TMV p126 protein-targeted dsRNA, water bacillus depletus engineering strain and application of TMV p126 protein-targeted dsRNA and water bacillus depletus engineering strain

By using the engineered strain Bi-dsP126 constructed from Bacillus subtilis KBD-6, efficient expression and translocation of dsRNA in plant roots were achieved, solving the problems of instability and low delivery efficiency of dsRNA in the natural environment, and significantly improving the control effect against tobacco mosaic virus.

CN121450657AActive Publication Date: 2026-02-03TOBACCO RESEARCH INSTITUTE OF CHINESE ACADEMY OF AGRICULTURAL SCIENCES (QINGZHOU TOBACCO RESEARCH INSTITUTE OF CHINA NATIONAL TOBACCO COMPANY)
View PDF 8 Cites 0 Cited by

Patent Information

Application Number
CN202610019024.4
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-01-08
Publication Date
2026-02-03
Estimated Expiration
2046-01-08

AI Technical Summary

Technical Problem

In existing technologies, chemically synthesized dsRNA is unstable in the natural environment, has low delivery efficiency, and is difficult to penetrate the cuticle of plant leaves. Conventional microbial vectors have insufficient colonization ability in the rhizosphere of non-host plants, resulting in poor dsRNA delivery and difficulty in achieving efficient control of tobacco mosaic virus.

Method used

Using Bacillus subtilis KBD-6 as the chassis strain, an engineered strain Bi-dsP126 was constructed. This strain was used to express and secrete dsRNA in situ in plant roots, which was then absorbed by the roots and transported through the vascular system to achieve whole-plant protection.

Benefits of technology

After 10 generations of continuous passage without antibiotic pressure, the engineered strain Bi-dsP126 still maintained a dsRNA yield and stability of up to 98%, significantly improving the control effect against tobacco mosaic virus to 95.40%, thus solving the bottleneck of low dsRNA delivery efficiency.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121450657A_ABST
    Figure CN121450657A_ABST
Patent Text Reader

Abstract

The invention relates to the technical field of microorganisms, in particular to dsRNA of a targeted TMV p126 protein, a water bacillus depletus engineering strain and application of the water bacillus depletus engineering strain. The coding sequence of the dsRNA is as shown in SEQ ID No. 1. The engineering strain Bi-dsP126 is constructed by taking the Bacillus pumilus KBD-6 with the preservation number of CGMCC (China General Microbiological Culture Collection Center) No.36724 as a host bacterium and introducing a recombinant vector containing the dsRNA expression cassette into the host bacterium. The engineering strain can be efficiently colonized at the root of tobacco and continuously and stably secretes dsRNA of targeted p126 protein, and the yield of the engineering strain is obviously higher than that of an engineering strain constructed by taking bacillus amyloliquefaciens, bacillus subtilis and the like as a chassis. After the dsRNA is applied in a root irrigation mode, the dsRNA can be absorbed by a root system and transferred to leaves through a vascular system, and the prevention and treatment effect on tobacco mosaic disease reaches 95% or above.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the field of microbial technology, and in particular to a dsRNA targeting TMV p126 protein, an engineered B. deserti strain and application thereof. BACKGROUND

[0002] Tobacco mosaic virus (TMV) is one of the most important pathogens that threaten global tobacco production, and its pathogenic mechanism is highly dependent on the p126 protein encoded by the virus. This protein is not only a key component of the viral replication complex, but also a potent RNA silencing suppressor that inhibits the plant's natural antiviral immune response, paving the way for successful infection and systemic spread of the virus. Currently, the prevention and control of TMV still mainly relies on chemical pesticides, but it faces many challenges such as pesticide residues, environmental pollution, and virus resistance, etc.

[0003] RNA interference (RNAi) technology, as a new green prevention and control method, can efficiently and accurately silence key viral genes by delivering sequence-specific dsRNA, thereby inhibiting viral replication. However, this technology has always been restricted by two major technical bottlenecks when moving from the laboratory to the field application: first, dsRNA synthesized in vitro is extremely unstable in the natural environment and is easily degraded by ultraviolet light and microbial nucleases, resulting in short duration and high cost. Second, traditional delivery methods such as foliar spraying have low efficiency, and dsRNA is difficult to penetrate the cuticle of plant leaves and cannot be efficiently transported systemically in the plant body to the site of active viral replication.

