Real-time fluorescent quantitative PCR (Polymerase Chain Reaction) kit for quantitatively detecting content of mRNA (Messenger Ribonucleic Acid) of human antibody in organism as well as detection method and application

Abstract

The invention provides a real-time fluorescent quantitative PCR (Polymerase Chain Reaction) kit for quantitatively detecting the mRNA (Messenger Ribonucleic Acid) content of a human antibody in an organism, a detection method and application, and belongs to the technical field of drug detection. The invention provides a real-time fluorescent quantitative PCR (Polymerase Chain Reaction) kit for quantitatively detecting the mRNA (Messenger Ribonucleic Acid) content of a human antibody in a body, which is characterized in that reverse transcription and a qPCR process are combined by adopting a one-step method, a standard curve is constructed by using an RNA standard substance, and mRNA sequences for coding a heavy chain and a light chain of the human antibody are detected at the same time; according to the method, a series of concentration standard substance solutions subjected to gradient dilution react with a sample to be detected in parallel, behaviors of the sample in the detection process are simulated, the content of human antibody mRNA is visually displayed, and rapid and accurate quantitative detection of cells and gene therapy product drugs in biological samples is achieved. The method has the advantages of simplicity in operation, high sensitivity, strong specificity, wide detection range and the like.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of drug detection, and particularly relates to a real-time fluorescent quantitative PCR kit for quantitatively detecting the content of human antibody mRNA in a body, a detection method and application. BACKGROUND

[0002] Antibodies are a kind of immunoglobulin capable of specifically binding with antigens, and antibody drugs have good clinical effects in the prevention and treatment of numerous infectious diseases. However, the development and widespread use of antibody drugs are seriously restricted by the difficulties in antibody protein purification, harsh storage conditions and unstable neutralization effect. In view of this problem, researchers have developed antibody drugs based on DNA and RNA to avoid the difficulties in protein purification and modification in the production of recombinant antibodies, and the application prospect is wide. However, for human antibody drugs designed based on mRNA as a carrier, how to detect the pharmacokinetic characteristics is an important issue, and there is no commercial kit for quantitatively detecting the distribution of human antibody mRNA in an animal body. SUMMARY

[0003] The application provides a real-time fluorescent quantitative PCR kit for quantitatively detecting the content of human antibody mRNA in a body, a detection method and application, and can rapidly and accurately detect human antibody mRNA in an animal body.

[0004] The application provides a real-time fluorescent quantitative PCR kit for quantitatively detecting the content of human antibody mRNA in a body, which comprises heavy chain RNA standard products, light chain RNA standard products, sample RNA extraction reagents, one-step real-time fluorescent quantitative PCR reagents, a specific primer probe group designed for the heavy chain RNA standard products and a specific primer probe group designed for the light chain RNA standard products.

[0005] In a specific embodiment of the application, when the nucleotide sequence of the RNA heavy chain standard product is SEQ ID No. 7, the nucleotide sequence of the specific primer probe group designed for the heavy chain RNA standard product is shown in SEQ ID No. 1-SEQ ID No. 3; When the nucleotide sequence of the RNA light chain standard product is SEQ ID No. 8, the nucleotide sequence of the specific primer probe group designed for the light chain RNA standard product is shown in SEQ ID No. 4-SEQ ID No. 6.

[0006] In a specific embodiment of the application, the kit further comprises a diluent of the RNA standard product.

[0007] In a specific embodiment of the application, the heavy chain RNA standard product is diluted to 300-3x10 10at a gradient concentration of 1.0 copies / μL.

[0008] In one specific embodiment of the present application, the light chain RNA standard is diluted to a gradient concentration of 200-2x10 10 at a gradient concentration of 1.0 copies / μL.

[0009] The present application also provides a method for detecting the content of human antibody mRNA in a body by using the above real-time fluorescent quantitative PCR kit, comprising the following steps: diluting the RNA standard into linear working solutions at a gradient concentration for detecting heavy chains and into linear working solutions at a gradient concentration for detecting light chains, respectively; performing fluorescent quantitative PCR reaction by using the linear working solutions as templates, specific primer probes and one-step real-time fluorescent quantitative PCR reagent to configure a fluorescent quantitative PCR reaction system, and constructing a standard curve between the Cp value and the logarithm of the concentration of the RNA standard; extracting RNA from a sample to be detected by using a sample RNA extraction reagent, performing fluorescent quantitative PCR reaction by using the RNA as a template, specific primer probes and one-step real-time fluorescent quantitative PCR reagent to configure a fluorescent quantitative PCR reaction system, and determining the concentration of human antibody mRNA in the body according to the standard curve.

