Composition containing recombinant humanized superoxide dismutase as well as preparation method and application of composition

By combining recombinant humanized superoxide dismutase with fenugreek fruit extract, rhodiola rosea extract and lentil fruit extract in a specific ratio, the problem of activity stability of recombinant humanized superoxide dismutase under high temperature and acid-base conditions was solved, and the whitening and anti-wrinkle effects of cosmetics were improved.

CN121445641APending Publication Date: 2026-02-03广东赛元生物医学技术有限公司
View PDF 7 Cites 0 Cited by

Patent Information

Application Number
CN202511834618.2
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-12-08
Publication Date
2026-02-03

AI Technical Summary

Technical Problem

Existing recombinant humanized superoxide dismutases have poor activity stability under high temperature and acid-base conditions, and their skin care efficacy as a single ingredient is limited, making it difficult to widely use in cosmetics.

Method used

By employing a specific ratio of recombinant humanized superoxide dismutase with fenugreek fruit extract, rhodiola rosea extract, and lentil fruit extract, and through pH adjustment with hydrochloric acid and desalting treatment with a cation exchange resin column, combined with cellulase and pectinase treatment, a composition was prepared to improve enzyme stability and enhance whitening, anti-wrinkle, and firming effects.

Benefits of technology

It significantly improved the activity stability of recombinant humanized superoxide dismutase under high temperature and acid-base conditions, and significantly enhanced its skin care effects of whitening, anti-wrinkle and firming.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure SMS_1
    Figure SMS_1
Patent Text Reader

Abstract

The invention discloses a composition containing recombinant humanized superoxide dismutase as well as a preparation method and application thereof, and belongs to the technical field of cosmetics. The composition comprises recombinant humanized superoxide dismutase, a fenugreek fruit extract, a rhodiola rosea extract and a lentil fruit extract. The three plant extract components of the fenugreek fruit extract, the rhodiola rosea extract and the lentil fruit extract can synergistically improve the high temperature resistance and strong acid and alkali resistance activity of the recombinant humanized superoxide dismutase, and can achieve the effects of whitening, resisting wrinkles and tightening; experiments prove that the superoxide dismutase subjected to recombinant expression has better purity and biological activity, so that the composition containing the recombinant humanized superoxide dismutase has a wide market application prospect.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the field of cosmetics, in particular to a composition containing recombinant humanized superoxide dismutase and its preparation method and application. BACKGROUND

[0002] Superoxide dismutase (SOD) is an important antioxidant enzyme that can scavenge superoxide anion radicals in the body and plays an important role in anti-aging and antioxidant. However, natural SOD has poor stability and is easily inactivated under extreme conditions such as high temperature, acid and alkali, which limits its wide application in skin care products. The recombinant humanized SOD in the prior art is prepared by genetic engineering technology and has good compatibility with the human body, but its activity is still reduced under high temperature, acid and alkali conditions during the production, storage and use of skin care products. In addition, the single SOD component has limited effect on skin care functions such as whitening, anti-wrinkle and firming, and needs to be synergized with other components to enhance the effect. The prior art CN113491663A discloses a superoxide dismutase composition comprising sodium polyacrylate, lactic acid bacteria fermentation lysate, superoxide dismutase and fullerene. The composition can whiten, fade spots, resist aging, control oil and even skin color. However, this technology still does not solve the technical problem of easy inactivation of superoxide dismutase under high temperature.

[0003] The prior art CN116098848A discloses a moisturizing and whitening skin care stock solution comprising components: water, nicotinamide, sodium hyaluronate, glycerol, 1,3-propanediol, polypeptide, traditional Chinese medicine extract, troxerutin, hydrolyzed micrococcus gum, tremella polysaccharide, superoxide dismutase 0.5-0.8 parts, mannitol and xanthan gum. Although it contains a variety of components, it does not improve the stability of superoxide dismutase through the synergistic effect of the components.

[0004] At present, although there are attempts to use SOD and other plant extracts in cosmetics in the prior art, there are still deficiencies in the optimization of raw material preparation process, the synergistic stability of each component to SOD activity and the improvement of comprehensive skin care effect. Therefore, it is of great significance to develop a composition that can improve the activity stability of recombinant humanized SOD under extreme conditions and has excellent whitening, anti-wrinkle and firming effects. SUMMARY

[0005] In view of the poor activity stability of recombinant humanized superoxide dismutase under high temperature, acid and alkali conditions and the limited skin care effect of single component in the prior art, the present application provides a composition containing recombinant humanized superoxide dismutase and its preparation method and application, aiming to improve the activity stability of recombinant humanized superoxide dismutase under high temperature, acid and alkali conditions and achieve multiple effects such as whitening, anti-wrinkle and firming.

