KASP primer group for detecting gibberellic disease resistance gene and application of KASP primer group

Abstract

The invention discloses a KASP primer group for detecting a gibberellic disease resistance gene and application of the KASP primer group, and belongs to the technical field of wheat molecular breeding. According to the present invention, the Fhb7Th1 gene and the Fhb7Thp gene from the decaploid elytrigia elongata and the diploid elytrigia elongata are analyzed, and the result shows that the Fhb7Th1 gene and the Fhb7Thp gene have an A / C polymorphic site at the 383 nucleotide, and can be adopted as the gibberellic disease resistance site; based on the gibberellic disease-resistant site, the invention designs the KASP primer group for detecting the gibberellic disease-resistant gene, and the rapid and accurate detection of the resistance genes Fhb7Th1 gene and Fhb7Thp gene can be realized, so that the pyramiding breeding of the wheat gibberellic disease-resistant gene can be realized, and the KASP primer group has important significance for improving the resistance of wheat to gibberellic disease.

Description

Technical Field

[0001] This invention relates to the field of wheat molecular breeding technology, specifically to a KASP primer set for detecting Fusarium head blight resistance genes and its application. Background Technology

[0002] Fusarium head blight (also known as wheat head rot, wheat head decay, or red wheat head) is a major catastrophic disease of wheat distributed globally. It can occur from the seedling stage to the heading stage of wheat development. Infected wheat exhibits symptoms such as seedling rot, stem rot, stalk rot, and ear rot. This disease is extremely damaging, typically reducing yield by 10%-20% in epidemic years and by 20%-50% in pandemic years, leading to total crop failure in extreme cases. The annual affected area reaches 40-50 million mu (approximately 2.6-3.3 million hectares). Infected wheat grains become shriveled and dry, with reduced thousand-grain weight and flour yield, significantly lowering their commercial value. More seriously, fungal toxins produced by the pathogen, such as vomitoxin and zearalenone, contaminate the wheat grains, rendering them unsuitable for food and feed, and posing a serious threat to human and animal health.

[0003] Chemical agents and agricultural control are common traditional control measures for wheat scab, which have effectively mitigated the negative impact of scab on wheat yield and quality to some extent. However, due to factors such as the development of pathogen resistance, changes in environmental conditions, and differences in cultivation management, traditional control measures still have certain limitations. Scab-resistant breeding, on the other hand, has shown unique advantages. By utilizing disease-resistant gene resources to improve the wheat's own resistance, green control of wheat scab can be achieved.

[0004] Disease resistance gene aggregation involves combining superior disease resistance genes from different wheat materials into a single material. Aggregating different disease resistance genes can effectively improve the disease resistance of wheat varieties and reduce the risk of loss of crop resistance traits due to mutations or degeneration of single genes. However, currently, there are not many wheat varieties resistant to Fusarium head blight obtained through gene aggregation molecular breeding technology, and the number of effective resistance genes that can be used for molecular marker-assisted selection is still relatively small. Summary of the Invention

[0005] In view of the above-mentioned prior art, the purpose of this invention is to provide a KASP primer set for detecting Fusarium head blight resistance genes and its application.

[0006] To achieve the above objectives, the present invention adopts the following technical solution: A first aspect of the present invention provides a KASP primer set for detecting Fusarium head blight resistance genes, comprising the primers shown in SEQ ID NO. 1, SEQ ID NO. 2, and SEQ ID NO. 3, as detailed below: Kasp- Fhb7 The1 -F (Add FAM signal sequence): 5'- GAAGGTGACCAAGTTCATGCTAGTCGGCAGGGACATGCA-3'; (SEQ ID NO. 1) Kasp- Fhb7 Thp -F (Add HEX signal sequence): 5'-GAAGGTCGGAGTCAACGGATTAGTCGGCAGGGACATGCC-3'; (SEQ ID NO. 2) Kasp- Fhb7 - Th -R: 5'-GGCTGCGTCAACGTTGCTGTT-3'. (SEQ ID NO.3) In the above primer set, Kasp- Fhb7 The1 -F and Kasp- Fhb7 Thp -F is the upstream typing primer, Kasp- Fhb7 - Th -R is a downstream universal primer.

[0007] Furthermore, the Fusarium head blight resistance gene includes: from diploid *Thinopyrum elongatum*. Fhb7 The1 Genes and from decaploid long-spiked wheatgrass Fhb7 Thp Gene.

