Light-controlled yeast two-hybrid system as well as establishment method and application thereof

Abstract

The invention belongs to the technical field of gene engineering, and particularly relates to a light-controlled yeast two-hybrid system as well as an establishment method and application thereof. The light-controlled yeast two-hybrid system is obtained by integrating a phycocyanobilin synthesis module into a yeast strain containing a reporter gene and then transferring into a phytochrome A-LexA fusion expression vector and an AD-FHY1 fusion expression vector. The light-controlled yeast two-hybrid system provided by the invention well overcomes the defects that the existing light-controlled yeast two-hybrid system needs exogenous application of phycocyanobilin, the operation is more complex and the cost is higher, and does not cause that the phytochrome apoprotein expressed in yeast cells cannot realize conversion of two conformational forms of Pfr / Pr; and finally, the difference between the interaction intensity of the phytochrome in two conformational forms and the FHY1 signal protein cannot be distinguished.

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering technology, specifically relating to a light-controlled yeast two-hybrid system, its establishment method, and its application. Background Technology

[0002] Phytochromes perceive and initiate light signals through conformational changes and the interaction between different conformations and signal components. Phytochromes achieve conformational changes through the covalent binding of their PAS domain to a tetrapyrrole chromophore. Two main conformations exist: red-absorbing and far-red-absorbing. Newly synthesized phytochromes in the cytoplasm or those exposed to prolonged darkness primarily exist in the red-absorbing form. Red light irradiation causes a transition from the red-absorbing to the far-red-absorbing form, and vice versa. The far-red-absorbing form is considered more active and more readily interacts with signal components. Therefore, exploring the interactions between different conformations of phytochromes and signal components is crucial for understanding red and far-red light signal transduction in plants.

[0003] Yeast two-hybrid technology is a commonly used technique for verifying protein-protein interactions. The yeast two-hybrid system mainly consists of three components: a reporter gene, a BD fusion protein expression vector, and an AD fusion protein expression vector. The reporter gene includes... LacZ , MEL1 , Ade and His The BD fusion protein acts as a "bait" binding to the reporter gene promoter, while the AD fusion protein acts as the "prey," possessing transcriptional activation activity. When the interaction between the BD and AD fusion proteins is detected, the spatial distance between them is reduced, thereby activating reporter gene expression. The yeast two-hybrid system exhibits high stability and reproducibility. Therefore, yeast two-hybrid technology is commonly used in investigating the interaction between phytochromes and signal components. However, because phytochromes undergo conformational changes under light regulation, and yeast itself cannot produce chromophores to help phytochromes perceive light.

[0004] Currently, two main systems exist: GAL4 and LexA-based systems, used to detect the interaction between phytochromes and specific proteins in different conformations. Both systems require the additional application of a phycocyanin chromophore. When using these systems to investigate the interaction between phytochromes and signal components, the exogenously applied phycocyanin chromophore covalently binds to the phytochrome-BD fusion protein expressed in yeast. Applying red or far-red light to the yeast at this point causes a conformational change in phytochrome-BD, thereby affecting its interaction with the AD fusion protein and ultimately influencing reporter gene expression. This allows for the determination of the difference in interaction strength between the red-absorbing and far-red-absorbing forms of phytochrome and signal components.

[0005] Currently, existing light-controlled yeast two-hybrid systems require exogenous application of phycocyanin. However, phycocyanin is difficult to extract and expensive, which prevents the apoproteins of phytochromes expressed in yeast cells from achieving the conversion between the Pfr and Pr conformations. Ultimately, this makes it impossible to distinguish the difference in interaction strength between the two conformations of phytochromes and the FHY1 signaling component protein. Therefore, new strategies are needed to address these issues. Summary of the Invention

[0006] To overcome the problem that existing light-controlled yeast two-hybrid systems require exogenous application of phycocyanin, which is difficult and expensive to extract, and leads to the inability of the apoprotein of phytochrome expressed in yeast cells to achieve the conversion between the Pfr and Pr conformations, ultimately failing to distinguish the difference in interaction strength between the two conformations of phytochrome and the FHY1 signaling component protein, this invention provides a light-controlled yeast two-hybrid system, its establishment method, and its applications. To achieve the above objectives, this invention adopts the following technical solution.

[0007] The technical solution adopted by the present invention to solve its technical problem is as follows.

[0008] One objective of this invention is to provide a light-controlled yeast two-hybrid system, which is a light-controlled yeast two-hybrid system based on the endogenous synthesis of phycocyanin. The light-controlled yeast two-hybrid system is obtained by integrating a phycocyanin synthesis module into a yeast strain containing a reporter gene, and then transforming it into a phytochrome A-LexA fusion expression vector and an AD-FHY1 fusion expression vector.

[0009] The phycocyanin synthesis module is composed of PcyA - P2A - HO1 - P2A - FD - P2A - FNR - PolyA The gene sequence string and nucleotide sequence are as shown in SEQ ID NO.20. TEF1 promoter- MCS - PGK1 It is formed by terminating the connection of submodules.

[0010] The photopigment A-LexA fusion expression vector contains the coding sequence of the photopigment protein as shown in SEQ ID NO.15, SEQ ID NO.17 and / or SEQ ID NO.18.

[0011] The AD-FHY1 fusion expression vector contains the coding sequence of the plant FHY1 protein, as shown in SEQ ID NO.16 and / or SEQ ID NO.19.

[0012] The reporter gene in the yeast strain containing the reporter gene is: LacZ Reporter genes, the LacZ The nucleotide sequence of the reporter gene is shown in SEQ ID NO.21.

[0013] The light-controlled yeast two-hybrid system provided by this invention is a light-controlled yeast two-hybrid system based on the endogenous synthesis of phycocyanin. It is obtained by integrating a phycocyanin synthesis module into a yeast strain containing a reporter gene, and then transforming it into a phytochrome A-LexA fusion expression vector and an AD-FHY1 fusion expression vector. The phycocyanin synthesis module is derived from... PcyA - P2A - HO1 - P2A - FD - P2A - FNR - PolyA The gene sequence string and nucleotide sequence are as shown in SEQ ID NO.20. TEF1 promoter- MCS - PGK1 The terminator submodule is used to connect the vectors. The phytochrome A-LexA fusion expression vector contains the coding sequence of the phytochrome protein as shown in SEQ ID NO.15, SEQ ID NO.17, and / or SEQ ID NO.18. The AD-FHY1 fusion expression vector contains the coding sequence of the plant FHY1 protein as shown in SEQ ID NO.16 and / or SEQ ID NO.19. The reporter gene in the yeast strain containing the reporter gene is... LacZ Reporter genes, the LacZ The nucleotide sequence of the reporter gene is shown in SEQ ID NO.21. This light-controlled yeast two-hybrid system achieves the biosynthesis of phycocyanin in yeast cells by modifying the endogenous metabolic pathway. Using this system, the interaction between phycocyanin and signaling components under light regulation was investigated. No exogenous application of phycocyanin was required; the phycocyanin protein expressed in yeast could directly sense changes in red / far-red light and achieve conformational transitions. This system effectively solves the drawbacks of existing light-controlled yeast two-hybrid systems, which require exogenous application of phycocyanin, are more complex, and more expensive. Furthermore, it avoids the problem that the apoprotein of the phycocyanin expressed in yeast cells cannot achieve the conversion between the Pfr and Pr conformations, ultimately failing to distinguish the difference in interaction strength between the two conformations of the phycocyanin and the FHY1 signaling protein.

[0014] Meanwhile, the light-controlled yeast two-hybrid system provided by the present invention also has the characteristics of high efficiency, economy, convenient operation and high sensitivity.

[0015] Preferably, the yeast strain containing the reporter gene is obtained by introducing the reporter gene into Saccharomyces cerevisiae EGY48. LacZ The strain formed after the reporter gene.