[0006] In a first aspect, the present application provides a composition containing recombinant humanized superoxide dismutase, characterized by comprising the following components by weight: 7-10 parts of recombinant humanized superoxide dismutase, 15-20 parts of Trigonella foenum-graecum fruit extract, 10-15 parts of Rhodiola rosea extract, and 20-25 parts of Lens culinaris fruit extract.

[0007] Further preferably, the composition provided in the first aspect comprises the following components: 8-9 parts of recombinant humanized superoxide dismutase, 17-20 parts of Trigonella foenum-graecum fruit extract, 12-15 parts of Rhodiola rosea extract, and 20-23 parts of Lens culinaris fruit extract.

[0008] The preparation method of the Trigonella foenum-graecum fruit extract comprises the following steps: mixing Trigonella foenum-graecum fruit powder with an ethanol aqueous solution with a volume fraction of 60-80%, and the solid-liquid ratio of the powder to the ethanol aqueous solution being 1 g:(10-15) mL. Ultrasonic extraction is performed under ice water bath conditions for 1-5 h at an ultrasonic power of 300-350 W, and then the pH is adjusted with hydrochloric acid, followed by suction filtration, cation exchange resin desalination, concentration, and freeze-drying to obtain the Trigonella foenum-graecum fruit extract.

[0009] The preparation method of the Rhodiola rosea extract comprises the following steps: mixing Rhodiola rosea root stem powder with an ethanol aqueous solution with a volume fraction of 50-70%, and the solid-liquid ratio of the powder to the ethanol aqueous solution being 1 g:(10-20) mL. Heating and refluxing are performed at 70-80 ℃ for 4-8 h, and then the filtrate obtained by suction filtration is combined, followed by cation exchange resin desalination, concentration, and freeze-drying to obtain the Rhodiola rosea extract.

[0010] The preparation method of the Lens culinaris fruit extract comprises the following steps: mixing Lens culinaris fruit powder with distilled water at a solid-liquid ratio of 1 g:(20-30) mL, adding a cellulase and pectinase mixture, and keeping the temperature at 30-40 ℃ for 1-5 h; heating and refluxing at 80-100 ℃ for 1-3 h, followed by suction filtration, and then adding EDTA to the filtrate; ultrafiltration, concentration, and freeze-drying to obtain the Lens culinaris fruit extract. The weight ratio of the cellulase to the pectinase is 1:(1-2), the cellulase and pectinase mixture is added in an amount of 0.05-1% of the weight of the Lens culinaris fruit powder, and the amount of EDTA added is 0.001-0.01% of the weight of the Lens culinaris fruit powder.

[0011] In a second aspect, the present application further provides a preparation method of the composition containing recombinant humanized superoxide dismutase according to the first aspect, which comprises mixing the components in proper amounts to obtain the composition.

[0012] In a third aspect, the present application further provides the use of the composition containing recombinant humanized superoxide dismutase according to the first aspect in the preparation of cosmetics.

[0013] Preferably, the amount of the composition containing the recombinant humanized superoxide dismutase in the cosmetic product of the first aspect is 0.05-20wt%; more preferably, the amount is 1-10wt%.

[0014] Preferably, the cosmetic product further comprises at least one of emulsifiers, thickeners, humectants, preservatives, antioxidants, stabilizers, solvents, in addition to the composition containing the recombinant humanized superoxide dismutase of the first aspect.

[0015] More preferably, the cosmetic product is any one of moisturizing lotion, essence, emulsion, mask liquid, cream, and paste.

[0016] The fenugreek fruit extract is a natural plant ingredient extracted from fenugreek fruit, mainly rich in flavonoids (such as vitexin, tricin, naringenin, quercetin), saponins (such as diosgenin), organic acids, polysaccharides (such as galactomannan) and other components. Flavonoids can inhibit the activity of tyrosinase, and flavonoids and polysaccharides have antioxidant effects, can scavenge free radicals, and reduce the damage of oxidative stress to the skin. The -OH in the fenugreek polysaccharide molecule can form a hydrogen bond with water molecules to form a network structure, locking water, resulting in water loss, and having a moisturizing effect.

[0017] The rhodiola extract is a natural plant ingredient extracted from the roots and stems of the rhodiola plant rhodiola crenulata, and the rhodiola extract is rich in rhodioloside, gallic acid, tyrosol, ethyl gallate and many other bioactive substances, which have antioxidant, anti-aging, whitening and other effects, and can be applied to cosmetics.

[0018] The lentil fruit extract contains various active components, mainly including polyphenols, flavonoids, amino acids, vitamins, polysaccharides, dietary fiber and the like. Among them, flavonoids have excellent antioxidant capacity, can scavenge free radicals in the skin, reduce the oxidative damage of free radicals to skin cells, and avoid the skin from becoming dark and yellow due to oxidation.

[0019] Beneficial effects The present application provides a composition containing recombinant humanized superoxide dismutase and a preparation method and application thereof, the composition comprising recombinant humanized superoxide dismutase, fenugreek fruit extract, rhodiola extract, and lentil fruit extract.