[0004] To overcome the stability and delivery efficiency problems of dsRNA, a method using root-colonizing microorganisms as in situ producers for in vivo expression and delivery of dsRNA has emerged. This method theoretically has dual advantages: the persistent colonization of microorganisms in the rhizosphere can provide a stable source of dsRNA for plants. dsRNA can be absorbed by the roots and transported upward through the vascular system, achieving whole-plant protection. However, the actual effectiveness of this method is highly dependent on the performance of the selected chassis microorganism.

[0005] Currently, research in this field is generally focused on using Bacillus amyloliquefaciens (B. amyloliquefaciens) as the chassis microorganism. Bacillus amyloliquefaciens Bacillus subtilis (B. subtilis) as the chassis microorganism. Bacillus subtilisA few model strains, such as [list of strains], were used as vectors. Extensive research and the inventors' previous experience have shown that these conventional strains have significant and inherent limitations as dsRNA delivery vectors: their ability to colonize the rhizosphere of non-host plants is often unsatisfactory, making it difficult to form a dominant bacterial community. Their underlying molecular mechanisms generally result in low expression yield and stability of exogenous dsRNA. These inherent defects directly lead to unstable and limited efficacy of engineered strains constructed from them, making it difficult to meet the threshold for commercial application and hindering the practical application of the promising idea of ​​microbial dsRNA delivery.

[0006] Therefore, those skilled in the art face a clear and unresolved technical challenge: finding and identifying a novel microbial vector that can efficiently colonize the rhizosphere of target plants and stably express target dsRNA at a high level is an inevitable choice and a core key to breaking through existing technical bottlenecks and achieving efficient and green control of plant viruses using dsRNA.

[0007] The information disclosed in this background section is only intended to enhance the understanding of the background technology of this application and should not be construed as an admission or in any way implying that the information constitutes prior art known to those skilled in the art. Summary of the Invention

[0008] To address the shortcomings of existing technologies, the inventors isolated a strain of *Bacillus subtilis* (…). Bacillus inaquosorum KBD-6 (accession number: CGMCC No. 36724). Unexpectedly, the inventors discovered that this Bacillus subtilis strain KBD-6 exhibits superior performance compared to other known Bacillus strains in terms of dsRNA expression in the chassis, providing a novel solution to overcome the bottlenecks in existing technologies.

[0009] The technical solution of this invention is as follows: On the one hand, the present invention provides a dsRNA targeting the TMV p126 protein, the coding sequence of which is shown in SEQ ID No. 1.

[0010] On the other hand, the above-mentioned dsRNA is used in the preparation of agents to prevent and control tobacco mosaic disease.

[0011] On the other hand, the present invention provides a recombinant expression vector comprising an expression cassette for expressing the above-mentioned dsRNA.

[0012] On the other hand, the recombinant expression vector is the L4440 plasmid, and the expression cassette contains a dual reverse T7 promoter.

[0013] On the other hand, the present invention provides an engineered strain of Bacillus aqueductus, which contains the above-mentioned recombinant expression vector and is capable of expressing the above-mentioned dsRNA.

[0014] On the other hand, the engineered strain is classified as Bacillus inaquosorum Bi-dsP126 and was deposited at the China General Microbiological Culture Collection Center on December 4, 2025, with accession number CGMCC No. 36887.

[0015] On the other hand, the engineered strain is *Bacillus silicosis* with accession number CGMCC No. 36724. Bacillus inaquosorum KBD-6 was used as the host bacterium, and the recombinant expression vector was introduced into it. *Bacillus leucosus* KBD-6 was deposited on November 21, 2025, at the China General Microbiological Culture Collection Center (CGMCC), with accession number CGMCC No. 36724.

[0016] On the other hand, the present invention provides a microbial preparation for controlling tobacco mosaic disease, the preparation comprising the above-mentioned engineered strain of *Bacillus silicosis* and an agriculturally acceptable carrier, wherein the viable concentration of the engineered strain is 10. 5 ~10 9 cfu / mL.

