglyceride, infant creatine kinase MB isozyme (CK-MB), infant serum amyloid A (SAA). The above indexes are related to inflammatory development indexes, fetal development indexes, liver and kidney functions, neonatal complications, long-term growth and development indexes, and maternal related parameters.

[0040] The Kendall's tau-b non-parametric correlation analysis method was used to analyze the correlation between the relative expression level of 3'tiRNA-50-SerCGA-4 and each of the above parameter indexes, and the statistical significance level was set to p<0.05.

[0041] The analysis results are shown in Table 12: Table 12 The descriptive statistics (mean ± standard deviation) results are shown in Table 13: Table 13 As can be seen from Table 12 and Table 13, in the healthy control group, the expression level of 3'tiRNA-50-SerCGA-4 was not found to be statistically significantly correlated with all the detected clinical parameters (all p values>0.05). This suggests that in healthy individuals, the expression of 3'tiRNA-50-SerCGA-4 can be relatively stable, or the correlation between it and these parameters is not strong.

[0042] In the brain injury group, the expression level of 3'tiRNA-50-SerCGA-4 showed significant correlation with multiple parameters. Specifically, the expression level of 3'tiRNA-50-SerCGA-4 was significantly negatively correlated with the maternal pre-pregnancy weight (τ = -0.510, p = 0.017) and the pre-pregnancy BMI (τ = -0.581, p = 0.006). This suggests that in the children with brain injury, the maternal pre-pregnancy body type indicators (such as weight and BMI) are closely inversely associated with the expression level of 3'tiRNA-50-SerCGA-4. In addition, the expression level of 3'tiRNA-50-SerCGA-4 was significantly positively correlated with the infant blood chloride (τ = 0.535, p = 0.036). In the brain injury group, the creatine kinase MB isozyme (CK-MB) was not statistically significantly correlated with the expression level of 3'tiRNA-50-SerCGA-4 (p = 0.411), but the CK-MB was significantly negatively correlated with the maternal pre-pregnancy weight (τ = -0.494, p = 0.048), suggesting that in the brain injury group, the maternal pre-pregnancy weight may indirectly affect the level of CK-MB.

[0043] In summary, the Kendall's tau-b non-parametric correlation analysis results further support the difference in the correlation pattern of 3'tiRNA-50-SerCGA-4 with clinical parameters between the healthy control group and the brain injury group. In particular, in the children with brain injury, the expression level of 3'tiRNA-50-SerCGA-4 is significantly correlated with the maternal pre-pregnancy body type indicators and the infant blood chloride level, which provides a new perspective for the biomarker in the diagnosis of brain injury, risk assessment and potential mechanism research.

[0044] Although the present disclosure is disclosed as above, the protection scope of the present disclosure is not limited to this. Those skilled in the art can make various changes and modifications without departing from the spirit and scope of the present disclosure, and these changes and modifications will fall within the protection scope of the present disclosure.

Claims

1. A pediatric brain injury detection marker, characterized in that, The pediatric brain injury detection marker is 3'tiRNA-50-SerCGA-4, and the nucleotide sequence of the 3'tiRNA-50-SerCGA-4 is shown as SEQ ID No.

1.

2. Use of the biomarker of claim 1 for detecting pediatric brain injury, characterized in that, The 3'tiRNA-50-SerCGA-4 is used for detection and typing of pediatric brain injury.

3. Use according to claim 2, wherein the compound is ###0002### The 3'tiRNA-50-SerCGA-4 is derived from umbilical cord blood, whole blood, serum, plasma or cerebrospinal fluid.

4. A pediatric brain injury detection product, characterized by, The 3'tiRNA-50-SerCGA-4 detection reagent is included.

5. The pediatric brain injury detection product as described in claim 4, characterized in that, The 3'tiRNA-50-SerCGA-4 detection reagent includes an upstream primer shown as SEQ ID No. 2 and a downstream primer shown as SEQ ID No.

3.

6. The pediatric brain injury detection product of claim 4, wherein, A control gene detection reagent is also included.

7. The pediatric brain injury detection product of claim 6, wherein, The control gene detection reagent includes a housekeeping gene detection reagent.

8. The pediatric brain injury detection product of claim 4, wherein, Any one or more of an RNA extraction reagent, a cDNA synthesis reagent, a PCR premix is also included.