[0020] The present application inventors have unexpectedly found that the fenugreek fruit extract, rhodiola extract and lentil fruit extract can synergistically improve the activity stability of the recombinant humanized superoxide dismutase under high temperature, acid and alkali conditions through a specific amount ratio, and can achieve the technical effects of whitening, anti-wrinkle and firming.

[0021] Further, the preparation methods of the fenugreek fruit extract, the rhodiola extract, and the lentil fruit extract also have a significant influence on the activity stability of the recombinant humanized superoxide dismutase. The fenugreek fruit extract is adjusted in pH by hydrochloric acid and is desalted by a cation resin column to remove protein polypeptides and inorganic salts (especially heavy metal cations) and other components that may affect enzyme activity; the rhodiola extract is desalted by a cation resin column to remove inorganic salts and other components that affect enzyme activity; and the lentil fruit extract can obviously increase the content of polysaccharides and other effective components that stabilize enzyme activity in the extract by adding a specific ratio of cellulase and pectinase mixture; so that the three kinds of plant extracts prepared in the present application can further stabilize enzyme activity and ensure the play of the whitening, anti-wrinkle, and firming effects of the composition. DETAILED DESCRIPTION

[0022] The technical solutions in the embodiments of the present application will be clearly and completely described below in combination with the embodiments of the present application, and the described embodiments are only some preferred embodiments of the present application, rather than all embodiments. Based on the embodiments in the present application, all other embodiments obtained by those skilled in the art without creative labor fall within the scope of protection of the present application.

[0023] In the embodiments, the experimental methods used are all conventional or general methods in the art if no special description is given, and the materials, reagents, etc. used can be obtained from commercial channels if no special description is given.

[0024] The raw materials used in the examples and comparative examples will be described as follows: Preparation of recombinant humanized superoxide dismutase (rhSOD-A): a humanized superoxide dismutase gene with a 6×His-tag coding sequence at the 5' end was chemically synthesized, and the sequence of the gene is shown in SEQ ID NO. 1, and the chemical synthesis was completed by a GenScript company agent; the gene sequence was cloned into an E. coli expression vector pET-3c (Nde I and BamH I were used as the enzyme digestion sites), to construct a pET-3c-hSOD1 expression plasmid, and the construction of the recombinant plasmid was also completed by a GenScript company agent; the pET-3c-hSOD1 expression plasmid was transformed into BL21 (DE3) competent cells by heat shock method, and BL21 (DE3)-pET-3c-hSOD1 engineering bacteria were obtained through screening and sequencing verification; the BL21 (DE3)-pET-3c-hSOD1 engineering bacteria were cultured in LB medium to OD600 of 0.6-0.8, and then 1 mmol / L IPTG was added for induction of expression, and the bacteria were further cultured at 37°C for 4 hours, and then the temperature was reduced to 25°C and the bacteria were cultured for 16 hours; the bacteria were collected by centrifugation, and then the bacteria were resuspended in 50 mmol / L Tris-HCl buffer (pH 8.0) and then ultrasonically broken; the supernatant was collected after centrifugation, and then the supernatant was purified by Ni-NTA affinity chromatography to obtain the rhSOD-A. 2+ and 20 μmol / L Zn 2+The fermentation liquid was collected by centrifugation at 5000 rpm and 4°C for 20 min. The bacterial cells were lysed by adding a lysis solution in a mass / volume ratio of 1:5. The lysis solution was prepared by mixing 20 mM imidazole, 500 mM sodium chloride, and 20 mM PB (pH 7.4). The resuspended solution was homogenized by a high-pressure homogenizer (pressure 1000 bar) for 3 times. Then, the solution was centrifuged at 10000 rpm and 4°C for 30 min. The supernatant was collected and filtered through a 0.45 μm filter membrane. The recombinant humanized superoxide dismutase was purified by nickel column affinity chromatography. Before the purification of the protein, the nickel column affinity chromatography medium was equilibrated with 10 times the column volume of an equilibration buffer (20 mM imidazole, 500 mM sodium chloride, and 20 mM PB, pH 7.4). Then, the purified protein was eluted with 200 mM imidazole. After the protein was purified, the protein was concentrated and desalted by an ultrafiltration tube (30 kDa cut-off) at 4°C and 6000 rpm. After 50 μl of the purified sample was mixed with 25 μl of 2x SDS-PAGE loading buffer, 10 μl of the mixture was subjected to SDS-PAGE electrophoresis. After the protein was stained with Coomassie brilliant blue, the purity of the recombinant humanized superoxide dismutase was determined to be greater than or equal to 95%. Then, the protein sample was loaded onto a Q column, and the flow-through was collected to remove endotoxins. The catalytic activity of the prepared recombinant humanized superoxide dismutase (rhSOD-A) was determined by a hydroxylamine method total superoxide dismutase (T-SOD) assay kit. The rhSOD-A with high activity was stored at -80°C for later use.