[0016] A second objective of this invention is to provide a method for establishing the light-controlled yeast two-hybrid system, comprising the following steps: (1) Constructing a phycocyanin synthesis module: The above PcyA - P2A - HO1 - P2A - FD - P2A - FNR - PolyA Gene sequence string cloning, and with the TEF1 promoter - MCS - PGK1 The submodule connection is terminated to form the phycocyanin synthesis module.

[0017] (2) Constructing the pLexA-JL vector: The pLexA vector contains... LexA The gene coding sequence was moved from the N-terminal region of the multiple cloning site to the C-terminal region, resulting in the pLexA-JL vector. Wherein, the... LexA The nucleotide sequence of the gene coding sequence is shown in SEQ ID NO. 23.

[0018] (3) Construction of phytochrome A-LexA fusion expression vector: The coding sequence of the phytochrome protein is cloned and ligated into the pLexA-JL vector to form the phytochrome A-LexA fusion expression vector. The nucleotide sequence of the coding sequence of the phytochrome protein is shown in SEQ ID NO.15, SEQ ID NO.17 and / or SEQ ID NO.18.

[0019] In one embodiment of the present invention, the photochromic protein is Arabidopsis thaliana photochromic A protein, the nucleotide sequence of which is shown in SEQ ID NO.15; the coding sequence of Arabidopsis thaliana photochromic A protein is linked to... ADH1 promoter- MCS - LexA - ADH1 The submodule is terminated to obtain the phytochrome A-LexA recombinant vector. In another embodiment of the present invention, the phytochrome protein is maize phytochrome A protein, which includes maize phytochrome A1 protein and maize phytochrome A2 protein. The nucleotide sequence of the coding sequence of the maize phytochrome A1 protein is shown in SEQ ID NO.17, and the nucleotide sequence of the coding sequence of the maize phytochrome A2 protein is shown in SEQ ID NO.18. The coding sequence of the maize phytochrome A1 protein is ligated to... ADH1 promoter- MCS - LexA - ADH1The submodule was terminated, yielding the maize phytochrome A1-LexA vector. The coding sequence of the maize phytochrome A2 protein was then ligated to... ADH1 promoter- MCS - LexA - ADH1 The submodule was terminated to obtain the maize phytochrome A2-LexA carrier.

[0020] (4) Construction of AD-FHY1 fusion expression vector: The coding sequence of plant FHY1 protein is cloned and ligated into the C-terminal region of the AD fusion protein expression vector to form the AD-FHY1 fusion expression vector. The AD fusion protein expression vector is a pB42AD vector. The nucleotide sequence of the coding sequence of the plant FHY1 protein is shown in SEQ ID NO.16 and / or SEQ ID NO.19.

[0021] In one embodiment of the present invention, the plant FHY1 protein is Arabidopsis thaliana FHY1 protein. The coding sequence of Arabidopsis thaliana FHY1 protein is cloned and ligated to the C-terminal region of the AD fusion protein expression vector pB42AD to obtain the AD-FHY1 recombinant vector; wherein the nucleotide sequence of the coding sequence of Arabidopsis thaliana FHY1 protein is shown in SEQ ID NO.16. In another embodiment of the present invention, the coding sequence of maize FHY1.3 protein is ligated to the pB42AD vector to obtain the AD-maize FHY1 recombinant vector; wherein the nucleotide sequence of the coding sequence of maize FHY1.3 protein is shown in SEQ ID NO.19.

[0022] (5) Construction of EGY48-PBM strain: The phycocyanin synthesis module was transferred into the yeast strain EGY48-Y2H containing the reporter gene to form EGY48-PBM strain.

[0023] (6) Constructing a strain co-expressing phytochrome A-LexA and AD-FHY1: Using the PEG / lithium acetate method, the phytochrome A-LexA fusion expression vector and the AD-FHY1 fusion expression vector were co-transformed into the EGY48-PBM strain to obtain a strain co-expressing phytochrome A-LexA and AD-FHY1, thus forming the light-controlled yeast two-hybrid system.

[0024] In one embodiment of the present invention, the phytochrome A-LexA recombinant vector and the AD-FHY1 recombinant vector are co-transformed into the EGY48-PBM strain using the PEG / lithium acetate method to obtain strain AD-FHY1+phytochrome A-LexA. In another embodiment of the present invention, the corn phytochrome A1-LexA vector and the AD-corn FHY1 recombinant vector are co-transformed into the EGY48-PBM strain to obtain strain corn FHY1.3+corn phytochrome A1-LexA; the corn phytochrome A2-LexA vector and the AD-corn FHY1 recombinant vector are co-transformed into the EGY48-PBM strain to obtain strain corn FHY1.3+corn phytochrome A2-LexA.

[0025] Preferably, the yeast strain EGY48-Y2H containing the reporter gene is a strain formed by transferring the reporter gene vector p8op-LacZ into Saccharomyces cerevisiae EGY48.

[0026] A third objective of this invention is to provide the application of the light-controlled yeast two-hybrid system in detecting the interaction between phytochromes and signaling molecules. Specifically, controlling the conformation of the phytochrome-LexA fusion protein expressed endogenously in yeast through light refers to driving the phytochrome to switch between Pfr and Pr conformations through red and / or far-red light treatment, thereby detecting the interaction between the phytochrome and other signaling molecules.

[0027] Preferably, the phytochrome A-LexA fusion expression vector and the AD-FHY1 fusion expression vector are co-transformed into a vector carrying a auxotrophic marker named Ura. - Leu - Trp - His - In the EGY48-PBM strain, a positive transformant capable of autonomously synthesizing uracil, leucine, tryptophan and histidine on a selective medium that does not contain uracil, leucine, tryptophan and histidine was obtained, namely the photochromin-FHY1 positive transformant.

[0028] The photosensitive pigment-FHY1 positive transformants were divided into two groups, and red light treatment and red light + far-red light treatment were performed on the other two groups respectively.

[0029] Under the conditions of red light processing and red light + far-red light processing, by detecting the... LacZ The expression levels of reporter genes were quantitatively analyzed to determine the strength of the interaction between phytochrome and FHY1 under two conditions.

[0030] Preferably, the LacZ The expression level of the reporter gene was determined by the liquid ONPG method and expressed as described above.LacZ The Miller Unit, representing the activity unit of the reporter gene expression product β-galactosidase, is used to quantitatively compare the differences in the interaction between phytochrome A and FHY1 under red light treatment and red light + far-red light conditions.

[0031] Preferably, the conditions for the red light treatment are a light intensity of 50 μmol / m² / s and a treatment temperature of 30°C for 5 min.

[0032] Preferably, the conditions for the red light + far-red light treatment are: red light intensity 50 μmol / m² / s, treated at 30℃ for 5 min, then switched to far-red light intensity 50 μmol / m² / s, and treated at 30℃ for 5 min.

