Methylation markers for diagnosis of ovarian clear cell carcinoma

Abstract

The present application relates to the biomedical technology field, and more particularly to a methylation marker for diagnosis of ovarian clear cell carcinoma. The present application can realize specific diagnosis of the type of ovarian cancer at the molecular level by detecting the methylation level of methylation markers MIR148A, CRLF1 and FER1L4 in ovarian clear cell carcinoma related samples. Compared with traditional histopathological diagnosis or conventional tumor marker detection (such as CA125, HE4, etc.), the detection system provided by the present application can realize high sensitivity, high specificity and low invasiveness in tissue or body fluid samples, effectively improving the accuracy of early detection and typing diagnosis.

Description

Technical Field

[0001] This invention relates to the field of biomedical technology, and in particular to a methylation marker for the diagnosis of clear cell carcinoma of the ovary. Background Technology

[0002] Ovarian clear cell carcinoma (OCCC) is a specific type of epithelial malignant tumor of the ovary. Although it does not account for the highest proportion of ovarian cancers, it has attracted considerable attention due to its unique pathological features and clinical behavior. As a highly aggressive tumor type, it accounts for approximately 5%-25% of epithelial ovarian tumors. OCCC is more common in Asian women, second only to high-grade serous carcinoma. OCCC not only has a unique epidemiological distribution, but its histological subtypes also have significant clinical implications: it is often closely associated with endometriosis (EMs) and is a high-risk factor for venous thromboembolism, occurring twice as frequently as other epithelial ovarian cancers. Furthermore, OCCC has poor sensitivity to platinum-based chemotherapy drugs and is prone to developing drug resistance, resulting in a poor prognosis for advanced-stage patients, suggesting that its treatment strategy needs to be differentiated from other ovarian cancer subtypes.

[0003] Compared to other ovarian cancer subtypes, OCCC is a unique subtype with specific pathological features. Typical characteristics of OCCC include its composition of clear, eosinophilic, and booty-like cells with polygonal tumor cells and clear or vacuolated cytoplasm. Notably, approximately half of OCCC patients also have endometriosis, suggesting a possible shared pathological mechanism or environmental influence. Histologically, the diagnosis of OCCC relies primarily on microscopic observation of cell morphology, including clear or vacuolated cytoplasm, irregular nuclei, and specific cell arrangement. While histological morphology can accurately identify OCCC in most cases, its diagnosis has a degree of subjectivity. OCCC cell nuclei exhibit a range from mild to significant atypia, primarily showing mild nuclear atypia. Meanwhile, intraoperative frozen section analysis presents challenges due to the low number of mitotic figures in OCCC cells and the difficulty in identifying the distinctive hobnail-shaped cells. This makes intraoperative frozen section diagnosis difficult, easily leading to misdiagnosis of OCCC as other types of ovarian tumors, and in certain special cases, it may be confused with other types of ovarian cancer or benign lesions. Therefore, developing more objective and accurate diagnostic methods is of great significance for improving the diagnostic rate and treatment outcomes of OCCC.

[0004] With the rapid development of molecular biology techniques, DNA methylation, as a core mechanism of epigenetic modification, has become a hot topic in tumor research. In particular, in recent years, specific biomarkers discovered through methylation sequencing technology have provided a completely new perspective and method for the diagnosis of OCCC. These molecular-level markers can not only more accurately distinguish OCCC from other ovarian cancer subtypes, but may also provide important evidence for early diagnosis, prognostic assessment, and personalized treatment. DNA methylation is a common epigenetic modification that plays an important role in gene expression regulation. In tumor cells, DNA methylation patterns are often disordered, manifested as hypermethylation in gene promoter regions and hypomethylation throughout the genome. These abnormal methylation patterns not only affect the expression of tumor suppressor genes, but may also be closely related to tumor occurrence, development, metastasis, and response to treatment. In OCCC research, researchers have found that the methylation status of promoter regions of multiple genes is related to the occurrence and development of OCCC. For example, methylation of the RASSF2 gene is significantly associated with the occurrence of OCCC. Furthermore, SLFN11 gene expression was associated with sensitivity to platinum-based chemotherapy, and this association was independent of BRCA1 / 2 mutation status. These findings suggest that DNA methylation not only has potential in the diagnosis of OCCC, but may also play an important role in prognostic assessment and treatment decisions. Summary of the Invention

[0005] This invention covers the following technical solutions: One aspect of the present invention relates to the use of a reagent for detecting methylation markers in the preparation of a kit for the diagnosis of clear cell ovarian carcinoma in an individual; said reagent is used to detect the methylation level of at least one of the following methylation markers selected from said individual in a sample isolated from said individual: MIR148A, CRLF1 and FER1L4.

[0006] Another aspect of the present invention relates to a diagnostic kit for ovarian clear cell carcinoma, comprising at least one or more of three primer-probe systems: A, B, and C. Where A is selected from a′) and / or b′); B is selected from c′) and / or d′); C is selected from e′) and / or f′); a′) The upstream primer shown in SEQ ID NO: 1, the downstream primer shown in SEQ ID NO: 2, and the probe shown in SEQ ID NO: 3 for a). b′) For b), the upstream primer shown in SEQ ID NO:4, the downstream primer shown in SEQ ID NO:5, and the probe shown in SEQ ID NO:6; c′) For c) the upstream primer shown in SEQ ID NO: 7, the downstream primer shown in SEQ ID NO: 8, and the probe shown in SEQ ID NO: 9; d′) The upstream primer shown in SEQ ID NO: 10, the downstream primer shown in SEQ ID NO: 11, and the probe shown in SEQ ID NO: 12 for d). e′) The upstream primer shown in SEQ ID NO: 13, the downstream primer shown in SEQ ID NO: 14, and the probe shown in SEQ ID NO: 15 for e). f′) refers to the upstream primer shown in SEQ ID NO: 16, the downstream primer shown in SEQ ID NO: 17, and the probe shown in SEQ ID NO: 18 for f).

[0007] Another aspect of the invention relates to a diagnostic device comprising one or more separate modules, at least one of which contains the components of the kit described above.

[0008] This invention enables specific diagnosis of this type of ovarian cancer at the molecular level by detecting the methylation levels of methylation markers MIR148A, CRLF1, and FER1L4 in samples related to clear cell ovarian cancer. Compared with traditional histopathological diagnosis or routine tumor marker detection (such as CA125, HE4, etc.), the detection system provided by this invention can achieve highly sensitive, highly specific, and low-invasive diagnosis in tissue or body fluid samples, effectively improving the accuracy of early detection and subtyping diagnosis. Attached Figure Description

[0009] To more clearly illustrate the specific embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the specific embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of the present invention. For those skilled in the art, other drawings can be obtained from these drawings without creative effort.