[0025] The humanized superoxide dismutase gene (SEQ ID NO. 1) is as follows: ATGGCAACCAAAGCGGTGTGCGTTCTGAAAGGTGACGGCCCAGTCCAAGGCATCATCAACTTCGAGCAAAAAGGTTCTAACGGTACTGTGAAAGTATGGGGCAGCATCAAAGGTCTGACCGAAGGCCTGCACGGCTTTCACGTTCACGAATTCGGTGACAATACCGCTGGCTGTACGAGCGCTGGTCCGCACTTCAACCCGCTGAGCCGTAAACACGGCGGTCCGAAAGATGAGGAGCGTCACGTGGGTGACCTGGGTAACGTAACCGCAGACAAAGACGGTGTTGCGGATGTCAGCATTGTGGACAGCGTGATCTCTCTGAGCGGCGATCACTCTATCATTGGCCGTACCCTGGTTGTTCACGAAAAAGCTGATGACCTGGGTAAAGGCGGCAACGAAGAGTCTACCAAAACCGGTAACGCAGGCAGCCGTCTGGCGTGTGGTGTTATTGGTATTGCCCAGTAA.

[0026] EDTA (ethylenediaminetetraacetic acid): purchased from Xi'an Tianyi Biotechnology Co., Ltd. Cellulase: purchased from Shanghai Yuanye Biotechnology Co., Ltd. Pectinase: purchased from Shanghai Zheyanchuang Biotechnology Co., Ltd. Total superoxide dismutase (T-SOD) test kit (hydroxylamine method): purchased from Nanjing Jiancheng Biological Engineering Institute.

[0027] The component raw materials used in each embodiment and comparative example of the present application are commercially available raw materials unless otherwise specified, and the component raw materials used in each parallel experiment are the same.

[0028] Preparation of fenugreek fruit extract (self-made): The specific preparation method includes the following steps: mixing fenugreek fruit powder with 60% by volume ethanol aqueous solution, and the solid-liquid ratio of the powder to the ethanol aqueous solution is 1 g: 15 mL. Ultrasonic extraction is carried out under ice water bath conditions for 2 h, the ultrasonic power is 300 W, and after the extraction is completed; adjust the pH to 3 with 1M hydrochloric acid, and perform Buchner filtration twice; slowly add the filtrate to a cation exchange resin (type 732) column (diameter 2 cm, height 30 cm) at a flow rate of 0.8 times the column volume per hour for desalination, collect the effluent, concentrate, and freeze-dry to obtain the fenugreek fruit extract.

[0029] Preparation of rhodiola extract (self-made): The specific preparation method comprises the following steps: taking the root stem powder of Rhodiola rosea and mixing it with a 70% ethanol aqueous solution by volume fraction, and the solid-liquid ratio of the powder and the ethanol aqueous solution is 1 g:20 mL. Heating is performed at 80°C for 4 h under reflux, and then filtration is performed. After extraction for 2 times, the filtrates are combined, and then the filtrates are slowly added to a cation exchange resin (type 732) column (diameter 2 cm, height 30 cm) for desalination at a flow rate of 0.8 times the column volume per hour. The effluent is collected, concentrated, and freeze-dried to obtain the Rhodiola rosea extract.

[0030] Preparation of lentil fruit extract (self-made): The specific preparation method comprises the following steps: taking the lentil fruit powder and mixing it with distilled water, and the solid-liquid ratio is 1 g:25 mL. A cellulase and pectinase mixture is added, and enzymolysis is performed at 40°C for 3 h. Heating is performed at 80°C for 2 h under reflux, and then filtration is performed twice by using a Buchner funnel. After EDTA is added to the filtrate and stirred uniformly, ultrafiltration is performed (with a molecular weight cut-off of 1000 Da), and the cut-off liquid is collected, concentrated, and freeze-dried to obtain the lentil fruit extract. The weight ratio of the cellulase and the pectinase is 1:1.5. The cellulase and the pectinase mixture is added in an amount of 0.1% of the weight of the lentil fruit powder. The amount of EDTA added is 0.005% of the weight of the lentil fruit powder.

[0031] Example 1 A composition containing recombinant humanized superoxide dismutase, 9 parts of recombinant humanized superoxide dismutase, 18 parts of fenugreek fruit extract, 13 parts of Rhodiola rosea extract, and 22 parts of lentil fruit extract are mixed, and the mixture is obtained.

[0032] Example 2 A composition containing recombinant humanized superoxide dismutase, 10 parts of recombinant humanized superoxide dismutase, 20 parts of fenugreek fruit extract, 10 parts of Rhodiola rosea extract, and 25 parts of lentil fruit extract are mixed, and the mixture is obtained.