[0008] The Fhb7 The1 The nucleotide sequence of the gene is shown in SEQ ID NO.4; nucleotide 383 in the sequence shown in SEQ ID NO.4 is the site of resistance to Fusarium head blight; details are as follows: > Fhb7 The1 ATGGCCACCTCCACCTCCACCTCCACCCCAATCATCTTCTACGACATAGCCCAGCGGCCCCCCGTCGCAGAAACATGCTGCGCCGTCAACCCTTGGAAATCCAGACTGGCCCTCAACTTCAAGGCCGTCCCCTACACAACCACCTGGGTCAAGATGCCAGATATCAGCAGCGTCCGCGCCAGCCTCAACGTGCCAGCGTGTCGCAAGTTCGCCGACGGCTCCGACTTCAACACCCTGCCCATCATCCACGACCCCGCGACCGACTCCCTCATCGGCGACTCCTTGGACATCGCCGCCTACCTGCAGCGCACGTATCCCGCCTCGGGCGCCGGCGACCTCTTCCCCCCCCAGAAGCTCGACTACGCAGTCGGCAGGGACATGCAGCAGCTGCTCTTCCCGCTGTCCGAGATTCGCGCATCACCAGAGCTCGCAGACTACGCCCGCTTCAACAGCAACGTTGACGCAGCCTTTACCGCGCACGTGGGCCTCATGGTCCACGGACTTCCCTTGGATCCTGCCACCGCCGACGTGACCAAGGCCGAGTTTGTGCGGCGCGCGGGGCTCTCATCGTGGGACGACTTGGAAATGGTTGGCGAGGCGCGCGACAAGATGATGCAGTCCCTCCGAAACATGCTGGGGGACCTGGCTGCTTTGTTTCGGAAAGATGCGAGCGGGCCGTTCCTGTTGGGGCAGAGGGCCACGTATGCGGACATGATTGTCGGTGGCTGGTTGCGCATGATGCGGGCGACGTTGCCGGTGAGCGAGTGGCAGGAGGCGAGAGCCTGCCACGGGGCTATCTTTGGGCAGCTGCATGATGCGCTGGACAAGTATGCCGAGGTGAAGTAG。

[0009] Note: The nucleotides in bold and shaded in the sequence are the scab resistance loci.

[0010] The Fhb7 ThpThe nucleotide sequence of the gene is shown in SEQ ID NO.5; the 383rd nucleotide in the sequence shown in SEQ ID NO.5 is the scab resistance locus; specifically as follows: > Fhb7 Thp ATGGCCACCTCCGCCTCCACCTCCACCCCAATCATCTTCTACGACATAGCCCAGCGGCCCCCCGTCGCAGAAACATGCTGCGCCGTCAACCCTTGGAAATCCAGACTGGCCCTCAACTTCAAGGCCGTCCCCTACACAACCACCTGGGTGAAGATGCCAGACATCAGCAGCGTCCGCGCCAGCCTCAACGTGCCAGCGTGTCGCAAGTTCGCCGACGGCTCCGACTTCAACACCCTGCCCATCATCCACGACCCCGCGACCGACTCCCTCGTCGGCGACTCCTTTGACATCGCCGCCTACCTGCAGCGCACGTATCCCGCCTCGGGCGCCGGCGACCTCTTCCCCCCCCAGAAGCTCGACTACGCAGTCGGCAGGGACATGCCGCAGCTGCTCATCCCGCTGTCCGAGATTCGCGCATCACCAGAGCTCGCAGACTACGCCCGCTTCAACAGCAACGTTGACGCAGCCTTTACCGCGCACGTGGGCCTCATGGTCCACGGACTTCCCTTGGATCCTGCCACCGCCGACGTGACCAAGGCCGAGTTTGTGCGGCGCGCGGGGCTCTCATCGTGGGACGACTTGGAAATGGTTGGCGAGGCGCGCGACAAGATGATGCAGTCCCTCCGAAACATGCTGGGGGACCTGGCTGCCTTGTTTCGGAAAGATGCGAGCGGGCCGTTCCTGTTGGGGCAGAGGGCCACGTATGCGGACATGATTGTCGGTGGCTGGTTGCGCATGATGCGGGCGACGTTGCCGGTGAGTGAGTGGCAGGAGGCGAGAGCCTGCCACGGAGCTATCTTTGGGCAGCTGCATGATGCGCTGGACAAGTATGCCGAGGTGAAGTAG。

[0011] Note: The nucleotides in bold shaded areas in the sequence are sites of resistance to Fusarium head blight.