[0033] Compared with the prior art, the present invention has the following beneficial effects: 1. This invention provides a light-controlled yeast two-hybrid system. The light-controlled yeast two-hybrid system provided by this invention is a light-controlled yeast two-hybrid system based on the endogenous synthesis of phycocyanin. It is obtained by integrating a phycocyanin synthesis module into a yeast strain containing a reporter gene, and then transforming it into a phytochrome A-LexA fusion expression vector and an AD-FHY1 fusion expression vector. The phycocyanin synthesis module is derived from… PcyA - P2A - HO1 - P2A - FD - P2A - FNR - PolyA The gene sequence string and nucleotide sequence are as shown in SEQ ID NO.20. TEF1 promoter- MCS - PGK1 The terminator submodule is used to connect the vectors. The phytochrome A-LexA fusion expression vector contains the coding sequence of the phytochrome protein as shown in SEQ ID NO.15, SEQ ID NO.17, and / or SEQ ID NO.18. The AD-FHY1 fusion expression vector contains the coding sequence of the plant FHY1 protein as shown in SEQ ID NO.16 and / or SEQ ID NO.19. The reporter gene in the yeast strain containing the reporter gene is... LacZ Reporter genes, the LacZ The nucleotide sequence of the reporter gene is shown in SEQ ID NO.21. This light-controlled yeast two-hybrid system achieves the biosynthesis of phycocyanin in yeast cells by modifying the endogenous metabolic pathway. Using this system, the interaction between phycocyanin and signaling components under light regulation was investigated. No exogenous application of phycocyanin was required; the phycocyanin protein expressed in yeast could directly sense changes in red / far-red light and achieve conformational transitions. This system effectively solves the shortcomings of existing light-controlled yeast two-hybrid systems, which require exogenous application of phycocyanin, are more complex to operate, and are more expensive. Furthermore, it avoids the problem that the apoprotein of the phycocyanin expressed in yeast cells cannot achieve the conversion between the Pfr and Pr conformations, ultimately failing to distinguish the difference in interaction strength between the two conformations of the phycocyanin and FHY1.

[0034] 2. The light-controlled yeast two-hybrid system provided by this invention is a light-controlled yeast two-hybrid system based on the endogenous synthesis of phycocyanin. This invention provides an endogenous phycocyanin synthesis module for yeast cells, which can synthesize phycocyanin chromophores endogenously in yeast cells without the need for exogenous application of phycocyanin, reducing experimental procedures and costs. The light-controlled yeast two-hybrid system including the PBM module has high sensitivity, high reproducibility, and low background response. Furthermore, this invention provides two reporter gene detection methods, which can both qualitatively confirm protein interactions and quantitatively determine the strength of protein interactions. Attached Figure Description

[0035] Figure 1 In this invention TEF1 promoter - MCS - PGK1 A diagram illustrating the termination of a submodule.

[0036] Figure 2 In this invention ADH1 promoter- MCS - LexA - ADH1 A diagram illustrating the termination of a submodule.

[0037] Figure 3 This is a schematic diagram of the phycocyanin synthesis module in this invention.

[0038] Figure 4 This invention demonstrates the application of the light-controlled yeast two-hybrid system based on endogenous synthesis of phycocyanin to the detection results of the interaction between phytochrome A and FHY1 in Arabidopsis thaliana; wherein, Figure 4 Figure A in the diagram represents red light processing, where A1 is AD+LexA, A2 is AD-FHY1+LexA, A3 is AD+photochromic pigment A-LexA, and A4 is AD-FHY1+photochromic pigment A-LexA. Figure 4 Figure B in the diagram represents far-red light treatment, where B1 is AD+LexA, B2 is AD-FHY1+LexA, B3 is AD+photosensitive pigment A-LexA, and B4 is AD-FHY1+photosensitive pigment-LexA. Among these, AD+LexA corresponds to strain I, AD+photosensitive pigment A-LexA corresponds to strain II, AD-FHY1+LexA corresponds to strain III, and AD-FHY1+photosensitive pigment A-LexA corresponds to strain IV.

[0039] Figure 5 This invention presents the results of quantitative detection of the interaction intensity between the light-controlled yeast two-hybrid system based on endogenous synthesis of phycocyanin in Arabidopsis thaliana. Here, "red light" refers to red light treatment for 5 minutes, abbreviated as R; "red light + far-red light" refers to red light treatment for 5 minutes + far-red light treatment for 5 minutes, abbreviated as R+FR.

[0040] Figure 6 This invention presents the results of applying the light-controlled yeast two-hybrid system based on endogenous synthesis of phycocyanin to the detection of the interaction between maize phytochrome A1 / 2 and maize FHY1.3; wherein, Figure 6 Figure A in the diagram represents red light processing. A1 represents AD + LexA; A2 represents AD + maize phytochrome A1-LexA; A3 represents AD + maize phytochrome A2-LexA; A4 represents AD - maize FHY1.3 + LexA; A5 represents maize FHY1.3 + maize phytochrome A1-LexA; and A6 represents maize FHY1.3 + maize phytochrome A2-LexA. Figure 6 Figure B in the diagram represents far-red light treatment. B1 represents AD+LexA; B2 represents AD+maize phytochrome A1-LexA; B3 represents AD+maize phytochrome A2-LexA; B4 represents maize FHY1.3+LexA; B5 represents maize FHY1.3+maize phytochrome A1-LexA; and B6 represents maize FHY1.3+maize phytochrome A2-LexA. AD+LexA corresponds to strain I; AD+maize phytochrome A1-LexA corresponds to strain V; AD+maize phytochrome A2-LexA corresponds to strain VI; AD-maize FHY1.3+LexA corresponds to strain VII; maize FHY1.3+maize phytochrome A1-LexA corresponds to strain VIII; and maize FHY1.3+maize phytochrome A2-LexA corresponds to strain IX.

[0041] Figure 7 This invention presents the results of quantitative detection of the interaction intensity between maize phycocyanin A1 / 2 and maize FHY1.3 using the light-controlled yeast two-hybrid system based on endogenous synthesis of phycocyanin. Here, "red light" refers to 5 minutes of red light treatment, abbreviated as R; "red light + far-red light" refers to 5 minutes of red light treatment + 5 minutes of far-red light treatment, abbreviated as R+FR. Detailed Implementation

[0042] The present invention will now be described in detail with reference to the accompanying drawings and specific embodiments, but this should not be construed as limiting the invention. Unless otherwise specified, the technical means used in the following embodiments are conventional means well known to those skilled in the art, and the materials, reagents, etc. used in the following embodiments are commercially available unless otherwise specified.

[0043] Example I. Construction of a light-controlled yeast two-hybrid system based on endogenous synthesis of phycocyanin 1. Construction TEF1 promoter - MCS - PGK1 Termination of submodule: (1) TEF1The promoter was obtained by amplification using the p416TEF vector as a template. The specific method was as follows: amplification was performed using amplification primer 1. TEF1 The promoter sequence was used to design restriction enzyme sites in amplification primer one to obtain... TEF1 Termination of contract.

[0044] The p416TEF vector was provided by Dr. Yanjie Li of Yale University and is publicly available in the literature. "Mumberg D, Müller R, Funk M. Yeast vectors for the controlled expression of heterologous proteins in different genetic backgrounds. Gene. 1995. 156:119-22."

[0045] The amplification primer 1 and its sequence are as follows: The nucleotide sequence of TEF-F is shown in SEQ ID NO.1: 5'-AGGGAACAAAAGCTGGAGCTCATAGCTTCAAAATGTTTCTAC-3'.

[0046] The nucleotide sequence of TEF-R is shown in SEQ ID NO.2: 5'-CCGCGTCGACCCGCGGGGATCCAAACTTAGATTAGATTGCTATGC-3'.

[0047] TEF1 The nucleotide sequence of the promoter is shown in SEQ ID NO.3: ATAGCTCAAAATGTTTCTACTCCTTTTTTACTCTTCCAGATTTTCTCGGACTCCGCGCATCGCCGTACCACTTCAAAACACCCAAGCACAGCATACTAAATTTCCCCTCTTTCTTCCTCTAGGGTTGTCGTTAATTACCCGTACTAAAGGTTTGGAAAAGAAAAAAGAGACCGCCTCGTTTCTTTTTCTTCGTCGAAAA AGGCAATAAAAATTTTTATCACGTTTCTTTTTCTTGAAAATTTTTTTTTTGATTTTTTTCTTTCGATGACCTCCATTGATATTTAAGTTAATAAAACGGTCTTCAATTTCTCAAGTTTCAGTTTCATTTTTCTTGTTCTATTACAACTTTTTTTACTTCTTGCTCATTAGAAAGAAAGCATAGCAATCTAATCTAAG.