[0010] Figure 1 Spearman clustering heatmap of 1041 markers; green: benign samples, orange: clear cell carcinoma samples, red: high plasma carcinoma samples.

[0011] Figure 2 Spearman clustering heatmap of 61 markers; green: benign samples, orange: clear cell carcinoma samples, red: high plasma carcinoma samples.

[0012] Figure 3Figure 1 shows the results of methylation level detection of the methylation markers of the present invention in ovarian clear cell carcinoma and control samples.

[0013] Figure 4 : Receiver operating characteristic (ROC) curve based on the combined detection of methylation of the three genes MIR148A, CRLF1, and FER1L4. Detailed Implementation

[0014] Reference will now be made to detailed embodiments of the present invention, one or more of which are described below. Each example is provided for explanation and not for limitation of the invention. In fact, it will be apparent to those skilled in the art that various modifications and variations can be made to the invention without departing from its scope or spirit. For example, features described or illustrated as part of one embodiment may be used in another embodiment to produce further embodiments.

[0015] In this invention, unless otherwise stated, the scientific and technical terms used herein have the meanings commonly understood by those skilled in the art. Furthermore, the nucleic acid chemistry, molecular biology, and immunology-related terms and laboratory procedures used herein are all widely used terms and routine procedures in their respective fields. To better understand this invention, definitions and explanations of relevant terms are provided below.

[0016] As used herein, the terms “and / or,” “or / and,” and “and / or” encompass any one of two or more of the relevant listed items, as well as any and all combinations of the relevant listed items, including any two of the relevant listed items, any more of the relevant listed items, or a combination of all the relevant listed items.

[0017] The terms “containing,” “comprising,” and “including” as used in this invention are synonyms and are inclusive or open-ended, not excluding additional, uncited members, elements, or method steps.

[0018] In this invention, the numerical range represented by endpoints includes all numerical values ​​and fractions contained within that range, as well as the endpoints mentioned.

[0019] As used in this invention, the term "about" or "approximately" means within 20%, preferably within 10%, and more preferably within 5%, of a given value or range. It also includes specific numbers, such as about 20 including 20.

[0020] This invention relates to concentration values, which include fluctuations within a certain range. For example, fluctuations are allowed within a corresponding precision range. For instance, 2% can fluctuate within ±0.1%. For larger values ​​or values ​​that do not require overly precise control, even greater fluctuations are permitted. For example, 100mM can fluctuate within ranges of ±1%, ±2%, ±5%, etc. Regarding molecular weight, fluctuations of ±10% are allowed.

[0021] As used in this invention, unless otherwise stated, the singular forms of the articles “a,” “an,” and “the” include plural referents.

[0022] In this invention, the terms "multiple" or "various" are used unless otherwise specified, referring to a quantity of 2 or more.

[0023] In this invention, the technical features described in an open-ended manner include both closed-ended technical solutions composed of the listed features and open-ended technical solutions that include the listed features.

[0024] In this invention, terms such as "preferred," "better," "more suitable," and "ideal" merely describe implementation methods or embodiments with better effects and should be understood not to limit the scope of protection of this invention. In this invention, terms such as "optionally," "optionally," and "optional" mean that something is optional, that is, selected from either "with" or "without" a parallel solution. If multiple "optional" statements appear in a technical solution, unless otherwise specified and without contradiction or mutual constraint, each "optional" statement is independent.

[0025] All references to this invention are incorporated herein by reference as if each document were individually incorporated herein by reference. Unless they conflict with the inventive purpose and / or technical solution of this invention, the referenced documents are incorporated herein by reference in their entirety and for all purposes. When references are made in this invention, the definitions of relevant technical features, terms, nouns, phrases, etc., are also incorporated herein by reference. Examples and preferred embodiments of the referenced technical features may also be incorporated herein by reference, but only to the extent that they enable the implementation of this invention. It should be understood that when the cited content conflicts with the description in this invention, this invention shall prevail or modifications shall be made adaptively according to the description in this invention.

[0026] In this invention, the term "diagnosis" refers to the process of determining or predicting whether a subject has a certain disease (especially clear cell ovarian carcinoma), including its status, risk, subtype, or development trend, based on the detection results of one or more biological indicators in the sample, including but not limited to methylation sites. Diagnosis can be qualitative (e.g., presence / absence of disease), quantitative (e.g., risk score), or subtyping (e.g., different subtypes), including initial screening, retesting, (prognostic) risk assessment, and disease monitoring.

[0027] The term "methylation marker" as used herein is broadly interpreted to include both 1) the original marker found in a biological sample or genomic DNA (in a specific methylation state) and 2) its processed sequences (e.g., bisulfite-converted or MSRE-treated regions). Bisulfite-converted regions differ from target markers in the genomic sequence in that one or more unmethylated cytosine residues are converted to uracil, thymine, or other bases that differ from cytosine in hybridization behavior. MSRE-treated regions differ from target markers in the genomic sequence in that the sequence is cleaved at one or more MSRE cleavage sites.

[0028] In this invention, "methylation state" refers to the presence, absence, and / or amount of one or more methylated nucleotide bases in a nucleic acid molecule. For example, a nucleic acid molecule containing methylated cytosine is considered methylated, and its methylation state is methylated. A nucleic acid molecule containing no methylated cytosine is considered unmethylated, and its methylation state is unmethylated. In some embodiments, a nucleic acid may be characterized as "unmethylated" if it is not methylated at a specific locus (e.g., a locus containing a specific single CpG dinucleotide) or a specific combination of loci, even if it is methylated at other loci of the same gene or molecule.

[0029] In this invention, genes used as methylation markers are expected to include naturally occurring variants of the gene, its complementary sequence, all its promoters and regulatory elements (e.g., nucleic acid sequences within 5 kb upstream (e.g., 4 kb, 3 kb, 2 kb, or 1 kb) of the gene annotation start site and within 5 kb downstream of its gene annotation termination site), and fragments of the gene or the variant, particularly molecularly detectable fragments. In this invention, the terms "molecularly detectable fragment," "target region," and "target gene region" are used interchangeably. The molecularly detectable fragment preferably comprises at least 16, 17, 18, 19, 20, 22, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, or more consecutive nucleotides of the marker. In some embodiments, the continuous nucleotides comprise at least one, two, three, four, five, six, seven, eight, nine, ten, twelve, fifteen, or more CpG dinucleotide sequences. In some embodiments, the target gene region is preferably rich in CpG dinucleotides.