[0017] On the other hand, the present invention provides a method for preventing and controlling tobacco mosaic disease, the method comprising applying an effective amount of the above-mentioned engineered strain of *Bacillus silenstilae* or the above-mentioned microbial preparation to tobacco.

[0018] On the other hand, the application method is root irrigation, with 20-50 mL of bacterial suspension applied to each tobacco plant, once every 7 days, for a total of 2-3 applications.

[0019] The beneficial effects achieved by this invention are as follows: 1. This invention utilizes the engineered strain Bi-dsP126 to express and secrete dsRNA in situ in plant roots. This method completely avoids the problem of easily degraded dsRNA synthesized in vitro in the environment. Experimental data shows that the dsRNA yield of the engineered strain Bi-dsP126 is as high as 3120 μg / mL, and after 10 consecutive passages without antibiotic stress, the yield stability remains above 98%. This high yield and high stability ensure a continuous and sufficient supply of dsRNA throughout the entire susceptible period of the plant, fundamentally solving the problem of short-lasting efficacy. 2. The substrate bacterium used in this invention—Bacillus siltatifolius KBD-6—has excellent ability to colonize tobacco roots (colonization density reaches 1.2 × 10⁻⁶).8 The cfu / g concentration was significantly higher than that of other control strains. This lays a solid foundation for the local production and efficient delivery of dsRNA. After the engineered strain of this invention has been stably colonized in the rhizosphere, it can continuously release dsRNA into the rhizosphere. Utilizing the plant root system for absorption and the vascular system, the dsRNA is efficiently and systematically transported to virus-infected sites such as leaves, achieving the effect of root administration and systemic protection, overcoming the bottleneck of low delivery efficiency in foliar spraying. 3. This invention utilizes the unexpectedly superior performance of *Bacillus aqueductus* as a dsRNA delivery vector. Comparative experiments fully demonstrate that the engineered strain Bi-dsP126 constructed using it achieves a control effect of up to 95.40% against tobacco mosaic virus. This control effect is significantly superior to that of engineered strains constructed using conventionally used *Bacillus amyloliquefaciens* and *Bacillus subtilis* as substrates, with an improvement of 20-40 percentage points. Attached Figure Description

[0020] Figure 1 This is a morphological diagram of Bacillus subtilis KBD-6.

[0021] Figure 2 This is a graph showing the efficacy of biocontrol bacteria against TMV; where a: Bacillus aqueductus KBD-6; b: Bacillus amyloliquefaciens; c: Bacillus subtilis; d: Bacillus brevis; e: Bacillus belye; f: blank control.

[0022] Figure 3 This is a graph showing the quality detection of dsRNA extraction from different engineered strains; where M: DNA marker; 1: Bi-dsP126; 2: Bacillus amyloliquefaciens engineered strain; 3: Bacillus subtilis engineered strain; 4: Bacillus brevis engineered strain; 5: Bacillus belyss engineered strain; 500 bp indicator dsRNA band.

[0023] Figure 4 The half-leaf necrotic spot method was used to detect the activity of dsRNA on TMV; the left half-leaf was dsRNA treated and the right half-leaf was the control.

[0024] Figure 5 The graphs show the efficacy of different engineered strains against TMV; where a: Bi-dsP126; b: Bacillus amyloliquefaciens engineered strain; c: Bacillus subtilis engineered strain; d: Bacillus brevis engineered strain; e: Bacillus belyss engineered strain; f: blank control. Detailed Implementation

[0025] The technical solutions in the embodiments of the present invention will be clearly and completely described below in conjunction with the content of the embodiments of the present invention.

[0026] In this invention, unless otherwise specified, the equipment and raw materials used are commercially available or commonly used in the art. The methods in the following embodiments, unless otherwise specified, are conventional methods in the art. Unless otherwise defined, all technical and scientific terms used in this specification have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains.

[0027] In the following examples, the engineered strain of Bacillus aqueductus malariae, Bi-dsP126, may be simply referred to as "engineered strain Bi-dsP126" or "Bi-dsP126".