[0048] (2) PGK1 The terminator was obtained by amplification using the pBridge vector as a template. The specific method was as follows: amplification was performed using amplification primer 2. PGK1 The sequence of the terminator was used to design restriction enzyme sites in amplification primer two to obtain... PGK1 Termination of contract.

[0049] The pBridge vector is a commercially available vector purchased from Clontech, catalog number #K1605-1.

[0050] The amplification primer 2 and its sequence are as follows: The nucleotide sequence of PGK1-F is shown in SEQ ID NO.4: 5'-ATCCCCGCGGGTCGACGCGGCCGCATTAGCCCGAAGATCTTCG-3'.

[0051] The nucleotide sequence of PGK1-R is shown in SEQ ID NO.5: 5'-ATAACTAATTACATGACTCGAGGAAGATCCGAGGCCTAGCTTT-3'.

[0052] PGK1 The nucleotide sequence of the terminator is shown in SEQ ID NO.6: ATTAGCCCGAAGATCTTCGGGCTGATCTCCCATGTCTCTACTGGTGGTGGTGCTTCTTTGGAATTATTGGAAGGTAAGGAATTGCCAGGTGTTGCTTTCTTATCCGAAAAGAAATAAATTGAATTGAAATCGATAGATCAATTTTTTTCTTTTCTCTTTCCCCATCCTTTACGCTAAAATAATAGTTTATTTTATTTTTTGA ATATTTTTTATTTATATACGTATATATAGACTATTATTTATCTTTTAATGATTATTAAGATTTTTTAAAAAAAAATTCGCTCCTCTTTTAATGCCTTTATGCAGTTTTTTTTTCCCATTCGATATTTCTATGTTCGGGTTCAGCGTATTTTAAGTTTAATAACTCGAAAATTCTGCGTTCGTTAAAGCTAGGCCTCGGATCTTC.

[0053] (3) MCS was designed by ourselves. The corresponding sites were introduced in TEF-R of amplification primer 1 and PGK1-F of amplification primer 2, and there is a 20bp complementary region between TEF-R and PGK1-F sequences.

[0054] The nucleotide sequence of MCS is shown in SEQ ID NO.7: GGATCCCCGCGGGTCGACGCGGCCGCATTAGCCCGAAGATCT.

[0055] (4) Completed through seamless cloning. promoter TEF1 The assembly of the submodule is terminated by using amplification primers TEF-F / TEF-R to... - MCS - PGK1 The promoter nucleotide sequence was amplified using amplification primers PGK1-F / PGK1-R. TEF The nucleotide sequence of the terminator was amplified using restriction endonucleases. PGK1 I and Sac I linearized the pRS425 vector and used a seamless cloning system to... Xho promoter and TEF1 The terminator is simultaneously integrated into the pRS425 vector, resulting in... PGK1 promoter TEF1 Terminate the submodule.

[0056] The pRS425 vector was provided by Professor Lou Huiqiang of China Agricultural University and is publicly available in the literature. "Brachmann CB, Davies A, Cost GJ, Caputo E, Li J, Hieter P, Boeke JD. Designer deletion strains derived from Saccharomyces cerevisiae S288C: auseful set of strains and plasmids for PCR-mediated gene disruption and other applications. Yeast. 1998. 14:115-32."

[0057] - MCS - PGK1 promoter TEF1 A diagram of the termination submodule is shown below. - MCS - PGK1 As shown. Figure 1 promoter TEF1 The nucleotide sequence of the termination submodule is shown in SEQ ID NO.20:

[0058] .

[0059] 2. Construction - MCS - PGK1 promoter- ADH1 Termination of submodule: This module is mainly obtained by modifying the pEG202 vector, as follows: (1) MCS - LexA - ADH1 The promoter was obtained by amplification using the pEG202 vector as a template. The specific method was: amplification using three primers.ADH1 The promoter sequence was used to design restriction enzyme sites in amplification primer three to obtain... ADH1 Promoter.

[0060] The pEG202 vector is a commercially available vector purchased from Clontech, catalog number #K609-1.

[0061] The amplification primer three and its sequence are as follows: The nucleotide sequence of ADH1-F is shown in SEQ ID NO.8: 5'-GCTCTTGCCGGCCCGGCGATAAC-3'.

[0062] The nucleotide sequence of ADH1-R is shown in SEQ ID NO.9: 5'-GAATTCCCGCGGTCCGCCCGGAATTAATTC-3'.

[0063] The nucleotide sequence of the promoter is shown in SEQ ID NO.10:

[0064] Using amplification primers ADH1-F / ADH1-R to... ADH1 Promoter nucleotide sequence amplification using restriction endonucleases ADH1 I and ADH1 I linearized the pEG202 vector, and then used T4 ligase to ligate... Nae The promoter is linked to the linearized pEG202 vector to form an intermediate vector.

[0065] (2) EcoR The gene coding sequence was obtained by amplification using the pEG202 vector as a template. The specific method was as follows: amplification was performed using four amplification primers. ADH1 The gene coding sequence was used to design restriction enzyme sites in primer four for amplification, resulting in... LexA Modification sequence.

[0066] The amplification primer four and its sequence are as follows: The nucleotide sequence of LexA-F is shown in SEQ ID NO.11: 5'-GGATCCATGAAAGCGTTAACGGCC-3'.

[0067] The nucleotide sequence of LexA-R is shown in SEQ ID NO.12: 5'-CTCGAGTCACAGCCAGTCGCCGTTGCG-3'.

[0068] Amplification using primers four: LexA-F / LexA-R LexA Gene coding sequence, using restriction endonucleases LexA I and restriction endonucleases LexA I linearized the intermediate vector obtained in step (1), and then used T4 ligase to ligate the amplified vector. BamH The modified sequence was ligated into the linearized intermediate vector, the original pEG202 vector. Xho The sequence of terminators remains unchanged, ultimately yielding a sequence containing... LexA promoter- ADH1 The pLexA-JL carrier of the termination submodule. Contains... ADH1 promoter- MCS - LexA - ADH1 ADH1 The pLexA-JL vector of the termination submodule is simply referred to as the pLexA-JL vector.

[0069] in, MCS - promoter- LexA - ADH1 A diagram of the termination submodule is shown below. ADH1 As shown. MCS - LexA - ADH1 promoter- Figure 2The nucleotide sequence of the termination submodule is shown in SEQ ID NO.22:

[0070]

[0071] ADH1 The nucleotide sequence of the gene coding sequence is shown in SEQ ID NO.23: ATGAAAGCGTTAACGGCCAGGCAACAAGAGGTGTTTGATCTCATCCGTGATCACATCAGCCAGACAGGTATGCCGCCGACGCGTGCGGAAATCGCGCAGCGTTTGGGGTTCCGTTCCCCAAACGCGGCTGAAGAACATCTGAAGGCGCTGGCACGCAAAGGCGTTATTGAAATTGTTTCCGGCGCATCACGCGGGATTCGTCTGTTGCAGGAAGAGGAAGAAGGGTTGCCGCTGGTAGGTCGTGTGGCTGCCGGTGAACCACTTCTGGCGCAACAGCATATTGAAGGTCATTATCAGGTCGATCCTTCCTTATTCAAGCCGAATGCTGATTTCCTGCTGCGCGTCAGCGGGATGTCGATGAAAGATATCGGCATTATGGATGGTGACTTGCTGGCAGTGCATAAAACTCAGGATGTACGTAACGGTCAGGTCGTTGTCGCACGTATTGATGACGAAGTTACCGTTAAGCGCCTGAAAAAACAGGGCAATAAAGTCGAACTGTTGCCAGAAAATAGCGAGTTTAAACCAATTGTCGTAGATCTTCGTCAGCAGAGCTTCACCATTGAAGGGCTGGCGGTTGGGGTTATTCGCAACGGCGACTGGCTG。

[0072] MCS - LexA - ADH1 The nucleotide sequence of the modified sequence is shown in SEQ ID NO.24: .