[0033] Example 3 A composition containing recombinant humanized superoxide dismutase, 7 parts of recombinant humanized superoxide dismutase, 15 parts of fenugreek fruit extract, 15 parts of Rhodiola rosea extract, and 20 parts of lentil fruit extract are mixed, and the mixture is obtained.

[0034] Example 4 A composition containing recombinant humanized superoxide dismutase, 8 parts of recombinant humanized superoxide dismutase, 20 parts of fenugreek fruit extract, 15 parts of Rhodiola rosea extract, and 23 parts of lentil fruit extract are mixed, and the mixture is obtained.

[0035] Comparative Example 1 A composition containing recombinant humanized superoxide dismutase, 9 parts of recombinant humanized superoxide dismutase, 13 parts of rhodiola extract, 22 parts of lentil fruit extract are mixed, and the weight parts are obtained.

[0036] Comparative Example 2 A composition containing recombinant humanized superoxide dismutase, 9 parts of recombinant humanized superoxide dismutase, 18 parts of fenugreek fruit extract, 22 parts of lentil fruit extract are mixed, and the weight parts are obtained.

[0037] Comparative Example 3 A composition containing recombinant humanized superoxide dismutase, 9 parts of recombinant humanized superoxide dismutase, 18 parts of fenugreek fruit extract, 13 parts of rhodiola extract are mixed, and the weight parts are obtained.

[0038] Comparative Example 4 A composition containing recombinant humanized superoxide dismutase, 9 parts of recombinant humanized superoxide dismutase, 18 parts of fenugreek fruit extract, 13 parts of rhodiola extract, 22 parts of lentil fruit extract are mixed, and the weight parts are obtained.

[0039] Comparative Example 4 and Example 1 The preparation method of fenugreek fruit extract and rhodiola extract is different. The preparation method of fenugreek fruit extract and rhodiola extract in Comparative Example 4 is as follows: Preparation of fenugreek fruit extract: Mix fenugreek fruit powder with 60% ethanol aqueous solution, and the solid-liquid ratio of powder to ethanol aqueous solution is 1g:15mL. Ultrasonic extraction for 2h under ice water bath condition, ultrasonic power 300W, after extraction; filter twice by Buchi, concentrate the filtrate, freeze-dry to obtain fenugreek fruit extract (i.e. compared with the preparation method of fenugreek fruit extract in Example 1: without hydrochloric acid to adjust pH and cation resin column desalination).

[0040] Preparation of rhodiola extract: Take rhodiola root stem powder and mix with 70% ethanol aqueous solution, and the solid-liquid ratio of powder to ethanol aqueous solution is 1g:20mL. Heat under reflux at 80℃ for 4h, filter, combine the filtrate after extraction twice, concentrate the filtrate, freeze-dry to obtain rhodiola extract (i.e. compared with the preparation method of rhodiola extract in Example 1: without cation resin column desalination).

[0041] Comparative Example 5 A composition containing recombinant humanized superoxide dismutase, 9 parts of recombinant humanized superoxide dismutase, 18 parts of fenugreek fruit extract, 13 parts of rhodiola extract, 22 parts of lentil fruit extract are mixed, and the weight parts are obtained.

[0042] Comparative Example 5 differs from the preparation method of the Phaseolus lunatus fruit extract in Example 1, and the only difference is that the weight ratio of cellulase and pectinase is 2:1, and the remaining steps and parameters are the same as those in Example 1.

[0043] Table 1 Components and parts by weight of Examples 1-4 and Comparative Examples 1-5 Example 1 Example 2 Example 3 Example 4 Comparative Example 1 Comparative Example 2 Comparative Example 3 Comparative Example 4 Comparative Example 5 Recombinant humanized superoxide dismutase 9 10 7 8 9 9 9 9 9 Bengal gram fruit extract (self-prepared) 18 20 15 20 / 18 18 / 18 Rhodiola extract (self-prepared) 13 10 15 15 13 / 13 / 13 Pea fruit extract (self-prepared) 22 25 20 23 22 22 / 22 / Bengal gram fruit extract (prepared according to the method in Comparative Example 4) / / / / / / / 18 / Rhodiola extract (prepared according to the method in Comparative Example 4) / / / / / / / 13 / Pea fruit extract (prepared according to the method in Comparative Example 5) / / / / / / / / 22 Note: " / " means that the component is not contained.

[0044] Application Examples 1-4 and Comparative Application Examples 1-5 The application examples and comparative application examples provide a whitening and moisturizing lotion, the composition of which is shown in Table 2 Whitening and Moisturizing Lotion Formulation Table, and Application Examples 1-4 and Comparative Application Examples 1-5 respectively contain the composition containing recombinant humanized superoxide dismutase prepared in Examples 1-4 or Comparative Examples 1-5.