[0010] In one specific embodiment of the present application, the fluorescent quantitative PCR reaction system is 20 μL, including: 1 μL OneStep U+Enzyme Mix, 4 μL 5x One Step U+Mix, 0.4 μL 10 μM upstream primer, 0.4 μL 10 μM downstream primer, 0.2 μL 10 μM probe, 3 μL linear working solution or 4 μL sample RNA to be detected and the balance of RNase-Free Water.

[0011] In one specific embodiment of the present application, the program of the fluorescent quantitative PCR reaction includes: 55℃ reverse transcription for 15 min; 95℃ pre-denaturation for 30 sec; 95℃ denaturation for 10 sec, 60℃ annealing and extension for 30 sec, 45 cycles.

[0012] In one specific embodiment of the present application, the sample to be detected includes at least one of the following: spleen, kidney, brain, testis, small intestine, bone marrow, inguinal lymph node, local muscle for injection and whole blood.

[0013] The present application also provides an application of the above real-time fluorescent quantitative PCR kit in preparing a tool for preclinical biological distribution research of human antibody mRNA drugs.

[0014] Beneficial effects: the present application provides a real-time fluorescent quantitative PCR kit for quantitatively detecting human antibody mRNA content in a body, the kit adopts one-step method, combines reverse transcription with qPCR process, constructs a standard curve with RNA standard, simultaneously detects mRNA sequences coding human antibody heavy chain and light chain, and realizes rapid and accurate quantitative detection of cells and gene therapy product drugs in biological samples by parallelly reacting gradient-diluted series concentration standard solution with the sample to be detected, intuitively displaying human antibody mRNA content, simulating sample behavior in the detection process, and realizing rapid and accurate quantitative detection of cells and gene therapy product drugs in biological samples. The detection method has the advantages of simple operation, high sensitivity, strong specificity, wide detection range and the like, and can be used for preclinical biological distribution research, clinical research biological sample detection and clinical treatment drug distribution monitoring of human antibody mRNA drugs. BRIEF DESCRIPTION OF DRAWINGS

[0015] Figure 1 A standard curve graph of the heavy chain concentration-Cp value for quantitatively detecting human antibody mRNA drugs in cynomolgus monkeys by PCR; Figure 2 A standard curve graph of the light chain concentration-Cp value for quantitatively detecting human antibody mRNA drugs in cynomolgus monkeys by PCR. DETAILED DESCRIPTION

[0016] The present application provides a real-time fluorescent quantitative PCR kit for quantitatively detecting human antibody mRNA content in a body, including heavy chain RNA standard, light chain RNA standard, sample RNA extraction reagent, one-step real-time fluorescent quantitative PCR reagent, specific primer probe group designed for the heavy chain RNA standard, and specific primer probe group designed for the light chain RNA standard.

[0017] The human antibody mRNA in the present application is an antibody drug with mRNA as a carrier, and the sequence of the human antibody mRNA is not particularly limited. Based on the content of the present application, any sequence of human antibody mRNA can be rapidly and accurately detected.

[0018] In an embodiment of the present application, the nucleotide sequence of the heavy chain RNA standard is shown as SEQ ID No. 7, and the nucleotide sequence of the specific primer probe group designed for the heavy chain of the heavy chain RNA standard is shown as SEQ ID No. 1-SEQ ID No. 3.

[0019] In an embodiment of the present application, the nucleotide sequence of the light chain RNA standard is shown as SEQ ID No. 8, and the nucleotide sequence of the specific primer probe group designed for the light chain RNA standard is shown as SEQ ID No. 4-SEQ ID No. 6.

[0020] A-F (SEQ ID No. 1): CATATCGAGAACAACTACAAGAC; A-R (SEQ ID No. 2): CTGACCCCGGCTCTTATCC; A-P (SEQ ID No. 3): CCATCCCTGGACAGCGATGGCTCC; B-F (SEQ ID No. 4): GGCATAGTGGAAGGTGGAT; B-R (SEQ ID No. 5): GTTCACGGCCTTGCTCAGG; B-P (SEQ ID No. 6): CGTAATGCAGAGCGGCAACAGC.