[0073] 3. Construction of the PBM module and EGY48-PBM strain: (1) Construct the PBM module: Amplification using amplification primer five LexA The gene sequence string template was provided by Professor Ye Haifeng of East China Normal University and is disclosed in patent CN202010443080: A gene expression switch regulated by red light and far-red light and its construction method and application.

[0074] LexA The nucleotide sequence of the gene sequence string is shown in the aforementioned patent.

[0075] The amplification primer five and its sequence are as follows: The nucleotide sequence of PBM-F is shown in SEQ ID NO.13: 5'-GGATCCATGTCCGTGCTGACCCACTC-3'.

[0076] The nucleotide sequence of PBM-R is shown in SEQ ID NO.14: 5'-GTCGACCCATAGAGCCCACCGCATCC-3'.

[0077] Using restriction endonucleases PcyA - P2A - HO1 - P2A - FD - P2A - FNR - PolyA I and restriction endonucleases PcyA - P2A - HO1 - P2A - FD - P2A - FNR - PolyA I will BamH promoter Sal The termination submodule was cut open; the amplified submodule was ligated using T4 ligase. TEF1 Gene sequences were tandemly inserted to obtain the phycocyanin synthesis module.

[0078] The phycocyanin synthesis module, also known as the PBM module or PBM, is illustrated in the diagram below. - MCS - PGK1 As shown.

[0079] (2) Constructing the EGY48-PBM strain with uracil + leucine as the screening marker: The PBM module labeled with leucine was transformed into the EGY48-Y2H strain labeled with uracil using the lithium acetate / PEG method, thus completing the construction of the EGY48-PBM strain labeled with uracil + leucine.

[0080] Among them, the EGY48-Y2H strain, which was selected with uracil as the marker, is the yeast strain EGY48-Y2H containing the reporter gene. The reporter gene is... PcyA - P2A - HO1 - P2A - FD - P2A - FNR - PolyA The reporter gene, whose nucleotides are shown in SEQ ID NO.21:

[0081]

[0082] The EGY48 strain is a commercial strain purchased from Clontech, catalog number #K1609-1.

[0083] Transformation into EGY48 strain using lithium acetate / PEG method Figure 3 The reporter gene was used to obtain a yeast strain containing the reporter gene, EGY48-Y2H. The yeast strain containing the reporter gene, EGY48-Y2H, is simply referred to as the EGY48-Y2H strain.

[0084] The EGY48-PBM strain selected by screening with uracil + leucine is abbreviated as EGY48-PBM strain.

[0085] II. Application of the light-controlled yeast two-hybrid system based on endogenous synthesis of phycocyanin provided by this invention in Arabidopsis thaliana To test the applicability of the light-controlled yeast two-hybrid system based on endogenous synthesis of phycobilin provided in this invention for detecting the interaction between phytochromes of different conformations and their signal molecules, the interaction between Arabidopsis thaliana phytochrome A (phyA) and the signal molecule protein FHY1 is used as an example below. The light-controlled yeast two-hybrid system based on endogenous synthesis of phycobilin is referred to simply as the light-controlled yeast two-hybrid system.

[0086] 1. Construction of the phytochrome A-LexA recombinant vector: The coding sequence of Arabidopsis thaliana phytochrome A protein was ligated to a protein containing... LacZ promoter- LacZ The pLexA-JL vector of the termination submodule was used to obtain the phytochrome A-LexA recombinant vector. Histidine was used as the selection marker. The phytochrome A-LexA recombinant vector is a phytochrome A-LexA fusion expression vector.

[0087] Among them, containing ADH1 promoter- MCS - LexA - ADH1 The pLexA-JL vector of the termination submodule is simply referred to as the pLexA-JL vector.

[0088] The nucleotide sequence encoding the phytochrome A protein is shown in SEQ ID NO.15:

[0089] 2. Construction of AD-FHY1 recombinant vector: The coding sequence of the Arabidopsis thaliana FHY1 protein was cloned and ligated into the C-terminal region of the AD fusion protein expression vector pB42AD to obtain the AD-FHY1 recombinant vector. Tryptophan was used as the selection marker. The AD-FHY1 recombinant vector is an AD-FHY1 fusion expression vector.

[0090] The nucleotide sequence encoding the Arabidopsis thaliana FHY1 protein is shown in SEQ ID NO.16: .

[0091] The AD fusion protein expression vector pB42AD, or simply pB42AD vector, is a commercially available vector purchased from Clontech under catalog number #K1609-1.

[0092] Subsequently, plasmid combinations (I) to (IV) were transformed into the EGY48-PBM strain to obtain four strains with different protein expression combinations.

[0093] The four strains with different protein expression combinations are strain I, strain II, strain III, and strain IV. Strain I refers to strain AD+LexA, abbreviated as AD+LexA; strain II refers to strain AD+Photochromin A-LexA, abbreviated as AD+Photochromin A-LexA; strain III refers to strain AD-FHY1+LexA, abbreviated as AD-FHY1+LexA; and strain IV refers to strain AD-FHY1+Photochromin A-LexA, abbreviated as AD-FHY1+Photochromin A-LexA. Strain AD-FHY1+Photochromin A-LexA is a strain that co-expresses photochromin A-LexA and AD-FHY1.

[0094] The plasmid combinations used for transformation are as follows: (I) AD+LexA: pB42AD vector and pLexA-JL vector.

[0095] (II) AD+Photochromic Pigment A-LexA: pB42AD carrier and photochromic pigment A-LexA recombinant carrier.

[0096] (III) AD-FHY1+LexA: AD-FHY1 recombinant vector and pLexA-JL vector.

[0097] (IV) AD-FHY1+Photochromin A-LexA: AD-FHY1 recombinant vector and photochromin A-LexA recombinant vector.

[0098] In the above-mentioned plasmid combinations of transformations, AD refers to the pB42AD vector, LexA refers to the pLexA-JL vector, phytochrome A-LexA refers to the phytochrome A-LexA recombinant vector, and AD-FHY1 refers to the AD-FHY1 recombinant vector.

[0099] The method for transforming plasmid combinations (I) to (IV) into EGY48-PBM strain was yeast transformation using the PEG lithium acetate method. The specific transformation steps are as follows: 1) First, reactivate the EGY48-PBM strain by burning the inoculation stick with an alcohol lamp in a clean bench. After it cools down, dip the EGY48-PBM strain into the inoculation stick and streak it on SD / -uracil-leucine solid medium. Place it in a constant temperature incubator at 30°C and culture until new single colonies grow.

[0100] The pH of 1L of SD / -uracil-leucine solid culture medium is 5.8, and its composition is as follows: 6.7 g of nitrogen source without amino acids, 0.6 g of selective amino acid mixture lacking leucine and uracil, 50 mL of 40% galactose solution, 20 g of agar, and ddH2O were added to a final volume of 1 L.

[0101] The formulation of SD / -uracil-leucine liquid medium is based on SD / -uracil-leucine solid medium without the addition of agar.

[0102] 2) In a clean bench, select single colonies with good growth status, inoculate them into 10 mL of SD / -uracil-leucine liquid medium, and incubate overnight at 30°C and 180 rpm to obtain yeast culture.

[0103] Overnight refers to a culture time of ≥12 hours.

[0104] 3) Expanded culture: In a clean bench, transfer 2 mL of yeast culture to 10 times its volume of SD / -uracil-tryptophan liquid medium and incubate at 30°C and 200 rpm for 3 hours until the OD of the culture reaches zero. 600 It is 1.0.