[0030] The term "methylation level" as used herein refers to the relationship between the methylation status of any number and any position of CpGs in the sequence in question. This relationship can be the result of addition or subtraction of methylation status parameters (e.g., 0 or 1) or calculations using mathematical algorithms (e.g., mean, percentage, number, proportion, degree, or calculations using mathematical models), including but not limited to methylation level measures, methylation haplotype ratios, methylation haplotype loadings, or, in the case of machine learning models such as logistic regression, the AUC of an ROC curve.

[0031] The term "oligonucleotide" refers to a polymeric form of nucleotides of any length, which may be ribonucleotides or deoxyribonucleotides. This term includes double-stranded and single-stranded DNA and RNA, and modified and unmodified forms such as methylated or capped polynucleotides. The terms "polynucleotide" and "oligonucleotide" are used interchangeably herein. Oligonucleotides may, but are not required to, include other coding or non-coding sequences, or they may, but are not necessarily, linked to other molecules and / or vectors or supporting materials. Oligonucleotides used in the methods or kits of this invention may have any length suitable for the specific method. In some applications, the term refers to antisense nucleic acid molecules (e.g., mRNA or DNA strands in the opposite direction to the sense polynucleotide encoding the markers of this invention).

[0032] As used herein, "primer" generally refers to a linear oligonucleotide that is complementary to and annealed to the target sequence. The lower limit of primer length depends on hybridization ability, as very short primers (e.g., less than 5 nucleotides) do not form thermodynamically stable double strands under most hybridization conditions. Primer length typically varies between 8 and 50 nucleotides. In some embodiments, primers are between approximately 15 and 25 nucleotides. Naturally occurring nucleotides (especially guanine, adenine, cytosine, and thymine, hereinafter referred to as "G", "A", "C", and "T") and nucleotide analogs can be used as primers in this invention.

[0033] The term "bisulfite reagent" refers to a bisulfite used to distinguish between methylated and unmethylated CpG dinucleotide sequences.

[0034] The term "methylation-sensitive restriction enzyme" should be understood as an enzyme that selectively digests nucleic acids based on the methylation state of its recognition site. For restriction enzymes that specifically cleave when the recognition site is unmethylated or hemimethylated, cleavage does not occur or occurs with significantly reduced efficiency when the recognition site is methylated. Preferably, the following methylation-sensitive restriction enzymes have a recognition sequence containing a CG dinucleotide (e.g., cgcg or cccggg). In some embodiments, it is further preferred to be a restriction enzyme that does not cleave when the cytosine in the dinucleotide is methylated at the C5 carbon atom.

[0035] The terms “subject,” “patient,” and “individual” are used interchangeably herein and refer to mammals. This term includes, but is not limited to, livestock, rodents (e.g., rats and mice), primates, and humans. Preferably, the term refers to humans.

[0036] The term "methylation assay" refers to any assay that determines the methylation status of one or more dinucleotide (e.g., CpG) sequences within a DNA sequence.

[0037] The term "sample" means material that is known or suspected to express or contain the markers described herein. Samples may be derived from biological sources ("biological samples"), such as tissues (e.g., biopsy samples), extracts, or cell cultures including cells (e.g., tumor cells), cell lysates, and biological or physiological fluids, such as whole blood, plasma, serum, saliva, cerebrospinal fluid, sweat, urine, breast milk, peritoneal fluid, etc. Samples obtained from sources or samples that have been pretreated to improve sample characteristics (e.g., plasma preparation from blood) may be used directly. In some aspects of the invention, the sample is a human physiological fluid, such as human plasma. In some aspects of the invention, the sample is a biopsy sample, such as tumor tissue or cells obtained through histological examination.

[0038] In this invention, MIR148A refers to MicroRNA 148a, which belongs to the miR-148 / 152 family and is located in the 7p15.2 region of human chromosome.

[0039] In this invention, CRLF1 (Cytokine Receptor-Like Factor 1) is a cytokine receptor-like factor 1 located on human chromosome 19p13.11, encoding a cytokine receptor-like protein.

[0040] In this invention, FER1L4 (Fer-1-Like Family Member 4, Pseudogene) is Fer-1 family member 4 (pseudogene), located on human chromosome 20q11.22, and is a long non-coding RNA.

[0041] The first aspect of the present invention relates to the use of a reagent for detecting methylation markers in the preparation of a kit for the diagnosis of clear cell ovarian carcinoma in an individual; said reagent is used to detect the methylation level of at least one of the following methylation markers selected from said individual in a sample isolated from said individual: MIR148A, CRLF1 and FER1L4.

[0042] In this invention, the methylation level of the methylation marker can be analyzed by any known methylation detection method, and this invention is not limited thereto. Methylation detection methods suitable for this invention include, but are not limited to: bisulfite conversion combined with sequencing (e.g., BS-seq, RRBS), methylation-specific PCR (MSP), high-resolution melting analysis (HRM), methylation microarray hybridization, methylation-specific probe hybridization, methylation-sensitive restriction endonuclease (MSRE) method, enrichment method (e.g., MeDIP), and mass spectrometry (e.g., MALDI-TOF MS). Any of the above methods can be used to determine the status of the target methylation marker and the reference methylation marker described in this invention. The "reagents for detecting methylation markers" may include, but are not limited to: oligonucleotide primers, probes, capture probes, methylation-sensitive restriction nucleases, bisulfite conversion reagents, etc., for detecting the methylation status of the promoter region or exon region of the marker gene.

[0043] By employing the methylation marker detection reagent of this invention, epigenetic abnormalities in ovarian clear cell carcinoma samples can be detected with high specificity and sensitivity. Specifically, MIR148A, CRLF1, and FER1L4 all exhibit significant abnormal methylation states in ovarian clear cell carcinoma tissue, while maintaining low methylation or unmethylation levels in other ovarian cancer subtypes or normal ovarian tissue. Therefore, the detection reagent based on these markers can effectively distinguish between clear cell and non-clear cell ovarian carcinoma, achieving subtyping diagnosis and improving diagnostic accuracy and clinical applicability.