[0028] Example 1: Screening of biocontrol bacteria and identification of Bacillus subtilis KBD-6 1.1 Strain screening: Rhizosphere soil samples were collected from tobacco rhizosphere areas in Baoshan, Yunnan Province, at a depth of 20 cm. Three replicates were collected from each sampling point, and the samples were mixed and passed through a 2 mm sieve. The samples were then plated on LB agar plates using a serial dilution method and incubated at 37°C for 24 h. Single colonies with different morphologies were picked, purified, and stored in 20% glycerol. Five biocontrol bacteria were isolated: *Bacillus amyloliquefaciens*, *Bacillus subtilis*, *Bacillus brevicaulis*, *Bacillus leucosus*, and *Bacillus belesiensis*.

[0029] After transplanting tobacco seedlings (4-leaf stage), drench each seedling with 10 ml of water at the root. 7 15 mL of CFU / mL bacterial suspension was prepared, and root tissue (0.5 g) was collected after 30 days. The tissue was washed three times with sterile water, ground, serially diluted, and plated on LB agar plates for counting. The root colonization of the five wild-type biocontrol bacteria is shown in Table 1.

[0030] Table 1. Statistics on root colonization of five wild-type biocontrol fungi

[0031] As shown in Table 1, the highest colonization density of *Bacillus subtilis* KBD-6 was 1.2 × 10⁻⁶. 7 The cfu / g concentration was significantly higher than that of the other four strains. p <0.05).

[0032] 1.2 Identification of Bacillus subtilis KBD-6: 16S rDNA sequencing comparison showed that it was similar to *Bacillus silicifica* (…). Bacillus inaquosorum Homology reached 99%; morphological observation revealed Gram-negative short bacilli, with pale yellow-white colonies and smooth edges, such as... Figure 1 As shown.

[0033] 1.3 Comparison of initial protective effects: The TMV control efficacy of five strains was determined by root drenching each wild-type tobacco seedling (4-leaf stage). 715 mL of cfu / mL wild-type bacterial suspension was applied in triplicate. TMV was inoculated by friction 24 h after the last root drench. Disease index was assessed 7 days later.

[0034] Disease index = Σ(number of diseased plants × disease level value) / (total number of plants × highest disease level value) × 100.

[0035] Table 2. Control efficacy of five wild-type biocontrol bacteria against TMV.

[0036] The results are shown in Table 2 and Figure 2 As shown, the control efficacy of Bacillus subtilis KBD-6 was the best at 69%, significantly higher than other strains. p <0.05, Table 2, Figure 2 Therefore, Bacillus subtilis KBD-6 was selected as the substrate bacteria.

[0037] Example 2: Design and Synthesis of dsRNA The p126 protein, which is closely related to TMV replication, was selected as the target gene. A 500 nt conserved and specific sequence fragment was selected as the target sequence (SEQ ID No. 1). Primers containing the T7 promoter were designed (SEQ ID No. 2-3). The results were verified by the online BLAST program (http: / / www.ncbi.nlm.nih.gov / blast / ) and showed no homology with the tobacco genome.

[0038] TMV p126 protein target sequence (SEQ ID No. 1): ACCTGCTTCTTGAAGATTCATACGTCAATCTGGACGAAATCAACGCGTGTTTTTCGCGCGATGGAGACAAGTTGACCTTTTCTTTTGCATCAGAGAGTACTCTTAATTACTGTCATAGTTATTCTAATATTCTTAAGTATGGTGTGCAAAACTTACTTCCCGGCCTCTAATAGAGAGGTTTACATGAAGGAGTTTTTAGTCACCAGGGTTAATACCTGGTTTTGTAAGTTTTTCTAGAATAGATACTTTTCT TTTGTACAAAGGTGTGGCCCATAAAGGTGTAGATAGTGAGCAGTTTTATACTGCAATGGAAGACGCATGGCATTACAAAAAGACTCTTGCAATGTGCAACAGCGAGAGAATCCTCCTTGAGGATTCATCAACAGTCAATTACTGGTTTCCCGAAATGAGGGATATGGTCATCGTACCATTATTCGACATTTCTTTGGAGACTAGTAAGAGGACGCGCAAGGAAGTCTTAGTGTCCAAGGATTTCGTGTTT p126-dsRNA-F: GGAGACCGGCAGATCTACCTGCTTCTTGAAGATTCATACG p126-dsRNA-R: TATAGGGCGAATTGGGTACCAAACACGAAATCCTTGGACAC Example 3: Construction of engineered strain Bi-dsP126 The dsRNA fragment targeting the p126 protein was amplified by PCR, and then... Eco R Ⅰ and Xho I. The L4440 plasmid was double-digested with enzymes, ligated overnight at 16°C using T4 DNA ligase, and transformed into *E. coli* DH5α. Positive clones were screened on ampicillin (100 μg / mL) plates, and sequencing confirmed the correct construction of the recombinant plasmid L4440-dsP126. The recombinant plasmid was then introduced into competent cells of five biocontrol bacteria (1.8 kV electrophoresis), plated on LB agar plates containing ampicillin (100 μg / mL), and transformants were picked after 48 h.