[0105] 4) Prepare 100 μL of salmon sperm DNA and boil it in water for 15 minutes. Then place it on ice for later use.

[0106] 5) In a clean bench, mix plasmids according to combinations (I) AD+LexA, (II) AD+photochromin A-LexA, (III) AD-FHY1+LexA and (IV) AD-FHY1+photochromin A-LexA with 10 μL salmon sperm DNA in a 1.5 mL centrifuge tube. Each plasmid should contain no less than 100 ng and be stored at 4 °C for later use.

[0107] 6) After the bacterial culture is shaken, centrifuge at 1000g for 5 minutes at room temperature, remove the supernatant, and obtain yeast cells.

[0108] 7) Resuspend the yeast cells in sterile ddH2O and centrifuge at 1000g for 5 minutes at room temperature.

[0109] 8) Prepare 1×TE / LiAc solution and PEG solution during centrifugation. The preparation method is as follows: The method for preparing 1 mL of 1×TE / LiAc solution is as follows: 100 μL of 10×TE and 100 μL of 10×LiAc are diluted to 1 mL with ddH2O.

[0110] The preparation methods for 10×TE are as follows: dissolve 15 mL of 1M Tris-HCl and 3 mL of 0.5M EDTA in ddH2O; the preparation method for 10×LiAc is as follows: dissolve 10.2 g of LiAc in ddH2O, adjust the pH to 7.5, and bring the volume to 100 mL. The pH of the 0.5M EDTA is 8.0, and the pH of the 1M Tris-HCl is 7.5.

[0111] The method for preparing 10 mL of PEG solution is as follows: 1 mL of 10×TE and 1 mL of 10×LiAc are diluted to 1 mL with PEG at a volume percentage of 50%.

[0112] 9) After centrifugation, remove the supernatant, collect the yeast cells, and resuspend the yeast cells in 100 μL of 1×TE / LiAc solution to obtain competent yeast cells.

[0113] 10) In a clean bench, add 100 μL of the competent yeast cells obtained in step 9) to each of the 1.5 mL centrifuge tubes containing the pre-prepared plasmid and salmon sperm DNA, and shake thoroughly to mix.

[0114] 11) Add 600 μL of PEG solution to the centrifuge tube, shake well to mix, and incubate at 30°C and 200 rpm for 30 min.

[0115] 12) After the shaking culture is complete, take out the centrifuge tubes and add 70 μL of DMSO to each tube in the clean bench. Gently invert the tubes to mix.

[0116] 13) Then, place each centrifuge tube in a 42°C water bath for 15 minutes, and immediately place it on ice for 5 minutes.

[0117] 14) Centrifuge briefly at 14000 rpm for 10 seconds, discard the supernatant, and collect the yeast cells in the lower layer.

[0118] 15) Resuspend the yeast cells in 100 μL of 1×TE buffer to obtain a resuspended bacterial solution. Spread 50 μL of the resuspended bacterial solution onto SD / -uracil-leucine-tryptophan-histidine solid medium and incubate at 30°C upside down for at least 3 days.

[0119] The preparation method for 1×TE is as follows: dilute 1 mL of 10×TE into 9 mL of ddH2O.

[0120] The pH of 1L SD / -uracil-leucine-tryptophan-histidine solid medium is 5.8. Its composition is as follows: 6.7g of amino acid-free nitrogen source, 0.6g of selective amino acid mixture lacking leucine, uracil, tryptophan and histidine, 50mL of 40% galactose solution (w / v) and 20g of agar, and then brought to a final volume of 1L with ddH2O.

[0121] The formulation of SD / -uracil-leucine-tryptophan-histidine liquid medium is based on SD / -uracil-leucine-tryptophan-histidine solid medium without the addition of agar.

[0122] ADH1 The steps for reporter gene detection are as follows: (1) Live plate test method: 1) Twelve single colonies of strains I, II, III and IV were selected and activated into new SD / -uracil-leucine-tryptophan-histidine solid medium and grown at 30°C for 2 days.

[0123] 2) Transfer the newly grown yeast cells to X-gal chromogenic medium and repeat the transfer to two plates.

[0124] The 1L X-gal chromogenic medium has a pH of 5.8 and its composition is as follows: 6.7g of amino acid-free nitrogen, 0.6g of a selective amino acid mixture lacking leucine, uracil, tryptophan and histidine, 50mL of 40% galactose solution, 25mL of 40% raffinose solution, 100mL of 10×BU salt, and 20g of agar.

[0125] The pH of 1L of 10×BU salt is 7.0, and its formula consists of: 9.35g of Na2HPO4·12H2O and 3.9g of NaH2PO4·2H2O.

[0126] 3) Place both plates under far-red light at a light intensity of 50 μmol / m². 2 After processing at 30℃ for 5 minutes, one of the plates was then transferred to red light at an intensity of 50 μmol / m². 2 / s, 30℃, treated for 20h; simultaneously, another plate was kept under far-red light conditions, at a light intensity of 50μmol / m 2 Treatment was carried out at 30℃ for 22 hours. Photos were taken after the colonies on the X-gal staining plate turned blue.

[0127] The color development results of the X-gal colorimetric panel are as follows: MCS - LexA - ADH1As shown, strain IV exhibits a distinct deep blue color under red light treatment and a light blue color under far-red light treatment. Strains I, II, and III do not exhibit a distinct blue color, indicating that FHY1 interacts with phytochrome A, and that FHY1 is more inclined to interact with the far-red light-absorbing form of phytochrome A.

[0128] (2) Liquid culture detection method: 1) Pick the activated strains I, II, III and IV from step 3 and culture them in 1 mL of SD / -uracil-leucine-tryptophan-histidine liquid medium. Select 6 biological replicates for each of strains I, II, III and IV.

[0129] 2) After treating the bacterial cultures of strains I, II, III, and IV under far-infrared light for 5 minutes, they were then incubated overnight at 30°C and 180 rpm in the dark. "Overnight" refers to a time of ≥12 hours.

[0130] 3) In a dark room environment, using green light as illumination, divide the overnight culture solution from step 2) into two equal portions, each 500 μL. Treat one portion with red light for 5 minutes, and the other portion with red light + far-red light for 5 minutes, at a light intensity of 50 μmol / m². 2 / s. Among them, red light processing: R, far-red light processing: R+FR.

[0131] 4) Subsequently, add 1 mL of SD / -uracil-leucine-tryptophan-histidine liquid culture medium to the bacterial culture in step 3), and incubate at 30°C and 180 rpm in the dark for 2 h. Then, treat the cultured bacterial culture with light again as in step 3), and continue to incubate at 30°C and 180 rpm in the dark for 2 h.

[0132] 5) Prepare the following reagents for later use: Z-buffer, 0.1% SDS (w / v), 4 mg / mL ONPG solution, 1 M Na2CO3, and chloroform. ONPG solution: ONPG dissolved in Z-buffer.

[0133] The pH of 1L of Z buffer solution is 7.0, and its formula is: 0.246g / L MgSO4·7H2O, 0.75g / L KCl, 6.22g / L NaH2PO4·2H2O and 21.5g / L Na2HPO4·12H2O, with water as the solvent.

[0134] 6) In a dark room, take 1 mL of bacterial suspension from strains I, II, III, and IV from step 3, centrifuge at 14000 rpm for 5 min, discard the supernatant, collect the yeast cells, and determine the OD of the remaining bacterial suspensions from strains I, II, III, and IV. 600 .

[0135] 7) Add 1 mL of Z-buffer to the collected yeast cells, wash, shake to resuspend, centrifuge at 14000 rpm for 5 min, remove the supernatant, and collect the yeast cells.

[0136] 8) Then add 150 μL Z-buffer, 50 μL chloroform and 20 μL 0.1% SDS to the yeast cells collected in step 7) as the experimental group and set up a blank control group, and shake well for 15 s.