[0012] A second aspect of the present invention provides the application of the above-described KASP primer set in any one of (1)-(3): (1) To identify or assist in the identification of plant resistance to wheat scab; (2) Breeding for wheat scab resistance genes; (3) Select and breed wheat varieties resistant to Fusarium head blight.

[0013] In the above applications, preferably, the wheat scab resistance gene aggregation breeding is... Fhb7 The1 Genes and Fhb7 Thp Gene aggregation breeding.

[0014] In a third aspect, the present invention provides a kit for detecting Fusarium head blight resistance genes, the kit containing the aforementioned KASP primer set.

[0015] Furthermore, the kit also includes a DNA template and 2×Taq Master Mix.

[0016] A fourth aspect of the present invention provides the use of the above-described reagent kit in any one of (1)-(3): (1) To identify or assist in the identification of plant resistance to wheat scab; (2) Breeding for wheat scab resistance genes; (3) Select and breed wheat varieties resistant to Fusarium head blight.

[0017] A fifth aspect of the present invention provides a method for identifying or assisting in the identification of wheat resistance to Fusarium head blight, comprising the following steps: Using genomic DNA from the wheat sample as a template, PCR amplification was performed using the KASP primer set, and the fluorescence signal of the amplified product was detected. If a FAM fluorescence signal was detected, it indicates that the wheat sample contains a resistance gene. Fhb7 The1 The phenotype is resistance to Fusarium head blight; if a HEX fluorescence signal is detected, it indicates that the tested wheat contains a resistance gene. Fhb7 Thp The phenotype is resistance to Fusarium head blight; if both FAM and HEX fluorescent signals are detected, it indicates that the tested wheat contains a resistance gene. Fhb7 The1 and resistance genes Fhb7 Thp The polymer exhibits a phenotype resistant to Fusarium head blight.

[0018] Furthermore, the PCR reaction system was as follows: 1 μL DNA template, 5 μL 2×Taq Master Mix, 0.15 μL each of the primers shown in SEQ ID NO.1 and SEQ ID NO.2, 0.4 μL of the primer shown in SEQ ID NO.3, and double-distilled water to a final volume of 10 μL.

[0019] The PCR reaction conditions were: 95℃ for 10 min; 95℃ for 20 s, 67-57℃ for 1 min, with a decrease of 0.8℃ per cycle, for 10 cycles; 95℃ for 20 s, 57℃ for 1 min, for 30 cycles.

[0020] The beneficial effects of this invention are: This invention relates to Fusarium head blight resistance genes from decaploid and diploid *Thinopyrum elongatum*. Fhb7 The1 Gene, Fhb7 Thp Gene analysis revealed Fhb7 The1 Genes and Fhb7 Thp The gene contains an A / C polymorphism at nucleotide position 383, which can serve as a site for resistance to Fusarium head blight. Based on this resistance site, this invention designs a KASP primer set for detecting Fusarium head blight resistance genes, enabling the detection of resistance genes. Fhb7 The1 Genes and Fhb7 Thp Rapid and accurate gene detection facilitates the aggregation breeding of wheat scab resistance genes, which is of great significance for improving wheat resistance to scab. Attached Figure Description

[0021] Figure 1 KASP tag Kasp- Fhb7-Th Genotyping results in genetically modified wheat; the X-axis represents the FAM signal, with blue indicating genotype A, meaning the tested wheat contains the resistance gene. Fhb7 The1 The Y-axis represents the HEX signal, with red indicating the C genotype, meaning the wheat being tested contains the resistance gene. Fhb7 Thp .

[0022] Figure 2 Fielder, NE- Fhb7 Thp 、 Phenotypic identification results of diploid wheatgrass against Fusarium head blight; NE- Fhb7 Thp Contains resistance genes Fhb7 Thp Genetically modified wheat. Detailed Implementation

[0023] It should be noted that the following detailed descriptions are illustrative and intended to provide further explanation of this application. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application pertains.

[0024] To enable those skilled in the art to better understand the technical solution of this application, the technical solution of this application will be described in detail below with reference to specific embodiments.