[0044] In a further aspect of the invention, the methylation marker may be one, two, or any combination of three of MIR148A, CRLF1, and FER1L4. Specifically, it may be selected from the following combinations: 1) MIR148A and CRLF1; 2) MIR148A and FER1L4; 3) CRLF1 and FER1L4; 4) MIR148A, CRLF1 and FER1L4.

[0045] Studies have shown that the methylation status of different biomarkers exhibits heterogeneity in different samples of ovarian clear cell carcinoma. Therefore, multi-gene combined detection can significantly improve the sensitivity and reliability of diagnosis. This invention achieves stratified diagnostic results for ovarian clear cell carcinoma by detecting three methylation biomarkers—MIR148A, CRLF1, and FER1L4—in different combinations. In some examples, the AUC value of the combined detection of the three biomarkers exceeded 0.95, with sensitivity and specificity both exceeding 90%, achieving optimal comprehensive diagnostic performance. This covers the major molecular subtypes of ovarian clear cell carcinoma and achieves highly accurate and repeatable clinical detection results.

[0046] In one embodiment of the invention, the reagent is used to detect the methylation level of at least one target region of the at least one methylation marker, the target region being selected from target regions a)-f), or complementary sequences or processed sequences of target regions a)-f); or processed sequences of the complementary sequences; or any combination of the foregoing sequences and / or regions; The target regions corresponding to MIR148A are a) chr7:25858619-25858718 and / or b) chr7:25858694-25858808; the target regions corresponding to CRLF1 are c) chr19:18595096-18595203 and / or d) chr19:18595221-18595339; and the target regions corresponding to FER1L4 are e) chr20:35600780-35600918 and / or f) chr20:35602191-35602319.

[0047] The above regions are described based on human genome version hg38.

[0048] The complementary sequences mentioned in this invention include DNA sequences capable of hybridizing with DNA having a corresponding sequence (such as a target region) under stringent conditions. The “stringent conditions” used in this invention are well-known and include, for example, hybridization at 60°C for 12–16 hours in a hybridization solution containing 400 mM NaCl, 40 mM PIPES (pH 6.4), and 1 mM EDTA, followed by washing at 65°C for 15–60 minutes with a washing buffer containing 0.1% SDS and 0.1% SSC. The “complementarity” can be integral to the sequence or localized within a subsequence region.

[0049] The "processed sequence" refers to the sequence form obtained after necessary chemical or enzymatic treatment of genomic DNA before methylation detection. This includes, but is not limited to, sequences that deamination of unmethylated cytosine (C) and conversion to uracil (U) after bisulfite conversion, or derived sequences generated through steps such as methylation-sensitive restriction enzyme digestion, modification, cleavage, and enrichment. Since the above treatments alter the base composition or sequence structure, detection primers or probes can be designed specifically for this "processed sequence" to achieve differential identification of methylated and unmethylated sites.

[0050] In a further embodiment of the present invention, the reagent for detecting methylation markers includes a substance that hybridizes or amplifies a specific nucleotide sequence region of the marker. The substance may be an oligonucleotide primer, oligonucleotide probe, capture probe, oligonucleotide array probe, or other nucleic acid molecules capable of specifically binding to a target sequence, used to identify or amplify specific sites within the methylation region of the methylation marker gene. In a preferred embodiment, the substance that hybridizes or amplifies at least one target region of the methylation marker is, for example, an oligonucleotide primer and probe. The primer or probe may be designed based on the bisulfite transformation sequence of the target gene, methylation-sensitive enzyme digestion products, or other processed sequences, thereby achieving specific recognition of methylated and unmethylated sequences.

[0051] In some specific implementations, the oligonucleotide primer and probe combinations corresponding to the target regions a)-f) are shown as a′)-f′): a′) The upstream primer shown in SEQ ID NO: 1, the downstream primer shown in SEQ ID NO: 2, and the probe shown in SEQ ID NO: 3 for a). b′) For b), the upstream primer shown in SEQ ID NO:4, the downstream primer shown in SEQ ID NO:5, and the probe shown in SEQ ID NO:6; c′) For c) the upstream primer shown in SEQ ID NO: 7, the downstream primer shown in SEQ ID NO: 8, and the probe shown in SEQ ID NO: 9; d′) The upstream primer shown in SEQ ID NO: 10, the downstream primer shown in SEQ ID NO: 11, and the probe shown in SEQ ID NO: 12 for d). e′) The upstream primer shown in SEQ ID NO: 13, the downstream primer shown in SEQ ID NO: 14, and the probe shown in SEQ ID NO: 15 for e). f′) refers to the upstream primer shown in SEQ ID NO: 16, the downstream primer shown in SEQ ID NO: 17, and the probe shown in SEQ ID NO: 18 for f).

[0052] The primers and probes of this invention may be modified, and the modification may be performed using known methods. Modified versions of these primer and / or probe sequences may include, by non-limiting examples, adding one or more nucleotides to the 5' end, adding one or more nucleotides to the 3' end, adding one or more nucleotides to both the 5' and 3' ends, adding a tail, shortening the sequence, lengthening the sequence, shifting the sequence upstream or downstream by several bases, or any combination thereof.

[0053] Base modifications, such as 3'P, 5'P, 5-nitroindole, 2-aminopurine, 8-amino-2'-deoxyadenosine, C-5-propynyl-deoxycytidine, C-5-propynyl-deoxyuridine, 2-amino-2'-deoxyadenosine-5'-triphosphate, 2,6-diaminopurine (2-amino-dA), reversed-dT, reversed-dideoxy-T, hydroxymethyl-dC, iso-dC, 5-methyl-dC, aminoethyl-phenoxazine-deoxycytidine, and locked nucleic acids (LNAs), including at least one mismatched base at one of the bases, or replacing at least one of the bases with an RNA base, can achieve, for example, increased nucleic acid interaction at the 3' end of mutant-specific primers to increase Tm. The addition of stable double-stranded base modifications has a positive effect on PCR, enabling it to be performed at higher temperatures, within which Taq polymerase is known to exhibit maximum activity. Modified probes should retain the ability to distinguish between the mutant and wild-type sites to be detected.

[0054] In some embodiments, the probe is labeled with a detectable signal substance. In some embodiments, the signal substance is a fluorophore, colorimetric label, colloidal gold, quantum dot, biotin, and other tag molecules that can be used for detection (such as alkyne groups for Raman diffraction imaging, cycloalkenes for click reactions, and initiating groups for polymer labeling), or it may be selected from peptide / protein molecules, LNA / PNA, non-natural amino acids and their analogs (e.g., peptides), non-natural nucleic acids and their analogs (nucleotides), and nanostructures (including inorganic nanoparticles, NV-centers, aggregation / assembly-induced luminescent molecules, rare earth ion ligand molecules, polyoxometalates, etc.).