[0137] The Z-buffer is prepared by adding 27 μL of β-mercaptoethanol to 10 mL of Z-buffer.

[0138] The blank control group refers to the addition of only 150 μL Z-buffer, 50 μL chloroform and 20 μL 0.1% SDS, without the yeast cells collected in step 7).

[0139] 9) Add 200 μL of 4 mg / mL ONPG to the experimental group and the blank control group respectively, shake thoroughly, and then place them in a 30℃ water bath for reaction, and record the reaction time.

[0140] 10) Once the reaction solution of the experimental group turns yellow, add 500 μL of 1M Na2CO3 to both the experimental group and the blank control group, and vortex for 5 seconds to terminate the reaction.

[0141] 11) Centrifuge the reaction solutions of the experimental group and the blank control group at 14000 rpm for 5 min. After centrifugation, aspirate 800 μL of the supernatant into a cuvette and measure the absorbance (OD). 420 .

[0142] 12) Calculate the β-galactosidase activity in strains I, II, III, and IV from step 3 using the following formula: β-galactosidase activity = (A 420 ×1000) / (OD 600 ×t×v); In the above formula, A 420 The absorbance of the reaction solution at a wavelength of 420 nm is OD. 600 The concentration of the bacterial solution is represented by t, the reaction time is t, and the volume of the collected bacteria is v.

[0143] The results of β-galactosidase activity assays for strains I, II, III, and IV are as follows: LacZ As shown: The β-galactosidase activity in strain IV was significantly higher than that in strains I, II and III, and the enzyme activity of strain IV after 5 min of red light treatment was significantly higher than that after 5 min of red light + 5 min of far-red light treatment.

[0144] The above results indicate that FHY1 interacts with phytochrome A, and that FHY1 is more inclined to interact with the far-infrared absorbing form of phytochrome A.

[0145] III. Application of the light-controlled yeast two-hybrid system based on endogenous synthesis of phycocyanin provided by this invention in maize. To further demonstrate the applicability of the yeast hybridization system based on endogenous chromophore synthesis and light regulation described in this invention, the following experiments were conducted: The interaction between maize phytochromes and the signal protein maize FHY1.3 was selected for further verification. The method was the same as described in the application in Arabidopsis thaliana. The maize phytochromes included maize phytochrome A1 and maize phytochrome A2.

[0146] 1. Construction of maize phytochrome A1-LexA and maize phytochrome A2-LexA carriers: The coding sequence of the maize phytochrome A1 protein was linked to a protein containing... Figure 4 promoter- Figure 5 The pLexA-JL vector of the termination submodule was used to obtain the maize phytochrome A1-LexA vector. Histidine was used as the selection marker.

[0147] The coding sequence of the maize phytochrome A2 protein was ligated to a protein containing... ADH1 promoter- MCS - LexA - ADH1 The pLexA-JL vector of the termination submodule was used to obtain the maize phytochrome A2-LexA vector. Histidine was used as the selection marker.

[0148] Among them, containing ADH1 promoter- MCS - LexA - ADH1 The pLexA-JL vector of the termination submodule is simply referred to as the pLexA-JL vector.

[0149] Both the maize phytochrome A1-LexA vector and the maize phytochrome A2-LexA vector are phytochrome A-LexA fusion expression vectors.

[0150] The nucleotide sequence encoding the maize phytochrome A1 protein is shown in SEQ ID NO.17:

[0151] The nucleotide sequence encoding the maize phytochrome A2 protein is shown in SEQ ID NO.18:

[0152] 2. Construction of AD-maize FHY1.3 vector: The coding sequence of the maize FHY1.3 protein was ligated into the pB42AD vector to obtain the AD-maize FHY1.3 vector. Tryptophan was used as the selection marker. The maize FHY1.3 protein is the same as the maize FHY1 protein. The AD-maize FHY1.3 vector is the AD-maize FHY1 recombinant vector. The AD-maize FHY1 recombinant vector is an AD-FHY1 fusion expression vector.

[0153] The nucleotide sequence encoding the maize FHY1.3 protein is shown in SEQ ID NO.19: ATGGGAGCAAAGGCGGAGGAGTGTGAGGTGCCGCCGCTGGCTGCGAACGCGGAGGAGGCAGCTTCCACCAATCAGTGCACCCTCATCTTCAAAGGCTGTTCCAACAGCATGGAAAAAGTCTACGCCATCAGCAGTCCTAGTAAGAAAAGAAAATCACAGTATGAGCTGAGTGATCCAAAGTTGCTACCACTTAAATGCAAGTTTCGCAAACGGTTATATTGCCAGGATGATGAGTCTGCAACCACAGAAAGTTTAGGATATGATGGTATTTTCATGAACAAGACCTCTGGGACGGACATGGTCAGCATACCTGAAGAATTGGACTCTTGTGAGAACACTATAAGCCTGTTTTGTGGATGCATTGAAGTTGACTCAAAAAATGGAATTCAGGAACAATCTTTGAGAAAAATGTTTGAGATCCGGACATCTGCATCCAGTAGCTCGAGCAACAATTTTTCATCAGAGGCTTTTAGTTCTTCCCATAGCAGCGGCACGAGAGACACTGACAGCTGGGCTATGGACGATATAGAGCGTCATCATCCATATGTGATGCTGAAACCGCATAATGACGACCTTGAAAGGATATTCAACGTGCTTGAACAGTATGATGACCTAATGGAGGACGAACTAATGGCTGGCGATGTTTTTGGTTCTGCTGCTCAGGTCATGGATGAAAAGCTTTACTCGAATAGCGTTGACGATTTTCAGATTTTGCCAACAGGTCAGACTGGCTATCACGGTGAGAAGAAGCTAACCATCGATCAAGAATTTGAGCAGTATTTTGCGAACCTCATGCTG。

[0154] 3. Plasmids containing maize phytochrome A1-LexA and maize phytochrome A2-LexA, along with AD-maize FHY1.3 and corresponding control combinations, were transformed into the EGY48-PBM strain, resulting in six different control strains. These six control strains include strains I, V, VI, VII, VIII, and IX. Strain I refers to strain AD+LexA, abbreviated as AD+LexA; strain V refers to strain AD+maize phytochrome A1-LexA. The first strain is referred to as AD+maize phytochrome A1-LexA; strain VI refers to strain AD+maize phytochrome A2-LexA, abbreviated as AD+maize phytochrome A2-LexA; strain VII refers to strain AD-maize FHY1.3+LexA, abbreviated as AD-maize FHY1.3+LexA; strain VIII refers to maize FHY1.3+maize phytochrome A1-LexA, abbreviated as AD-maize FHY1.3+maize phytochrome A1-LexA; strain IX refers to maize FHY1.3+maize phytochrome A2-LexA, i.e., strain IX, abbreviated as AD-maize FHY1.3+maize phytochrome A2-LexA.

[0155] Strains FHY1.3+maize phytochrome A1-LexA and FHY1.3+maize phytochrome A2-LexA, i.e. strain IX, are strains that co-express phytochrome A-LexA and AD-FHY1.

[0156] The plasmids for the corresponding control combinations are shown below: (I) AD+LexA: pB42AD vector and pLexA-JL vector.

[0157] (V)AD+maize phytochrome A1-LexA: pB42AD carrier and maize phytochrome A1-LexA carrier.

[0158] (VI) AD+maize phytochrome A2-LexA: pB42AD carrier and maize phytochrome A2-LexA carrier.

[0159] (VII) AD-maize FHY1.3+LexA: AD-maize FHY1.3 vector and pLexA-JL vector.

[0160] (VIII) AD-maize FHY1.3 + maize phytochrome A1-LexA: AD-maize FHY1.3 carrier and maize phytochrome A1-LexA carrier.