[0021] The kit also includes a diluent of the RNA standard, which is EASY Dilution. Using the diluent, the heavy chain RNA standard is diluted to a gradient concentration of 300~3×10 10 copies / μL, such as 3×10 2 copies / μL, 3×10 3 copies / μL, 3×10 4 copies / μL, 3×10 5 copies / μL, 3×10 6 copies / μL, 3×10 7 copies / μL, 3×10 8 copies / μL, 3×10 9 copies / μL, 3×10 10 copies / μL; and the light chain RNA standard is diluted to a gradient concentration of 200~2×10 10 copies / μL, such as 2×10 2 copies / μL, 2×10 3 copies / μL, 2×10 4 copies / μL, 2×10 5 copies / μL, 2×10 6 copies / μL, 2×10 7 copies / μL, 2×10 8 copies / μL, 2×10 9 copies / μL, 2×10 10copies / μL. In the present application, the specific primers and probes of the RNA standard are dissolved in RNase-Free Water to a concentration of 100 μM stock solution, and then diluted by 10 times before use when the real-time fluorescent quantitative PCR system is prepared. The source of the EASY Dilution is not particularly limited in the present application, and in one embodiment, it is purchased from Takara.

[0022] The sample RNA extraction reagent contained in the kit of the present application includes a magnetic bead method tissue cell total RNA extraction reagent kit (in one embodiment, purchased from Guangzhou Avanti Biotech Co., Ltd.), and an EZ-press Whole Blood RNA Purification Kit (in one embodiment, purchased from EZ Bioscience).

[0023] The one-step real-time fluorescent quantitative PCR reagent of the present application contains One Step U+Enzyme Mix and 5×One Step U+Mix. The system of the real-time fluorescent quantitative PCR of the present application is 20 μL, including: 1 μL One Step U+Enzyme Mix, 4 μL 5×One Step U+Mix, 0.4 μL upstream primer, 0.4 μL downstream primer, 0.2 μL probe, 4 μL sample to be tested / 3 μL RNA standard, and the balance of RNase-Free Water. The One Step U+Enzyme Mix and 5×One Step U+Mix in the system of the present application are derived from Vazyme-AccurSTART II U+One Step RT-qPCR Probe Kit (for Fast ) in one embodiment, which is purchased from Vazyme.

[0024] The present application also provides a method for detecting the content of human antibody mRNA in the body by using the above-mentioned real-time fluorescent quantitative PCR kit, which comprises the following steps: diluting the RNA standard into linear working solutions of gradient concentrations for detecting heavy chains and linear working solutions of gradient concentrations for detecting light chains, respectively; configuring a fluorescent quantitative PCR reaction system by using the linear working solutions as templates, specific primer probe groups, and one-step real-time fluorescent quantitative PCR reagents to perform fluorescent quantitative PCR reaction, and constructing a standard curve between the Cp value and the logarithm of the RNA standard concentration. Extracting RNA from the sample to be tested by using a sample RNA extraction reagent, configuring a fluorescent quantitative PCR reaction system by using the RNA as a template, specific primer probe groups, and one-step real-time fluorescent quantitative PCR reagents to perform fluorescent quantitative PCR reaction, and determining the concentration of human antibody mRNA in the body according to the standard curve.

[0025] The RNA standard is diluted by EASY Dilution to obtain a series of linear working solutions with gradient concentrations. The real-time fluorescent quantitative PCR is performed by using the real-time fluorescent quantitative PCR reagent in the kit as the template of the series of linear working solutions. The standard curve is established by using the data of the series of RNA standards. The content of NK cells in the body is quantitatively detected by using the standard curve.

[0026] The RNA standard is diluted by EASY Dilution to obtain a series of linear working solutions with gradient concentrations. After obtaining the series of linear working solutions, the real-time fluorescent quantitative PCR reaction is performed by using the real-time fluorescent quantitative PCR reagent in the kit as the template of the series of linear working solutions. The program of the fluorescent quantitative PCR reaction comprises: 55℃ reverse transcription for 15 min; 95℃ pre-denaturation for 30 sec; 95℃ denaturation for 10 sec, 60℃ annealing and extension for 30 sec, 45 cycles.