[0045] The preparation method of the whitening and moisturizing lotion comprises the following steps: Sodium hyaluronate is added to deionized water, heated at 40°C, stirred at 100 rpm for 30 min, the heating is stopped, the temperature is lowered to room temperature, glycerol, propylene glycol, menthol, vitamin C, vitamin E, p-hydroxyacetophenone, 1,2-hexanediol, arginine are added, and stirred at 300 rpm for 5 min, then the composition containing recombinant humanized superoxide dismutase provided in the examples or comparative examples is added, stirred uniformly, and discharged to obtain the whitening and moisturizing lotion.

[0046] Table 2 Whitening and Moisturizing Lotion Formulation Table Raw material name Weight percentage (%) Composition containing recombinant humanized superoxide dismutase prepared in Examples 1 to 4 or Comparative Examples 1 to 5 10.00 Sodium hyaluronate 0.5 Glycerin 0.8 Propylene glycol 1.5 Menthol 0.2 Vitamin C 0.5 Vitamin E 0.5 p-Hydroxyacetophenone 0.5 1,2-Hexanediol 0.5 Arginine 0.05 Deionized water Balance Performance verification test 1. Human patch test of the application example whitening and moisturizing lotion Test method: According to the "Cosmetic Safety Technology Standard" (2015 edition), human patch test is used to verify the skin irritation of the application examples 1-4 and comparative application examples 1-5, and the specific test method and skin adverse reaction grading standard are shown in Table 3.

[0047] Thirty volunteers, half male and half female, aged 18-60 years, with an average age of 29.4 years, were recruited. First, select the appropriate patch tester, use the closed patch test method, apply equal amounts of the test substance about 25 μL to the patch tester, and apply it to the outer side of the volunteer's upper arm with low-sensitization tape, and press it evenly on the skin. After 24 hours, remove the test substance, and observe the skin reaction at 0.5 hours, 24 hours and 48 hours after removing the patch tester. The skin adverse reaction results are shown in Table 4.

[0048] Table 3 Skin Adverse Reaction Grading Standard Classification Skin reaction 0 No reaction 1 Weak erythema 2 Erythema, infiltration, and possibly papules 3 Erythema, infiltration, edema, papules, and blisters 4 Erythema, edema, and bullae Table 4 Skin adverse reaction record results Number of subjects Grade 0 Grade 1 Grade 2 Grade 3 Grade 4 Application Example 1 30 0 0 0 0 Application Example 2 30 0 0 0 0 Application Example 3 30 0 0 0 0 Application Example 4 30 0 0 0 0 Comparative Application Example 1 30 0 0 0 0 Comparative Application Example 2 30 0 0 0 0 Comparative Application Example 3 30 0 0 0 0 Comparative Application Example 4 30 0 0 0 0 Comparative Application Example 5 30 0 0 0 0 According to the data in Table 4, the whitening and moisturizing lotions prepared in application examples 1-4 and comparative application example 1-5 do not have skin irritation or sensitization, indirectly proving that the composition containing recombinant humanized superoxide dismutase prepared in the application does not have skin irritation, and has good biological safety, and is suitable for preparing cosmetics.

[0049] 2. Application example, comparative application example whitening performance test Test method: 90 volunteers with whitening needs, aged 20-50 years, were recruited, and were required to have not used whitening products, drugs or received whitening medical treatment in the past 1 month, skin type was Fitzpatrick type II-IV, and face had no active skin diseases (such as acne, eczema, contact dermatitis, etc.). The 90 subjects meeting the criteria were evenly divided into 9 groups by random number table method. Different groups used the whitening and moisturizing lotions prepared in application examples 1-4 and comparative application example 1-5, respectively.

[0050] Experimental area determination: the area from the zygomatic bone to the lower border of the mandible (area 4 cm x 5 cm) on the face was selected as the test area, which had no obvious scars, damage or hair obstruction, was symmetrical and had uniform pigment distribution. Using a Hexameter MX18 tester, 3 detection points were randomly selected in the test area (avoiding the edge of the pigment spot), each point was detected continuously for 3 times, and the average value was taken as the melanin content before use (recorded as M1). The subject applied 0.5 g of the whitening and moisturizing lotion to the test area, once in the morning and once in the evening, and the test lasted for 4 weeks. After 4 weeks of continuous use, the melanin content in the test area was detected under the same environmental conditions (temperature 22-24℃, humidity 45%-55%) as the baseline detection, and the average value was taken as the melanin content after use (recorded as M2). Calculation: melanin inhibition rate T = (M1-M2) / M1 x 100%.