[0055] In another embodiment of the invention, the reagent for detecting methylation markers is applicable to the detection of DNA from a variety of clinical samples, enabling molecular diagnosis of clear cell ovarian carcinoma under different sampling methods. Preferred samples are selected from paraffin-embedded tissue, fresh or frozen tumor tissue samples, plasma, ascites, biopsy cells, cervical or vaginal exfoliated cells, urine, pleural effusion, peripheral blood leukocyte DNA, exosome DNA, and any combination thereof. Paraffin-embedded tissue, fresh or frozen tumor tissue samples, and plasma are most preferred.

[0056] According to a second aspect of the present invention, there is a diagnostic kit for ovarian clear cell carcinoma, which comprises at least one or more of three primer and probe systems: A, B, and C. Where A is selected from a′) and / or b′); B is selected from c′) and / or d′); C is selected from e′) and / or f′); a′) The upstream primer shown in SEQ ID NO: 1, the downstream primer shown in SEQ ID NO: 2, and the probe shown in SEQ ID NO: 3 for a). b′) For b), the upstream primer shown in SEQ ID NO:4, the downstream primer shown in SEQ ID NO:5, and the probe shown in SEQ ID NO:6; c′) For c) the upstream primer shown in SEQ ID NO: 7, the downstream primer shown in SEQ ID NO: 8, and the probe shown in SEQ ID NO: 9; d′) The upstream primer shown in SEQ ID NO: 10, the downstream primer shown in SEQ ID NO: 11, and the probe shown in SEQ ID NO: 12 for d). e′) The upstream primer shown in SEQ ID NO: 13, the downstream primer shown in SEQ ID NO: 14, and the probe shown in SEQ ID NO: 15 for e). f′) refers to the upstream primer shown in SEQ ID NO: 16, the downstream primer shown in SEQ ID NO: 17, and the probe shown in SEQ ID NO: 18 for f).

[0057] In this disclosure, the term "kit" may refer to any article (e.g., packaging or container) that includes at least one device and comprises the detection reagents as described in this disclosure. The kit may further include instructions for use, supplementary reagents, and / or components or parts used in the methods or steps described in this disclosure.

[0058] Components within reagents or kits can be packaged in the form of solutions, solids, or test strips. In some preferred embodiments, at least one component of the reagent or kit is a solid, including at least one of lyophilized microspheres, lyophilized cakes, lyophilized powders, and spots dependent on a solid medium. Therefore, components required for nucleic acid amplification (and preferably nucleic acid detection), particularly various enzymes, nucleic acid components, and reaction buffer components, can be provided in lyophilized form. In this way, the nucleic acid amplification (and preferably nucleic acid detection) process can be directly initiated in a very user-friendly manner by adding the sample to be quantified and optionally other required components.

[0059] Wherein, A is selected from a′) and / or b′), corresponding to the detection system for the MIR148A gene; B is selected from c′) and / or d′), corresponding to the detection system for the CRLF1 gene; and C is selected from e′) and / or f′), corresponding to the detection system for the FER1L4 gene. Furthermore, for specific clinical needs, the kit may also contain only any two primer-probe systems, such as A and B, A and C, or B and C. Of course, it may also contain all of A, B, and C simultaneously.

[0060] In a further embodiment of the present invention, the ovarian clear cell carcinoma diagnostic kit, in addition to primers and probes for detecting specific methylation regions of the MIR148A, CRLF1, and FER1L4 genes, may further include a bisulfite reagent and / or a methylation-sensitive restriction enzyme reagent. The bisulfite reagent is used to perform bisulfite conversion on the sample DNA, deaminated unmethylated cytosine (C) and converted it to uracil (U), thereby distinguishing methylated and unmethylated bases at the sequence level and enabling subsequent methylation-specific amplification detection. The methylation-sensitive restriction enzyme reagent can indirectly reflect the methylation status of the target gene by recognizing and cleaving unmethylated CpG dinucleotide sequences at specific sites. These two types of reagents can be used alone or in combination to adapt to different detection systems (such as MSP, MSRE-PCR, or sequencing methods), thereby improving specificity and consistency while ensuring detection sensitivity, enabling the kit to cover a variety of methylation detection methods from chemical transformation to enzymatic recognition.

[0061] In another embodiment of the invention, the kit further comprises one or more of the following components: DNA extraction reagents, PCR amplification reaction system, negative control, positive control, and internal control detection system.

[0062] The DNA extraction reagent is used to extract genomic DNA from different types of samples, providing a pure template for subsequent methylation detection. The reagent exemplarily includes components such as sample lysis buffer, proteinase K, binding buffer, washing buffer, and elution buffer, and can be extracted using silica membrane adsorption or magnetic bead extraction methods, capable of removing impurities such as proteins, RNA, and inhibitors while maintaining DNA integrity.

[0063] The PCR amplification reaction system is used to amplify the methylated region of the target gene or its processed sequence to achieve specific detection of methylation status. This system may include Taq DNA polymerase, a mixture of dNTPs, Mg²⁺ solution, reaction buffer, and fluorescent probes or dyes (such as SYBR Green or TaqMan probes).

[0064] The negative control is used to verify the specificity of the detection system and is usually an unmethylated control DNA sample, which can be derived from peripheral blood of healthy individuals or artificially synthesized unmethylated standard DNA. The positive control is used to verify the sensitivity and amplification efficiency of the detection system and is usually a fully methylated DNA sample obtained by treatment with a methyltransferase (such as M.SssI).

[0065] The internal reference detection system is used to monitor the extraction quality of sample DNA and the bisulfite conversion efficiency. Preferably, a gene that is not sensitive to methylation status and has virtually no CpG sites in its sequence is selected as the internal reference. In some preferred embodiments, the internal reference detection system includes an internal reference primer and a probe for detecting the COL2A1 gene, more preferably: the upstream primer shown in SEQ ID NO: 19, the downstream primer shown in SEQ ID NO: 20, and the probe shown in SEQ ID NO: 21.

[0066] This system contains specific primers and probes for amplifying the target region of COL2A1, which can be performed simultaneously with the target gene detection reaction. If the internal control is not amplified or the Ct value is abnormally elevated, it indicates that the sample has not been degraded, the transformation is incomplete, or the reaction system is abnormal, thus ensuring the reliability and reproducibility of the detection results.