[0027] After the quantitative PCR is completed, the standard curve is established by taking the Cp value as the ordinate and the logarithm of the concentration as the abscissa. The correlation coefficient (R 2 ) is required to be not less than 0.98, and the overall amplification efficiency of PCR is between 80% and 120%. The overall amplification efficiency of PCR = 10 -1 / k -1, and k is the slope.

[0028] After obtaining the standard curve, the real-time fluorescent quantitative PCR is performed by using the RNA extracted from the body sample as the template. The content of human antibody mRNA in the body is quantitatively detected by using the standard curve.

[0029] The system and program of the real-time fluorescent quantitative PCR are preferably the same as the above. The animal sample preferably comprises spleen, kidney, brain, testis, small intestine, bone marrow, inguinal lymph node, local muscle injected or whole blood.

[0030] The application further provides the application of the real-time fluorescent quantitative PCR kit in the preparation of a tool for preclinical biological distribution research of human antibody mRNA drugs.

[0031] The fluorescent quantitative method used in the preclinical biological distribution research of human antibody mRNA drugs is the same as the foregoing, which is not described herein again.

[0032] In order to further illustrate the application, the real-time fluorescent quantitative PCR kit for quantitatively detecting the content of human antibody mRNA in the body, the detection method and the application are described in detail in combination with the embodiments, but they cannot be understood as the limitation on the protection scope of the application.

[0033] Example 1 The required reagents of the present application include RNA standard (SEQ ID No. 7), qPCR upstream and downstream primer probe (SEQ ID No. 1-SEQ ID No. 6), magnetic bead method tissue cell total RNA extraction kit, EZ-press Whole Blood RNA Purification Kit, AccurSTART II U+ One Step RT-qPCR Probe Kit (for Fast), anhydrous ethanol, EASY Dilution, Nuclease-Free Water.

[0034] The detection instrument of the present application is a real-time fluorescent quantitative PCR instrument, model number is Light Cycler 480.

[0035] Preparation of main reagents: the primer and probe are respectively dissolved in RNase-Free Water to a concentration of 100 μM stock solution, and then diluted by 10 times for use.

[0036] Preparation of linear working solution and quality control working solution: an appropriate amount of RNA standard is taken out by a pipette, and a series of concentrations of 3×10 2 , 3×10 3 , 3×10 4 , 3×10 5 , 3×10 6 , 3×10 7 , 3×10 8 , 3×10 9 , 3×10 10 copies / μL and 2×10 2 , 2×10 3 , 2×10 4 , 2×10 5 , 2×10 6 , 2×10 7 , 2×10 8 , 2×10 9 , 2×10 10 copies / μL of linear working solution are prepared by EASY Dilution. An appropriate amount of RNA standard is taken out by a pipette, and five concentrations of quality control working solution are prepared by EASY Dilution: LLOQ (heavy chain 3×10 2 copies / μL, light chain 2×10 2 copies / μL), QCL (heavy chain 2×10 3 copies / μL, light chain 1×10 3 copies / μL), QCM (heavy chain 2×106 copies / μL, light chain 1 x 10 6 copies / μL), QCH (heavy chain 2 x 10 9 copies / μL, light chain 1 x 10 9 copies / μL), ULOQ (heavy chain 3 x 10 10 copies / μL, light chain 2 x 10 10 copies / μL).

[0037] The qPCR reaction system was established: the reaction system was 20 μL, including 1 μL One Step U+Enzyme Mix, 4 μL 5x One Step U+Mix, 0.4 μL upstream primer, 0.4 μL downstream primer, 0.2 μL probe, 4 μL sample RNA to be detected was added when detecting unknown sample, and RNase-Free Water was added to 20 μL.

[0038] Method validation: Standard curve: an appropriate amount of RNA standard was removed by a pipette to prepare a series of concentrations of 3 x 10 2 , 3 x 10 3 , 3 x 10 4 , 3 x 10 5 , 3 x 10 6 , 3 x 10 7 , 3 x 10 8 , 3 x 10 9 , 3 x 10 10 copies / μL (heavy chain) and 2 x 10 2 , 2 x 10 3 , 2 x 10 4 , 2 x 10 5 , 2 x 10 6 , 2 x 10 7 , 2 x 10 8 , 2 x 10 9 , 2 x 10 10 copies / μL, with Cp value as vertical coordinate and logarithm of concentration as horizontal coordinate, to establish a standard curve, with correlation coefficient (R 2 ) not less than 0.98, PCR overall amplification efficiency between 80% and 120%, and PCR overall amplification efficiency = 10 -1 / k -1, k being the slope.