[0025] The test materials used in the embodiments of this invention are all conventional test materials in the art and can be purchased through commercial channels. Experimental methods without specified detailed conditions are performed according to conventional test methods or the supplier's recommended operating instructions.

[0026] Example 1: Development of KASP primers for detecting Fusarium head blight resistance genes A Fusarium head blight resistance gene was identified in diploid *Thinopyrum elongatum*. Fhb7 The1 The gene, whose nucleotide sequence is shown in SEQ ID NO.4.

[0027] A Fusarium head blight resistance gene was identified in decaploid long-spike wheatgrass. Fhb7 Thp The gene, whose nucleotide sequence is shown in SEQ ID NO.5.

[0028] Will Fhb7 The1 Genes and Fhb7 Thp Comparative analysis of the genes revealed that there is an A / C polymorphism site at nucleotide 383, which can serve as a site for resistance to Fusarium head blight.

[0029] Based on this Fusarium head blight resistance site, for effective detection Fhb7 The1 Genes and Fhb7 Thp The gene was used to design the KASP primer set, as follows: Kasp- Fhb7 The1 -F (Add FAM signal sequence): 5'- GAAGGTGACCAAGTTCATGCTAGTCGGCAGGGACATGCA-3'; (SEQ ID NO. 1) Kasp- Fhb7 Thp -F (Add HEX signal sequence): 5'-GAAGGTCGGAGTCAACGGATTAGTCGGCAGGGACATGCC-3'; (SEQ ID NO. 2) Kasp- Fhb7 - Th -R: 5'-GGCTGCGTCAACGTTGCTGTT-3'. (SEQ ID NO.3) Example 2: Fielder, NE- Fhb7 Thp 、 Genotypic and phenotypic identification of diploid *Thinopyrum elongatum* for resistance to Fusarium head blight 1. Construction of transgenic materials: Genes of resistance to Fusarium head blight in decaploid long-spike wheatgrass Fhb7 Thp Transferred to wheat, the lines were multiplied using an artificial climate chamber, and self-crossed to the T3 generation to obtain homozygous lines (NE-). Fhb7 Thp ).

[0030] 2. Genotyping: Using the Kasp primer set from Example 1, the transgenic wheat material (NE- Fhb7 Thp Genotyping was performed on diploid long-spike leptostoma and the following steps were taken: (1) Genomic DNA was extracted from the samples using the CTAB method; Cut leaves of wheat or diploid long-spike wheatgrass (2.0-3.0 cm long) and place them in a 2 mL centrifuge tube (containing two small steel balls). After freezing the leaves in liquid nitrogen, quickly grind them into powder (using a plant cell tissue disruptor set to 41 Hz frequency and 40 sec time). Add 800 μL of CTAB extraction buffer (preheated to 65°C in a water bath) and incubate at 65°C for 30 min. Then, add an equal volume of a three-component mixture (phenol:chloroform:isoamyl alcohol = 25:24:1, volume ratio), mix well, let stand for 3 min, centrifuge at 12000 rpm for 10 min, aspirate 700 μL of the supernatant, add 700 μL of isopropanol and 70 μL of sodium acetate, mix well, and let stand for 15 min. Then, centrifuge at 12000 rpm for 10 min, discard the supernatant, and the white precipitate is DNA. After washing twice with 600 μL of 70% ethanol, the DNA precipitate was dissolved in ddH2O and stored at low temperature for later use.

[0031] (2) PCR amplification; The PCR reaction system consisted of: 1 μL DNA template, 5 μL 2×Taq Master Mix, and 10 μmol / L Kasp primers.Fhb7 The1 -F and Kasp- Fhb7 Thp The universal reverse primer Kasp-, with 0.15 μL of each of the - and F groups and a concentration of 10 μmol / L, consists of 0.15 μL of the primer. Fhb7 - [[ID=5 Add 0.4 μL of R to double-distilled water to a final volume of 10 μL.

[0032] The PCR reaction conditions were: 95℃ for 10 min; 95℃ for 20 s, 65-57℃ for 1 min, with a decrease of 0.8℃ per cycle, for 10 cycles; 95℃ for 20 s, 57℃ for 1 min, for 30 cycles.

[0033] (3) KASP tagging results analysis.