[0051] Table 5 Melanin inhibition rate table Group Melanin inhibition rate (%) Application Example 1 23.6 Application Example 2 21.4 Application Example 3 20.7 Application Example 4 22.3 Comparative Application Example 1 13.9 Comparative Application Example 2 10.5 Comparative Application Example 3 15.4 Comparative Application Example 4 22.4 Comparative Application Example 5 18.2 From the data in Table 5, it can be seen that: 1) the application examples 1-4 can significantly inhibit melanin production and have better whitening effect than the comparative application examples 1-3 and 5. 2) The application example 1 has better melanin inhibition effect than the comparative application examples 1-3, indicating that the three plant extracts (fenugreek fruit extract, rhodiola extract, and lentil fruit extract) can synergize with the recombinant humanized superoxide dismutase to exert the whitening effect; when one kind of plant extract component is missing, the whitening effect will be significantly reduced. 3) The melanin inhibition rates of the comparative application example 4 and the application example 1 are close, and the whitening effects are equivalent, which indicates that the preparation methods of the fenugreek fruit extract and the rhodiola extract in the comparative application example 4 have little effect on the whitening effect of the comparative application example 4, which may be because the component compositions of the fenugreek fruit extract and the rhodiola extract in the comparative application example 4 and the comparative example 1 are less different, and the inorganic salt and protein polypeptide components contained in the fenugreek fruit extract and the rhodiola extract in the comparative application example 4 have little effect on the enzyme activity of the recombinant humanized superoxide dismutase in the short term. 4) The preparation method of the lentil fruit extract contained in the comparative application example 5 adds cellulase and pectinase in different amounts than the application example 1, resulting in a large difference in the component composition of the lentil fruit extract contained in the comparative application example 5 and the application example 1, and thus the melanin inhibition rate of the comparative application example 5 is significantly lower than that of the application example 1.

[0052] 3. High-temperature-resistant, acid- and alkali-resistant, long-term stability accelerated test 1) High-temperature resistance test The activity of the recombinant humanized superoxide dismutase in the application examples 1-4 and the comparative application examples 1-5 (denoted as N1) was determined at room temperature 25℃, and the activity of the recombinant humanized superoxide dismutase (denoted as N2) was determined after heating in a 50℃ constant temperature water bath for 0.5h, 1h, 2h, and 4h, respectively, and then recovering to room temperature 25℃. The enzyme activity retention rate W=(N2 / N1)×100% was calculated. The total superoxide dismutase (T-SOD) test kit (hydroxylamine method) was used to determine the enzyme activity.

[0053] 2) Acid and alkali resistance test The prepared whitening, moisturizing, and emollient 20mL in the application examples 1-4 and the comparative application examples 1-5 was taken into a 50mL centrifuge tube, and the activity of the recombinant humanized superoxide dismutase (denoted as N1) was determined at room temperature 25℃. The pH was adjusted with 0.1mol hydrochloric acid or 0.1mol sodium hydroxide solution to obtain samples to be tested with pH values of 2, 3, 4, 5, 6, 7, 8, 9, and 10. The samples to be tested were placed in a 37℃ constant temperature water bath for 30min, and then the enzyme activity (denoted as N2) was determined after recovering to room temperature. The enzyme activity retention rate W=(N2 / N1)×100% was calculated.

[0054] 3) Long-term stability accelerated test The activity of the recombinant humanized superoxide dismutase in application examples 1-4 and comparative application examples 1-5 was determined at room temperature 25℃. The whitening and moisturizing lotion prepared in application examples 1-4 and comparative application examples 1-5 was stored in a vial sealed and stored in a constant temperature and humidity (RH 60%) box at 40±1℃ in the dark, and the activity of the recombinant humanized superoxide dismutase was determined at 0 days (enzyme activity was recorded as N1), 1 month, 2 months, 3 months, and 4 months (recorded as N2), and the enzyme activity retention rate W=(N2 / N1)×100% was calculated. The appearance of the product after 4 months was recorded.

[0055] Table 6 Superoxide dismutase activity retention rate (%)

[0056] According to the data in Table 6, it can be seen that: 1) After the high temperature resistance test, acid and alkali resistance test, and long-term stability accelerated test, the recombinant humanized superoxide dismutase contained in application example 1-4 showed better high temperature resistance, acid and alkali resistance, and long-term stability than comparative application examples. 2) Compared with application example 1, comparative application example 1-3 lacks one of the three plant extracts (fenugreek fruit extract, rhodiola extract, and lentil fruit extract), which leads to a significant decrease in enzyme activity in the high temperature test, acid and alkali test, and long-term stability accelerated test. This indicates that fenugreek fruit extract, rhodiola extract, and lentil fruit extract can synergistically protect the recombinant humanized superoxide dismutase, improve the high temperature resistance, acid and alkali resistance of the recombinant humanized superoxide dismutase, and maintain the stability of the enzyme activity. 3) Compared with application example 1, comparative application example 4 contains fenugreek fruit extract that has not been adjusted to pH with hydrochloric acid and desalted by cation resin column, and rhodiola extract that has not been desalted by cation resin column. The adjustment of pH with hydrochloric acid and desalting by cation resin column can respectively precipitate protein polypeptides and inorganic salts (metal cations, especially heavy metal ions), which leads to a large amount of inorganic salts and protein polypeptide components in the extract, and further leads to a significant decrease in enzyme activity in the long-term stability accelerated test and precipitation. Although the preparation methods of the fenugreek fruit extract and rhodiola extract contained in comparative application example 4 and application example 1 are different, the main components of the plant extracts are similar, so the results of the high temperature resistance test and acid and alkali resistance test of comparative application example 4 and application example 1 are comparable. 4) Compared with application example 1, comparative application example 5 contains lentil fruit extract prepared with different amounts of cellulase and pectinase, which leads to a large difference in the components contained in the lentil fruit extract, and further leads to a significant decrease in enzyme activity in the high temperature resistance test, acid and alkali resistance test, and long-term stability accelerated test of comparative application example 5.