[0039] PCR verification successfully obtained engineered strains, and dsRNA was extracted to verify their synthetic ability. Figure 3As shown, the engineered strain of Bacillus subtilis is named Bi-dsP126.

[0040] Example 4: Detection of dsRNA Expression and Activity 4.1 dsRNA yield detection 4.1.1 Cultivation and Induction Take 30 μL of Bi-dsP126 bacterial culture, inoculate it with 15 mL of LB liquid medium containing ampicillin (100 μg / mL), and incubate at 37℃ and 200 rpm for 8 h. Add IPTG (50 mg / mL) and continue incubation for 4 h.

[0041] 4.1.2 Extraction and Quantification Collect bacterial cells by centrifugation at 8000 rpm for 10 min. Add 800 μL of 2×STE, 400 μL of DNA lysis buffer (phenol:chloroform:isopropanol = 25:24:1), and 183 μL of 10% SDS. Shake at room temperature for 10 min, then sonicate for 20 min (300W, 3 s working time, 5 s interval). Centrifuge at 12000 g for 10 min at 4℃. Take the supernatant, add 0.05 g of cellulose powder and 152 μL of anhydrous ethanol, then top up with 17% ethanol STE. Incubate on ice for 10 min, then centrifuge at 12000 g for 5 min at 4℃. Discard the supernatant, wash twice with 17% ethanol STE, dissolve in 650 μL of 1×STE, precipitate with isopropanol, wash with 75% ethanol, dissolve in RNase-free water, and quantify with Nanodrop.

[0042] Table 3. Detection of dsRNA yield in engineered strains

[0043] The results are shown in Table 3. The dsRNA yield of the engineered strain Bi-dsP126 reached 3120 μg / mL, which was significantly higher than that of other engineered strains.

[0044] 4.2 dsRNA stability assay After 10 generations of continuous culture without antibiotic stress, Bi-dsP126 maintained a dsRNA yield of 3060 μg / mL, with a stability of over 98%, as shown in Table 4. Other strains, such as the engineered Bacillus belyss, showed a yield decrease to 800 μg / mL after 10 generations, with a stability of only 62%.

[0045] Table 4. Stability detection of dsRNA in engineered strains

[0046] Stability = (10th generation output / initial output) × 100% 4.3. dsRNA activity detection The half-leaf necrotic spot method was used for the experiment. Four- to five-leaf stage tobacco plants with good growth were selected as hosts. The top two leaves of each plant were treated. The left half of the leaf was coated with a mixture of 10 mL dsRNA (1000 μg / mL) and an equal volume of TMV extract (TMV-infected tobacco leaves were frozen, ground into powder, and then mixed with deionized water at a ratio of 1:40 and filtered through gauze). The right half of the leaf was coated with a mixture of 10 mL LB medium and an equal volume of TMV extract (control). The experiment was repeated three times, and the number of necrotic spots was counted after 3-5 days.

[0047] Necrosis inhibition rate = (Number of necrotic spots in control half-leaf - Number of necrotic spots in treatment half-leaf) / Number of necrotic spots in control half-leaf × 100%.

[0048] Table 5. Inactivation effect of dsRNA on TMV

[0049] The results are shown in Table 5 and Figure 4 The results showed that the number of half-leaf necrotic spots in the treatment group was 7.63±1.25, while that in the control group was 230.15±15.32, and the necrotic spot inhibition rate reached 96.68%±1.52%, indicating that dsRNA has a highly efficient inactivation activity against TMV.