[0039] Precision and Accuracy: Using a pipette, transfer appropriate amounts of RNA standards to prepare LLOQ, QCL, QCM, QCH, and ULOQ quality control working solutions using EASY Dilution. Run the quality control samples in 6 analytical batches, with 5 concentration levels per batch (LLOQ, QCL, QCM, QCH, and ULOQ), and 5 quality control samples for each concentration level. All 6 analytical batches should be completed by at least two people over several days. The coefficient of variation (CV%) within and between batches for QCH, QCM, and QCL should not exceed 30%, and the CV% for ULOQ and LLOQ should not exceed 45%. Calculate the accuracy for each sample (average of measured values ​​ / theoretical value × 100%). An accuracy of 50%–200% is acceptable.

[0040] Specificity: Blank liver samples from six batches of cynomolgus monkeys and blank bone marrow, spleen, and whole blood samples from one batch of cynomolgus monkeys were obtained without standards. Additionally, blank liver samples from six batches of cynomolgus monkeys and blank bone marrow, spleen, and whole blood samples from one batch of cynomolgus monkeys were obtained at two concentration levels of two standards, QCH and QCL (final concentration of heavy chain standard 9.0 × 10⁻⁶). 9 copies / reaction, 9.0×10 3 Copies / reaction, final concentration of light chain standard 6.0 × 10⁻⁶ 9 copies / reaction, 6.0×10 3 A total of 27 specific samples were used (copies / reaction). The specificity of this method for standards was examined. Specific samples containing standards were required to have a Cp value less than the limit of quantification (LLOQ) Cp value, with a recovery rate of 50%–200%. Specific samples without standards had a Cp value greater than the LLOQ Cp value of the standard curve or no Cp value.

[0041] Stability: RNA was extracted from blank cynomolgus monkey whole blood and liver and diluted to 100 ng / μL. The RNA from these samples was then mixed with low and high concentration standards (QCL and QCH), respectively. The resulting RNA was used as the stability sample. Blank cynomolgus monkey liver RNA (final concentration 400 ng / reaction) was mixed with heavy chain standards (final concentration 9.0 × 10⁻⁶). 3 Copies / reaction) / Light chain standard (final concentration 6.0 × 10⁻⁶) 3 Mixed with copies / reaction; cynomolgus monkey blank liver RNA (final concentration 400 ng / reaction) and heavy chain standard (final concentration 9.0 × 10⁻⁶). 9 Copies / reaction) / Light chain standard (final concentration 6.0 × 10⁻⁶) 9copies / reaction) mixed; cynomolgus monkey blank whole blood RNA (final concentration 400 ng / reaction) mixed with heavy chain standard (final concentration 9.0 x 10 3 copies / reaction) / light chain standard (final concentration 6.0 x 10 3 copies / reaction) mixed; cynomolgus monkey blank whole blood RNA (final concentration 400 ng / reaction) mixed with heavy chain mRNA standard (final concentration 9.0 x 10 9 copies / reaction) / light chain mRNA standard (final concentration 6.0 x 10 9 copies / reaction) mixed. Two concentration levels of samples were measured at the time of preparation (C0), 4 h at 2-8 °C, 2 weeks at-60 °C below, after-60 °C below- room temperature freeze-thaw 5 cycles, each sample was prepared in triplicate. The recovery rate of each sample was calculated (the average of the measured value / theoretical value x 100%), and the recovery rate was 50%-200% stable.

[0042] As shown in Table 1 and Figure 1 the heavy chain mRNA standard curve PCR overall amplification efficiency was between 99.28% and 109.50%, the standard curve correlation coefficient (R 2 ) of each detection batch was between 0.9982 and 0.9997, all greater than 0.98, meeting the acceptance criteria.

[0043] As shown in Table 2 and Figure 2 the light chain mRNA standard curve PCR overall amplification efficiency was between 98.32% and 109.83%, the standard curve correlation coefficient (R 2 ) of each detection batch was between 0.9958 and 0.9993, all greater than 0.98, meeting the acceptance criteria.