[0057] The preferred embodiments of the application disclosed above are only to facilitate the elucidation of the application. The preferred embodiments do not describe all the details of the application and limit the application to the specific embodiments described. Obviously, many modifications and variations can be made in light of the teachings above. The description is chosen and described in order to best explain the principles of the application and its practical application to thereby enable others skilled in the art to best utilize the application and get the best results from the application. The application is only limited by the claims as well as their full scope and equivalents.

Claims

1. A composition containing recombinant humanized superoxide dismutase, characterized in that, By weight, it includes the following components: 7-10 parts of recombinant humanized superoxide dismutase, 15-20 parts of fenugreek fruit extract, 10-15 parts of Rhodiola rosea extract, and 20-25 parts of lentil fruit extract.

2. The composition containing recombinant humanized superoxide dismutase according to claim 1, characterized in that, 8-9 parts of recombinant humanized superoxide dismutase, 17-20 parts of fenugreek fruit extract, 12-15 parts of Rhodiola rosea extract, and 20-23 parts of lentil fruit extract.

3. The composition containing recombinant humanized superoxide dismutase according to claim 1, characterized in that, The preparation method of the fenugreek fruit extract includes the following steps: Fenugreek fruit powder was mixed with an ethanol aqueous solution with a volume fraction of 60%-80%, and the ratio of powder to ethanol aqueous solution was 1g:(10-15)mL. The mixture was ultrasonically extracted for 1-5 hours under ice-water bath conditions with an ultrasonic power of 300-350W. The pH was adjusted with hydrochloric acid, the mixture was filtered, desalted with cation exchange resin, concentrated, and freeze-dried to obtain fenugreek fruit extract.

4. The composition containing recombinant humanized superoxide dismutase according to claim 1, characterized in that, The preparation method of the Rhodiola rosea extract includes the following steps: Mix Rhodiola rosea root powder with a 50%-70% ethanol aqueous solution (by volume), with a powder-to-ethanol aqueous solution ratio of 1g:(10-20)mL; heat under reflux at 70-80℃ for 4-8 hours, filter, extract twice, combine the filtrates, desalt with cation exchange resin, concentrate, and freeze dry to obtain Rhodiola rosea extract.

5. The composition containing recombinant humanized superoxide dismutase according to claim 1, characterized in that, The preparation method of the lentil fruit extract includes the following steps: Mix lentil powder with distilled water at a ratio of 1g:(20-30)mL, add a mixture of cellulase and pectinase, and keep at a constant temperature of 30-40℃ for 1-5h; heat and reflux at 80-100℃ for 1-3h, filter, add EDTA to the filtrate; ultrafilter, concentrate the retentate, and freeze dry to obtain lentil extract.

6. The composition containing recombinant humanized superoxide dismutase according to claim 5, characterized in that, The weight ratio of cellulase to pectinase is 1:(1-2), and the amount of the mixture of cellulase and pectinase added is 0.05%-1% of the weight of the lentil powder.

7. The composition containing recombinant humanized superoxide dismutase according to claim 5, characterized in that, The amount of EDTA added is 0.001%-0.01% of the weight of the lentil powder.

8. The method for preparing the composition containing recombinant humanized superoxide dismutase according to any one of claims 1-7, characterized in that: The components are mixed in the specified amounts to obtain the composition.

9. The use of the composition containing recombinant humanized superoxide dismutase according to any one of claims 1-7 in the preparation of cosmetics.

10. The application according to claim 9, characterized in that, The composition containing recombinant humanized superoxide dismutase is added to the cosmetic at an amount of 0.05%-20wt%.

Citation Information

Patent Citations

  • Superoxide dismutase composition and preparation method thereof

    CN113491663A

  • Moisturizing, whitening and skin care stock solution and preparation method thereof

    CN116098848A

  • Preparation method and application of antioxidant and anti-wrinkle rhodiolarosea L. extract

    CN106265342A

  • Anti-ageing composition

    CN107412316A

  • Cosmetic composition with anti-glycosylation and anti-aging effects and application thereof

    CN111329808A