[0067] Useful sequences also include functional equivalents of any one of SEQ ID NO: 1-SEQ ID NO: 21 above. A functional equivalent is a sequence that has at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with the corresponding sequence and retains the relevant function (such as function as a primer, probe, or nucleic acid marker). Functional equivalents also include modified nucleic acids. The percentage of sequence identity can be obtained using well-known bioinformatics algorithms, including the Myers and Miller algorithm (Bioinformatics, 4(1): 11-17, 1988), the Needleman-Wunsch global alignment method (J.Mol.Biol., 48(3): 443-53, 1970), the Smith-Waterman local alignment method (J.Mol.Biol., 147: 195-197, 1981), the Pearson and Lipman similarity search method (PNAS, 85(8): 2444-2448, 1988), and the Karlin and Altschul algorithm (Altschul et al., J.Mol.Biol., 215(3): 403-410, 1990; PNAS, 90: 5873-5877, 1993). This is familiar to those skilled in the art.

[0068] According to a third aspect of the invention, a diagnostic device is provided, comprising one or more separate modules, at least one of which contains components of the kit described in the second aspect.

[0069] The diagnostic device can be modularly designed according to the application scenario. The overall structure includes, but is not limited to, a sample processing module, a nucleic acid extraction module, a methylation processing module, an amplification detection module, and a result interpretation module. Each module can operate independently or be integrated into the same detection platform to achieve a fully automated or semi-automated detection process from sample input to result output. In a preferred embodiment, the diagnostic device can be a fluorescence quantitative PCR instrument equipped with a temperature control and optical detection system, an integrated nucleic acid detection workstation, a portable chip detection device, or a closed detection system based on a microfluidic chip. This device, through pre-installed or replaceable reagent kit modules, achieves automated detection of the methylation status of MIR148A, CRLF1, and FER1L4, significantly reducing manual operation steps and improving detection sensitivity, consistency, and clinical application convenience, thereby providing an efficient and standardized detection platform for rapid subtyping diagnosis of ovarian clear cell carcinoma. The use of these diagnostic devices is generally common practice among those skilled in the art and can be modified from commercial diagnostic platforms, such as, but not limited to, the Bio-Rad QX200, Thermo Fisher QuantStudio Absolute Q, and QIAGEN QIAcuity devices.

[0070] According to a fourth aspect of the present invention, there is a method for diagnosing clear cell carcinoma of the ovary, the method comprising: (1) Provide a sample from the individual being tested and extract DNA from the sample; (2) The DNA is processed to distinguish between methylated and unmethylated cytosine; (3) The DNA is amplified or hybridized using specific primers and probes targeting at least one region of a methylation marker, wherein the methylation marker is selected from at least one of MIR148A, CRLF1 and FER1L4; (4) Analyze the methylation level of the target region. When the methylation level of any of the markers is detected to be higher than a preset threshold, determine the possibility that the individual from which the sample originated has clear cell ovarian carcinoma.

[0071] The target region, the sample, the primers and probes (primer-probe combination) may be defined by the first aspect or the second aspect of the present invention.

[0072] The embodiments of the present invention will be described in detail below with reference to examples. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. For experimental methods in the following embodiments where specific conditions are not specified, please refer to the guidelines given in this invention, or follow experimental manuals or conventional conditions in the art, or other experimental methods known in the art, or follow the conditions recommended by the manufacturer.

[0073] In the specific embodiments described below, the measurement parameters involving raw material components may have slight deviations within the weighing accuracy range unless otherwise specified. Temperature and time parameters are subject to acceptable deviations due to instrument testing accuracy or operational precision.

[0074] Example 1: Screening of methylation biomarkers for ovarian clear cell carcinoma A total of 98 ovarian tissue samples were collected from the Chinese population, including benign tumor tissue, high-grade serous carcinoma tissue, and clear cell carcinoma tissue. All tissue samples underwent independent histological evaluation by at least two senior pathologists and were definitively diagnosed after multidisciplinary consultation. The collected clinical samples were subjected to high-throughput capture sequencing using probes specifically targeting and covering 27,000 CpG islands. The methylation levels of cancerous and benign tissue samples were compared, with the following criteria: a. a Wilcoxon P-value less than 0.05; b. a mean methylation level less than 0.1 in benign samples; c. a mean methylation level greater than 0.2 in cancerous tissue. Preliminary screening yielded 1041 cancerous tissue methylation markers, which can clearly distinguish cancerous tissue samples from benign samples. Specific details are shown in [link to relevant documentation]. Figure 1 .

[0075] Cluster analysis revealed specific markers for both clear cell carcinoma and hypersporinous carcinoma. Further analysis was conducted to screen for methylation markers specific to clear cell carcinoma and hypersporinous carcinoma, respectively. The screening criteria were as follows: 1. Clear cell carcinoma-specific methylation markers: a. Wilcoxon test p-value < 0.05 for methylation levels between clear cell carcinoma and hypersporinous carcinoma samples; b. Difference in methylation levels between the two groups of cancer tissue samples > 0.2; c. Methylation level of hypersporinous carcinoma < 0.1. 2. Hypersporinous carcinoma-specific methylation markers: a. Wilcoxon test p-value < 0.05 for methylation levels between hypersporinous carcinoma and clear cell carcinoma samples; b. Difference in methylation levels between the two groups of cancer tissue samples > 0.2; c. Methylation level of clear cell carcinoma < 0.1. A total of 52 biomarkers specific to clear cell carcinoma and 9 biomarkers specific to hyperplasmic carcinoma were obtained. These methylation biomarkers can clearly distinguish hyperplasmic carcinoma, clear cell carcinoma, and benign samples. See below for details. Figure 2 .

[0076] Further ROC analysis was performed on the clear cell carcinoma-specific biomarkers obtained from the above screening. Based on AUC size and gene function, three methylation biomarkers, MIR148A, CRLF1, and FER1L4, were selected as representatives for subsequent analysis.

[0077] Example 2: Detection assay of methylation of nested clear cell carcinoma-related genes MIR148A, CRLF1 and FER1L4 using a kit.

[0078] The specific nucleotide sequences of the primers and probes used are shown in the table below: Table 1 Primers, probes and sequences

[0079] The internal reference gene is COL2A1, and the target region is chr12: 47987446-47987534. Forward primer: GGGAAGATGGGATAGAAGGGAATAT (SEQ ID NO: 19).