[0050] Example 5: Verification of the control effect of engineered strain Bi-dsP126 Pot experiment: Tobacco seedlings of uniform growth (4-leaf stage) were selected and 6 treatments were set up: ① Bi-dsP126 bacterial suspension root irrigation; ② Bacillus amyloliquefaciens engineered strain root irrigation; ③ Bacillus subtilis engineered strain root irrigation; ④ Bacillus lateralis engineered strain root irrigation; ⑤ Bacillus belyssus root irrigation; ⑥ Blank control (LB medium root irrigation). The bacterial suspension concentration was 10. 8 The concentration of cfu / mL was 30 mL per plant, with an interval of 7 days, for a total of 3 root drenches. TMV was inoculated 24 hours after the last root drenching. The incidence rate and disease index were investigated 7 days later, and the relative control efficacy was calculated.

[0051] Relative efficacy = (Control disease index - Treatment disease index) / Control disease index × 100%.

[0052] Table 6. Control effects of different treatments on tobacco mosaic virus

[0053] The results are shown in Table 6 and Figure 5As shown, the engineered strain Bi-dsP126 achieved a control effect of 95.40% against tobacco mosaic virus, which is significantly higher than other engineered strains, indicating that Bacillus silensii has an irreplaceable advantage as a chassis bacterium.

[0054] The embodiments of the present invention described above do not constitute a limitation on the scope of protection of the present invention. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention should be included within the scope of protection of the claims of the present invention.

Claims

1. A dsRNA targeting the TMV p126 protein, characterized in that: Its encoded sequence is shown in SEQ ID No.

1.

2. The application of the dsRNA according to claim 1 in the preparation of formulations for the prevention and control of tobacco mosaic disease.

3. A recombinant expression vector, characterized in that: The recombinant expression vector contains an expression cassette for expressing the dsRNA of claim 1.

4. The recombinant expression vector according to claim 3, characterized in that: The recombinant expression vector is the L4440 plasmid, and the expression cassette contains a dual inverse T7 promoter.

5. An engineered strain of *Bacillus subtilis*, characterized by: The engineered strain contains the recombinant expression vector as described in claim 3 or 4, and is capable of expressing dsRNA with a coding sequence as shown in SEQ ID No.

1.

6. The engineered strain of *Bacillus subtilis* according to claim 5, characterized in that: The engineered strain was classified as Bacillus inaquosorum Bi-dsP126 and was deposited at the China General Microbiological Culture Collection Center on December 4, 2025, with accession number CGMCC No. 36887.

7. The engineered strain of *Bacillus subtilis* according to claim 6, characterized in that: The engineered strain was obtained by introducing the recombinant expression vector into Bacillus aqueductus malariae KBD-6, which has the preservation number CGMCC No.36724.

8. A microbial preparation for controlling tobacco mosaic disease, characterized in that: The formulation comprises the engineered strain of Bacillus aqueductus as described in any one of claims 5-7 and an agriculturally acceptable vector, wherein the viable concentration of the engineered strain is 10⁶ to 10⁹ cfu / mL.

9. A method for preventing and controlling tobacco mosaic disease, characterized in that: The method includes applying an effective amount of the engineered strain of *Bacillus silicosis* as described in any one of claims 5-7 to tobacco.

10. The method according to claim 9, characterized in that: The application method for tobacco is root irrigation. Apply 20-50 mL of bacterial suspension to each tobacco plant, once every 7 days, for a total of 2-3 applications.

Citation Information

Patent Citations

  • RNAi nano preparation and preparation method and application thereof in prevention and treatment of TMV

    CN111513077A

  • Tobacco mosaic virus double-site mutation attenuated vaccine and application thereof

    CN116064412A

  • Fish intestinal composite probiotic agent and application thereof in growth promotion and bacterial disease prevention and control

    CN116536211A

  • Nano preparation for resisting tobacco mosaic virus and preparation method thereof

    CN118308352A

  • Broad-spectrum biocontrol bacterial strain barren water bacillus ZG18 and application of broad-spectrum biocontrol bacterial strain barren water bacillus ZG18

    CN120158390A