[0044] Table 1 Standard curve verification results (heavy chain)

[0045] Table 2 Standard curve verification results (light chain)

[0046] The precision and accuracy results are shown in Table 3, Table 4. The quality control samples were run in 6 analytical batches, 5 concentration levels (ULOQ, QCH, QCM, QCL and LLOQ) per batch. In the 6 analytical batches, the intra-batch CV% of heavy chain mRNA QCH, QCM, QCL was 4.62%~17.20%, the inter-batch CV% was 22.18%~29.95%, the intra-batch and inter-batch CV% were not greater than 30%; the intra-batch CV% of ULOQ and LLOQ CV% was 6.56%~42.87%, the inter-batch CV% was 17.18%~27.26%, the intra-batch and inter-batch CV% were not greater than 45%, the precision verification was qualified. The accuracy of each sample was 59.16%~197.12%, between 50%~200%, the accuracy verification was qualified; the intra-batch CV% of light chain mRNA QCH, QCM, QCL was 6.72%~21.11%, the inter-batch CV% was 15.13%~28.44%, the intra-batch and inter-batch CV% were not greater than 30%; the intra-batch CV% of ULOQ and LLOQ CV% was 4.10%~37.79%, the inter-batch CV% was 12.55%~29.37%, the intra-batch and inter-batch CV% were not greater than 45%, the precision verification was qualified. The accuracy of each sample was 53.53%~195.75%, between 50%~200%, the accuracy verification was qualified.

[0047] Table 3 Precision and accuracy verification results (heavy chain)

[0048] Table 4 Precision and accuracy verification results (light chain)

[0049] Note: / indicates that the Cp value deviates too much and does not participate in statistics.

[0050] The specificity results are shown in Table 5, Table 6. The 6 batches of cynomolgus monkey individual blank liver and 1 batch of cynomolgus monkey individual blank bone marrow, spleen, whole blood were respectively without standard, and the 6 batches of cynomolgus monkey individual blank liver and 1 batch of cynomolgus monkey individual blank bone marrow, spleen, whole blood were respectively with QCH, QCL two concentration levels (the final concentration of heavy chain mRNA was 9.0×10 9 copies / reaction, 9.0×10 3 copies / reaction, the final concentration of light chain mRNA was 6.0×10 9 copies / reaction, 6.0×10 3The standard sample was detected by 27 specific samples. The statistical results showed that the Cp value of the specific sample containing the standard sample was less than the Cp value of the lower limit of quantitative detection. The recovery rate of QCH and QCL concentration samples of heavy chain mRNA (adding blank liver RNA of cynomolgus monkey, blank bone marrow RNA, and blank spleen RNA) was 74.26%-189.47%. The recovery rate of QCH and QCL concentration samples of light chain mRNA (adding blank liver RNA of cynomolgus monkey, blank bone marrow RNA, and blank spleen RNA) was 71.40%-154.35%. The recovery rate of QCH and QCL concentration samples of heavy chain mRNA (adding blank whole blood RNA of cynomolgus monkey) was 101.61%-184.06%. The recovery rate of QCH and QCL concentration samples of light chain mRNA (adding blank whole blood RNA of cynomolgus monkey) was 71.87%-92.04%. The recovery rate of the specific sample containing the standard sample was between 50% and 200%. The specific sample without the standard sample had no Cp value. The specificity met the acceptance criteria.

[0051] Table 5. Specificity verification results (heavy chain)

[0052] Table 6. Specificity verification results (light chain)

[0053] The stability results are shown in Tables 7 and 8. The samples at two concentration levels (QCH and QCL) were measured immediately after preparation (C0), after being placed at 2-8°C for 4 hours, after being placed at-60°C or below for 2 weeks, and after being frozen and thawed at-60°C or below for 5 cycles. Each sample was prepared in triplicate. The recovery rate of each sample was calculated (average of measured value / theoretical value x 100%). The statistical results showed that the recovery rate of the stability sample of heavy chain mRNA (adding blank liver RNA of cynomolgus monkey) was 115.22%-157.48%, the recovery rate of the stability sample of light chain mRNA (adding blank liver RNA of cynomolgus monkey) was 75.92%-101.90%, the recovery rate of the stability sample of heavy chain mRNA (adding blank whole blood RNA of cynomolgus monkey) was 120.11%-168.78%, and the recovery rate of the stability sample of light chain mRNA (adding blank whole blood RNA of cynomolgus monkey) was 75.87%-138.67%, which was between 50% and 200%, meeting the acceptance criteria.