[0080] Reverse primer: AACAATTATAAACTCCAACCAC (SEQ ID NO: 20) Probe: TTCATTCTAACCCAATACCT (SEQ ID NO: 21) Sixty-six ovarian tumor samples with known and clear pathological information were selected: 27 were identified as high-grade serous carcinoma, 13 as clear cell carcinoma, and 26 as benign ovarian tumors.

[0081] DNA extraction from ovarian tumor tissue Tumor tissue DNA extraction was performed using the QIAamp DNA FFPE Tissue Kit, and the procedure is as follows: (1) Use a scalpel to cut off the excess paraffin on the sample block.

[0082] (2) Cut a maximum of 8 paraffin slices with a thickness of 5-10μm.

[0083] (3) Immediately place the slice into a 1.5 mL microcentrifuge tube and add 1 mL of xylene to the sample. Cover and vortex for 10 s.

[0084] (4) Centrifuge at full speed for 2 minutes at room temperature.

[0085] (5) Discard the supernatant.

[0086] (6) Add 1 mL of anhydrous ethanol (96-100%) to the precipitate and vortex to mix.

[0087] (7) Centrifuge at full speed for 2 minutes at room temperature.

[0088] (8) Discard the supernatant. Carefully remove any residual ethanol with a fine pipette tip.

[0089] (9) Open the centrifuge tube and incubate at room temperature for 10 minutes or until all residual ethanol has evaporated.

[0090] (10) Resuspend the precipitate in 180 μl Buffer ATL. Add 20 μL proteinase K and vortex to mix.

[0091] (11) Incubate at 56°C for 1 hour (or until the sample is completely lysed).

[0092] (12) Incubate at 90°C for 1 hour.

[0093] (13) Briefly centrifuge the 1.5mL centrifuge tube to remove the droplets inside the cap.

[0094] (14) Add 200 μl of BufferAL to the sample and vortex to mix thoroughly. Then add 200 μl of anhydrous ethanol (96%-100%) and vortex to mix thoroughly again.

[0095] (15) Briefly centrifuge the 1.5mL centrifuge tube to remove the droplets inside the cap.

[0096] (16) Carefully transfer the entire lysis buffer to the QIAamp MinElute adsorption column. Cap the column and centrifuge at 6000g for 1 min. Transfer the QIAamp MinElute adsorption column to a clean 2 mL collection tube.

[0097] (17) Carefully open the QIAamp MinElute adsorption column and add 500 μl of Buffer AW1. Cover the column and centrifuge at 6000 g for 1 min. Transfer the QIAamp MinElute adsorption column to a clean 2 mL collection tube.

[0098] (18) Carefully open the QIAamp MinElute adsorption column and add 500 μl of Buffer AW2. Cover the column and centrifuge at 6000 g for 1 min. Transfer the QIAamp MinElute adsorption column to a clean 2 mL collection tube.

[0099] (19) Centrifuge at full speed for 3 minutes to dry the sample.

[0100] (20) Place the QIAamp MinElute adsorption column into a clean 1.5 mL centrifuge tube. Carefully open the cap of the QIAamp MinElute adsorption column and add 30 μl of RNase-free water or Buffer ATE to the center of the membrane.

[0101] (21) Cover and incubate at room temperature for 1 min. Centrifuge at full speed for 1 min.

[0102] (22) Take 1 μL of purified DNA and quantify it using the Qubit dsDNA HS Assay Kit.

[0103] DNA bisulfite conversion DNA bisulfite conversion was performed using the EZ DNA Methylation-Gold Kit, and the procedure is as follows: (1) Add 20 μL of DNA sample to a PCR tube, followed by 130 μL of CT Conversion Reagent, and vortex to mix.

[0104] (2) Place the mixed sample into the PCR instrument and react at 98℃ for 10 min; 64℃ for 2.5 h; and keep at 4℃.

[0105] (3) Place the adsorption column into the collection tube and add 600 μL of Binding Buffer to the adsorption column.

[0106] (4) Add the sample to the adsorption column containing Binding Buffer and mix by inverting the column.

[0107] (5) Centrifuge at 10000g for 30s and discard the liquid in the collection tube.

[0108] (6) Add 100 μL M-Wash Buffer to the adsorption column, centrifuge at full speed for 30 seconds, and discard the liquid in the collection tube.

[0109] (7) Add 200 μL of M-Desulphonation Buffer to the adsorption column, incubate at room temperature for 15-20 min, centrifuge at full speed for 30 s after incubation, and discard the liquid in the collection tube.

[0110] (8) Add 200 μL of M-Wash Buffer to the adsorption column and discard the liquid in the collection tube.

[0111] (9) Repeat the previous step.

[0112] (10) Place the adsorption column in a 1.5 mL centrifuge tube and add 40 μL of M-Elution Buffer. Centrifuge at full speed for 30 s and recover the transformed DNA sample from the centrifuge tube.

[0113] Detection of transformed DNA by real-time quantitative PCR (1) The PCR reaction system is prepared as shown in Table 2: Table 2: PCR reaction system

[0114] (2) The PCR reaction conditions were as follows: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 15 s, 60℃ annealing extension for 35 s, 50 cycles; 25℃ hold for 10 min. Fluorescence signal was collected at 60℃.

[0115] (3) Result Interpretation Results are valid if the internal standard channel exhibits an S-shaped amplification curve and a Ct value ≤ 28. The Ct value of each methylated gene was recorded separately for performance evaluation. A Ct value below 30 was defined as positive.