[0161] (IX) AD-maize FHY1.3 + maize phytochrome A2-LexA: AD-maize FHY1.3 carrier and maize phytochrome A2-LexA carrier.

[0162] In the corresponding control combinations of the above plasmids, AD is the pB42AD vector, LexA is the pLexA-JL vector, maize phytochrome A1-LexA is the maize phytochrome A1-LexA vector, maize phytochrome A2-LexA is the maize phytochrome A2-LexA vector, AD-maize FHY1.3 is the AD-maize FHY1.3 vector, and maize FHY1.3 is FHY1.

[0163] Yeast transformation was performed using the PEG lithium acetate method, with the specific transformation steps being the same as in step 3.

[0164] The report shows the expression status of the gene: The color development results of the X-gal colorimetric panel are as follows: ADH1 As shown, under red light treatment, AD-maize FHY1.3+ maize phytochrome A1-LexA and AD-maize FHY1.3-maize phytochrome A2-LexA exhibit a distinct deep blue color; under far-red light treatment, AD-maize FHY1.3+ maize phytochrome A1-LexA does not exhibit a blue color, maize FHY1.3-maize phytochrome 2-LexA exhibits a light blue color, and other control strains also do not turn blue.

[0165] The above results indicate that maize FHY1.3 interacts with maize phytochrome A1 and maize phytochrome A2, and that maize FHY1.3 interacts more strongly with the far-infrared light-absorbing forms of maize phytochrome A1 and maize phytochrome A2.

[0166] The results of the liquid culture assay for β-galactosidase activity are as follows: MCS - LexA - ADH1 Figure 6 Figure 7 As shown, the β-galactosidase activity in AD-maize FHY1.3+maize phytochrome A1-LexA and AD-maize FHY1.3-maize phytochrome A2-LexA was significantly higher than that in strains I, V, VI and VII. Furthermore, the β-galactosidase activity of AD-maize FHY1.3+maize phytochrome A1-LexA and AD-maize FHY1.3+maize phytochrome A2-LexA was significantly higher after 5 min of red light treatment than after 5 min of red light + 5 min of far-red light treatment.

[0167] The above results indicate that maize FHY1.3 interacts with maize phyA1 / maize phytochrome A2, and interacts more strongly with the far-red light-absorbing forms of maize phytochrome A1 and maize phytochrome A2.

[0168] As can be seen from the above, the light-controlled yeast two-hybrid system based on endogenous synthesis of phycocyanin provided by this invention can synthesize phycocyanin, a chromophore of cyanobacteria, within yeast cells, enabling the photosensitive pigments in yeast cells to undergo conformational changes between far-red and red light absorption forms. Furthermore, this light-controlled yeast two-hybrid system based on endogenous synthesis of phycocyanin is not only applicable to the photosensitive pigments of the model plant Arabidopsis thaliana, but also to the photosensitive pigments of maize.

[0169] It should be noted that when numerical ranges are involved in this invention, it should be understood that the two endpoints of each numerical range and any value between the two endpoints can be selected. To avoid redundancy, this invention describes preferred embodiments.

[0170] Although preferred embodiments of the invention have been described, those skilled in the art, upon learning the basic inventive concept, can make other changes and modifications to these embodiments, all of which fall within the scope of the invention.

Claims

1. A light-controlled yeast two-hybrid system, characterized in that, The light-controlled yeast two-hybrid system is obtained by integrating a phycocyanin synthesis module into a yeast strain containing a reporter gene, and then transforming it into a phytochrome A-LexA fusion expression vector and an AD-FHY1 fusion expression vector; The phycocyanin synthesis module is composed of PcyA-P2A-HO1-P2A-FD-P2A-FNR-PolyA The gene sequence string and nucleotide sequence are as shown in SEQ ID NO.

20. TEF1 promoter- MCS-PGK1 It is formed by terminating the connection of sub-modules; The photopigment A-LexA fusion expression vector contains the coding sequence of the photopigment protein as shown in SEQ ID NO.15, SEQ ID NO.17 and / or SEQ ID NO.18; The AD-FHY1 fusion expression vector contains the coding sequence of the plant FHY1 protein, as shown in SEQ ID NO.16 and / or SEQ ID NO.19; The reporter gene in the yeast strain containing the reporter gene is: LacZ Reporter genes, the LacZ The nucleotide sequence of the reporter gene is shown in SEQ ID NO.

21.

2. The light-controlled yeast two-hybrid system according to claim 1, characterized in that, The yeast strain containing the reporter gene was obtained by using *Saccharomyces cerevisiae* (Saccharomyces cerevisiae). Saccharomyces cerevisiae ) Transferred into EGY48 LacZ The strain formed after the reporter gene.

3. The method for establishing the light-controlled yeast two-hybrid system according to claim 1, characterized in that, Includes the following steps: The pLexA vector LexA The gene coding sequence was moved from the N-terminal region to the C-terminal region of the multiple cloning site to obtain the pLexA-JL vector; the coding sequence of the phytochrome protein was ligated into the pLexA-JL vector to form a phytochrome A-LexA fusion expression vector; wherein, the LexA The nucleotide sequence of the gene coding sequence is shown in SEQ ID NO.23; The coding sequence of the plant FHY1 protein is ligated to the C-terminal region of the AD fusion protein expression vector to form an AD-FHY1 fusion expression vector; wherein, the AD fusion protein expression vector is a pB42AD vector; The phycocyanin synthesis module was transferred into the yeast strain containing the reporter gene to form the EGY48-PBM strain. The phytochrome A-LexA fusion expression vector and the AD-FHY1 fusion expression vector were co-transformed into the EGY48-PBM strain to obtain a phytochrome A-LexA and AD-FHY1 co-expressing strain, forming the light-controlled yeast two-hybrid system.

4. The application of the light-controlled yeast two-hybrid system according to claim 1 in detecting the interaction between phytochrome and signal molecules.

5. The application of the light-controlled yeast two-hybrid system according to claim 4 in detecting the interaction between phytochrome and signal molecules, characterized in that, The phytochrome A-LexA fusion expression vector and the AD-FHY1 fusion expression vector were co-transformed into a vector carrying the auxotrophic marker Ura. - Leu - Trp - His - In the EGY48-PBM strain, a positive transformant capable of autonomously synthesizing uracil, leucine, tryptophan and histidine on a selective medium that does not contain uracil, leucine, tryptophan and histidine was obtained, namely the photochromin-FHY1 positive transformant. The photosensitive pigment-FHY1 positive transformants were divided into two groups, and red light treatment and red light + far-red light treatment were performed on the other group respectively. Under the conditions of red light processing and red light + far-red light processing, by detecting the... LacZ The expression levels of reporter genes were quantitatively analyzed to determine the strength of the interaction between phytochrome and FHY1 under two conditions.

6. The application of the light-controlled yeast two-hybrid system according to claim 5 in detecting the interaction between phytochrome and signal molecules, characterized in that, The LacZ The expression level of the reporter gene was determined by the liquid ONPG method and expressed as described above. LacZ The Miller Unit, representing the activity unit of the reporter gene expression product β-galactosidase, is used to quantitatively compare the differences in the interaction between phytochrome A and FHY1 under red light treatment and red light + far-red light conditions.

7. The application of the light-controlled yeast two-hybrid system according to claim 5 in detecting the interaction between phytochrome and signal molecules, characterized in that, The conditions for red light treatment were: light intensity of 50 μmol / m² / s and treatment at 30°C for 5 min.

8. The application of the light-controlled yeast two-hybrid system according to claim 5 in detecting the interaction between phytochrome and signal molecules, characterized in that, The conditions for the red light + far-red light treatment are: red light intensity 50 μmol / m² / s, treated at 30℃ for 5 min, then switched to far-red light intensity 50 μmol / m² / s, and treated at 30℃ for 5 min.

Images