[0054] Table 7. Stability verification results (heavy chain)

[0055] Table 8 Stability verification results (light chain)

[0056] The method verification results show that the method standard curve, precision and accuracy, specificity, stability meet the acceptance criteria. After verification, the content of human antibody mRNA in tissues such as spleen, kidney, brain, testis, small intestine, bone marrow, inguinal lymph node, local muscle injected or whole blood can be successfully detected by the method, and the highest content of NK cells detected in whole blood is 2145.67 copies / 100 ng RNA.

[0057] Although the above embodiment has made a detailed description of the present application, it is only a part of the embodiments of the present application, not all the embodiments, and other embodiments can be obtained according to the present embodiment without creativity, which belong to the protection scope of the present application.

Claims

1. A real-time fluorescent quantitative PCR kit for quantitatively detecting the amount of human antibody mRNA in a body, characterized by comprising: a primer set for amplifying a human antibody mRNA; and a probe for detecting the amplified product. The kit comprises heavy chain RNA standard, light chain RNA standard, sample RNA extraction reagent, one-step real-time fluorescent quantitative PCR reagent, specific primer probe set designed for the heavy chain RNA standard, and specific primer probe set designed for the light chain RNA standard.

2. The real-time fluorescent quantitative PCR kit according to claim 1, characterized by, When the nucleotide sequence of the RNA heavy chain standard is as shown in SEQ ID No. 7, the nucleotide sequence of the specific primer probe set designed for the heavy chain RNA standard is as shown in SEQ ID No. 1-SEQ ID No.

3. When the nucleotide sequence of the RNA light chain standard is as shown in SEQ ID No. 8, the nucleotide sequence of the specific primer probe set designed for the light chain RNA standard is as shown in SEQ ID No. 4-SEQ ID No.

6.

3. The real-time fluorescent quantitative PCR kit according to claim 1, characterized by, The kit further comprises diluents of the RNA standards.

4. The real-time fluorescent quantitative PCR kit according to claim 3, characterized by, The heavy chain RNA standard was diluted to a gradient concentration of 300 to 3 x 10 10 copies / μL.

5. The real-time fluorescent quantitative PCR kit according to claim 3, characterized by, The light chain RNA standard was diluted to a gradient concentration of 200 to 2 x 10 10 copies / μL.

6. The method for detecting the content of human antibody mRNA in the body by using the real-time fluorescent quantitative PCR kit according to any one of claims 1 to 5, characterized in that, The kit comprises the following steps: The RNA standards are diluted into linear working solutions of gradient concentrations for detecting heavy chains and linear working solutions of gradient concentrations for detecting light chains, respectively; the linear working solutions are used as templates to configure fluorescent quantitative PCR reaction systems with the specific primer probe set and one-step real-time fluorescent quantitative PCR reagent to perform fluorescent quantitative PCR reaction, thereby constructing a standard curve between the Cp value and the logarithm of the RNA standard concentration; The sample RNA extraction reagent is used to extract RNA from the sample to be tested, and the RNA is used as a template to configure a fluorescent quantitative PCR reaction system with the specific primer probe set and one-step real-time fluorescent quantitative PCR reagent to perform fluorescent quantitative PCR reaction, and the concentration of human antibody mRNA in the body is determined according to the standard curve.

7. The method of claim 6, wherein, The fluorescent quantitative PCR reaction system comprises, in 20 μL: 1 μL One Step U+Enzyme Mix, 4 μL 5×One Step U+Mix, 0.4 μL 10 μM upstream primer, 0.4 μL 10 μM downstream primer, 0.2 μL 10 μM probe, 3 μL linear working solution or 4 μL sample RNA to be tested, and the balance of RNase-Free Water.

8. The method of claim 6 or 7, wherein, The program of the fluorescent quantitative PCR reaction comprises: 55℃ reverse transcription for 15 min; 95℃ pre-denaturation for 30 sec; 95℃ denaturation for 10 sec, 60℃ annealing and extension for 30 sec, 45 cycles.

9. The method of claim 6, wherein, The sample to be tested comprises at least one of the following: spleen, kidney, brain, testis, small intestine, bone marrow, inguinal lymph node, local muscle for injection, and whole blood.

10. Use of the real-time fluorescent quantitative PCR kit according to any one of claims 1-5 in the preparation of a tool for preclinical biological distribution research of human antibody mRNA drugs.

Images