[0034] After centrifugation, the PCR products were used to acquire fluorescence data using a FLUOstar Omega microplate reader, and Klustercaller software was used for data analysis, genotyping, and visualization.

[0035] If a FAM signal is detected (near the X-axis, green), the gene sequence at the Fusarium head blight resistance site in the tested material is A, indicating that the tested material contains a resistance gene. ​ The1 This indicates resistance to Fusarium head blight; if a HEX signal (close to the Y-axis, pink) is detected, the gene sequence at the Fusarium head blight resistance site in the tested material is C, representing the presence of a resistance gene in the tested material. ​ Thp It exhibits resistance to Fusarium head blight.

[0036] 3. Phenotypic identification: Selected for identification containing resistance genes ​ Thp Transgenic material (T3) ​ Thp Using diploid wheatgrass and Fielder as samples, resistance to Fusarium head blight phenotype was identified by in vitro leaf inoculation method.

[0037] Phenotypic identification results are as follows ​ As shown in Table 1.

[0038] Table 1: Results of wheat genotype resistance to Fusarium head blight phenotype The results show that: Kasp- ​ The results of the marker genotyping and the identification results of the Fusarium head blight resistance phenotype were completely consistent.

[0039] The above description is merely a preferred embodiment of this application and is not intended to limit this application. Various modifications and variations can be made to this application by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of this application should be included within the protection scope of this application.

Claims

1. A KASP primer set for detecting a scab resistance gene, characterized in that, comprising: primers set forth in SEQ ID NO. 1, SEQ ID NO. 2 and SEQ ID NO.

3.

2. The KASP primer set of claim 1, wherein, The scab resistance genes include: Fhb7 The1 Gene Fhb7 Thp Gene; The Fhb7 The1 The nucleotide sequence of the gene is shown as SEQ ID NO. 4; the 383rdnucleotide in the sequence shown as SEQ ID NO. 4 is the scab resistance site; the Fhb7 Thp The nucleotide sequence of the gene is shown as SEQ ID NO. 5; the 383rdnucleotide in the sequence shown as SEQ ID NO. 5 is the scab resistance site.

3. Use of the KASP primer set of claim 1 or 2 in any one of (1) - (3): (1) identifying or assisting in identifying a plant for resistance to wheat scab; (2) wheat scab resistance gene pyramiding breeding; (3) breeding wheat varieties resistant to scab.

4. Use according to claim 3, characterized in that, The wheat scab resistance gene pyramiding breeding is Fhb7 The1 genes and Fhb7 Thp gene pyramiding breeding.

5. A kit for detecting a resistance gene to scab, characterized by, The kit contains the KASP primer set of claim 1 or 2.

6. The kit of claim 5, wherein The kit further comprises: a DNA template and 2x TaqMaster Mix.

7. Use of the kit of claim 5 or 6 in any one of (1) - (3): (1) identifying or assisting in identifying a plant for resistance to wheat scab; (2) wheat scab resistance gene pyramiding breeding; (3) breeding wheat varieties resistant to scab.

8. A method for identifying or assisting in identifying wheat for resistance to scab, comprising the following steps: The KASP primer set in claim 1 or 2 is used for PCR amplification with the genomic DNA of the wheat to be detected as a template, and the fluorescence signal of the amplification product is detected; if FAM fluorescence signal is detected, it represents that the wheat to be detected contains the resistance gene Fhb7 The1 with the phenotype of resistance to scab; if HEX fluorescence signal is detected, it represents that the wheat to be detected contains the resistance gene Fhb7 Thp with the phenotype of resistance to scab; if both FAM and HEX fluorescence signals are detected, it represents that the wheat to be detected contains the resistance gene Fhb7 The1 and the resistance gene Fhb7 Thp polymerization, with the phenotype of resistance to scab.

9. The method of claim 8, wherein, The PCR reaction system is: DNA template 1 μL, 2x TaqMaster Mix 5 μL, primers set forth in SEQ ID NO. 1 and SEQ ID NO. 2 each 0.15 μL, primer set forth in SEQ ID NO. 3 0.4 μL, add double distilled water to 10 μL.

10. The method of claim 8, wherein, The PCR reaction condition is: 95℃ 10 min; 95℃ 20s, 67-57℃ 1 min, 10 cycles of each cycle decreasing 0.8℃; 95℃ 20s, 57℃ 1 min, 30 cycles.

Images