[0116] Test results as follows Figure 3 and Figure 4 As shown. Comparing clinicopathological results, in 66 ovarian tumor samples: MIR148A (chr7:25858619-25858718) showed a positivity rate of 100% (13 / 13) in clear cell carcinoma and a specificity of 92.6% (25 / 27) in high-grade serous carcinoma, with an ROC area of ​​0.972. Figure 3 The specificity in benign samples was 88.5% (23 / 26), and the ROC area was 0.959 ( ). Figure 4 ); The positive rate of MIR148A (chr7:25858694-25858808) in clear cell carcinoma was 100% (13 / 13), and the specificity in high-grade serous carcinoma was 92.6% (25 / 27), with an ROC area of ​​0.974. Figure 3 The specificity in benign samples was 88.5% (23 / 26), and the ROC area was 0.962 ( ). Figure 4 ); The positive rate of CRLF1 (chr19:18595096-18595203) in clear cell carcinoma was 100% (13 / 13), and the specificity in high-grade serous carcinoma was 88.9% (24 / 27), with an ROC area of ​​0.983. Figure 3 The specificity in benign samples was 100% (26 / 26), and the ROC area was 1 ( ). Figure 4 ); The positivity rate of CRLF1 (chr19:18595221-18595339) in clear cell carcinoma was 100% (13 / 13), and the specificity in high-grade serous carcinoma was 88.9% (24 / 27), with an ROC area of ​​0.986 ( ). Figure 3 The specificity in benign samples was 100% (26 / 26), and the ROC area was 1 ( ). Figure 4 ); The positive rate of FER1L4 (chr20:35600780-35600918) in clear cell carcinoma was 100% (13 / 13), and the specificity in high-grade serous carcinoma was 92.6% (25 / 27), with an ROC area of ​​0.980 ( ). Figure 3 The specificity in benign samples was 100% (26 / 26), and the ROC area was 1 ( ). Figure 4 ); The positive rate of FER1L4 (chr20:35602191-35602319) in clear cell carcinoma was 100% (13 / 13), and the specificity in high-grade serous carcinoma was 92.6% (25 / 27), with an ROC area of ​​0.977. Figure 3 The specificity in benign samples was 100% (26 / 26), and the ROC area was 1 ( ). Figure 4 ); Based on the optimal methylation regions of MIR148A, CRLF1, and FER1L4, joint detection can be performed, involving two genes or all three genes simultaneously. The results are shown in the table below: Table 3: Performance of combined detection of two genes

[0117] Table 4: Performance of combined detection of three genes

[0118] From the table above, we can see that if any two of the three genes are positive at the same time, the positive rate is 100% (13 / 13) in clear cell carcinoma, the specificity is 96.3% (26 / 27) in high-grade serous carcinoma, and the specificity is 100% (26 / 26) in benign tumors.

[0119] Therefore, through the analysis of Example 2, it can be concluded that the combined detection of any two genes of MIR148A, CRLF1, and FER1L4 has the highest specificity for high-grade serous carcinoma and benign ovarian tumors, and has a good detection rate, indicating that DNA methylation can be used for the detection of clear cell carcinoma.

[0120] The embodiments described above are merely illustrative of several implementations of the present invention, and while the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the invention patent. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these all fall within the protection scope of the present invention. Therefore, the protection scope of this invention patent should be determined by the appended claims, and the specification and drawings can be used to interpret the content of the claims.

Claims

1. Use of reagents for detecting methylation markers in the preparation of a kit for the diagnosis of clear cell ovarian carcinoma in an individual; said reagents are used to detect the methylation level of a target region of a methylation marker in an ovarian tissue sample isolated from said individual; said target region is described based on human genome version hg38; The methylation marker was selected from FER1L4; The target region is selected from target regions e)-f), or complementary sequences or processed sequences of target regions e)-f); or processed sequences of the complementary sequences; or any combination of the aforementioned sequences and / or regions; in, The treatment involves bisulfite conversion or methylation-sensitive restriction enzyme treatment; the target region corresponding to FER1L4 is e)chr20:35600780-35600918 and / or f)chr20:35602191-35602319.

2. The use according to claim 1, wherein the methylation marker is selected from the following combinations: 1) MIR148A and FER1L4; 2) CRLF1 and FER1L4; 3) MIR148A, CRLF1, and FER1L4; The target region is selected from target regions a)-f), or complementary sequences or processed sequences of target regions a)-f); or processed sequences of the complementary sequences; or any combination of the aforementioned sequences and / or regions; in, The treatment involves bisulfite conversion or methylation-sensitive restriction enzyme treatment; the target regions corresponding to MIR148A are a) chr7:25858619-25858718 and / or b) chr7:25858694-25858808; the target regions corresponding to CRLF1 are c) chr19:18595096-18595203 and / or d) chr19:18595221-18595339; the target regions corresponding to FER1L4 are e) chr20:35600780-35600918 and / or f) chr20:35602191-35602319.

3. The reagent according to claim 1 or 2, wherein the reagent comprises: Substances that hybridize with or amplify the target region of the methylation marker.

4. The use according to claim 3, wherein the substance is an oligonucleotide primer and probe.

5. According to the use described in claim 4, the oligonucleotide primer and probe combinations corresponding to the target regions e)-f) are as shown in e′)-f′): e′) The upstream primer shown in SEQ ID NO: 13, the downstream primer shown in SEQ ID NO: 14, and the probe shown in SEQ ID NO: 15 for e). f′) refers to the upstream primer shown in SEQ ID NO: 16, the downstream primer shown in SEQ ID NO: 17, and the probe shown in SEQ ID NO: 18 for f).

6. The use according to claim 2, wherein the reagent comprises: Substances that hybridize with or amplify the target region of the methylation marker, wherein the substance is an oligonucleotide primer and probe; The oligonucleotide primer and probe combinations corresponding to the target regions a)-f) are shown as a′)-f′): a′) The upstream primer shown in SEQ ID NO: 1, the downstream primer shown in SEQ ID NO: 2, and the probe shown in SEQ ID NO: 3 for a). b′) For b), the upstream primer shown in SEQ ID NO: 4, the downstream primer shown in SEQ ID NO: 5, and the probe shown in SEQ ID NO: 6; c′) For c) the upstream primer shown in SEQ ID NO: 7, the downstream primer shown in SEQ ID NO: 8, and the probe shown in SEQ ID NO: 9; d′) The upstream primer shown in SEQ ID NO: 10, the downstream primer shown in SEQ ID NO: 11, and the probe shown in SEQ ID NO: 12 for d). e′) The upstream primer shown in SEQ ID NO: 13, the downstream primer shown in SEQ ID NO: 14, and the probe shown in SEQ ID NO: 15 for e). f′) refers to the upstream primer shown in SEQ ID NO: 16, the downstream primer shown in SEQ ID NO: 17, and the probe shown in SEQ ID NO: 18 for f).

7. The use according to any one of claims 4 to 6, wherein the reagent further comprises a bisulfite reagent and / or a methylation-sensitive restriction enzyme reagent.

8. The kit according to any one of claims 4 to 6, further comprising one or more of the following components: DNA extraction reagents, PCR amplification reaction system, negative control, positive control, and internal control detection system.

9. The use according to claim 8, wherein the internal reference detection system comprises internal reference primers and probes for detecting the COL2A1 gene, which are: The upstream primer shown in SEQ ID NO: 19, the downstream primer shown in SEQ ID NO: 20, and the probe shown in SEQ ID NO: 21.

Images