Application of rice OsABI5 gene in reduction of cadmium absorption of rice
By editing the rice OsABI5 gene using CRISPR/Cas9 technology, mutant lines were constructed, solving the problem of cadmium absorption and accumulation in rice. This resulted in a significant reduction in cadmium absorption rate and grain accumulation, thus improving the cadmium tolerance of rice.
Patent Information
- Application Number
- CN202511889106.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-15
- Publication Date
- 2026-02-03
AI Technical Summary
Existing technologies are insufficient to effectively reduce the absorption and accumulation of cadmium in rice, thus impacting food security.
By using CRISPR/Cas9 technology to directionally edit the rice OsABI5 gene, mutant lines were constructed to inhibit OsABI5 function and limit cadmium absorption and accumulation.
It significantly reduced the rate of cadmium absorption by rice roots and the amount of cadmium accumulated in grains, thereby improving the cadmium tolerance of rice.
Smart Images

Figure CN121450705A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of genetic engineering technology, and more specifically, to rice. OsABI5 Application of genes in reducing cadmium absorption in rice. Background Technology
[0002] Cd is a heavy metal element that is severely toxic to plants and humans. Rice is the staple food crop for more than half of the world's population, and it absorbs and accumulates Cd more easily than other cereal crops. Scholars both domestically and internationally have conducted extensive research on Cd pollution in rice and the breeding of new rice varieties with low Cd accumulation. Currently, the main method for controlling excessive Cd in rice is to plant Cd-low accumulating rice varieties. Therefore, identifying genes that regulate Cd accumulation in rice to provide gene targets for the artificial breeding of Cd-low accumulating rice is of significant practical importance.
[0003] Studies have shown that ABI5, a key transcription factor in ABA signaling, acts as a regulator of abiotic stress responses in plants, inducing stress-responsive gene expression and triggering corresponding physiological responses to adapt to environmental changes. In Arabidopsis thaliana... AtABI5 By interacting with the R2R3 type MYB transcription factor MYB49 to inhibit the expression of downstream Cd uptake-related genes, Cd accumulation in Arabidopsis plants was reduced, and the gene knocked out... AtABI5 Cd accumulation increases in Arabidopsis thaliana. In tobacco... NtABI5 Through positive regulation NtDOGL4 The expression of ABA was inhibited, while the expression of Cd transport proteins was suppressed, promoting the formation and deposition of suberin and inhibiting Cd absorption by tobacco roots. This demonstrates that the key transcription factor ABI5 in ABA signaling plays an important role in plant responses to Cd stress. Therefore, this study intends to start from... OsABI5 This study aims to analyze the Cd accumulation mechanism in rice from the perspective of regulating Cd absorption, in order to provide a theoretical basis for improving the Cd accumulation mechanism in rice. Summary of the Invention
[0004] The purpose of this invention is to provide rice OsABI5 Application of genes in reducing cadmium absorption in rice.
[0005] The technical problem solved by this invention is achieved by the following technical solution.
[0006] This application provides rice. OsABI5 The application of the gene in reducing cadmium absorption in rice, the nucleotide sequence of the above gene is shown in SEQ ID No. 1.
[0007] Furthermore, the above application uses CRISPR / Cas9 technology to perform targeted editing of the gene to obtain mutant strains.
[0008] Furthermore, the aforementioned targeted editing includes the following steps: S1: Perform PCR amplification on the above genes to obtain amplification products; S2: Link the above product onto the expression vector to construct a recombination editing expression vector; S3: The above-mentioned recombinant editing expression vector was transformed into rice callus tissue using Agrobacterium-mediated transformation to obtain mutant lines.
[0009] This invention also provides a biomaterial comprising the genes described above.
[0010] The embodiments of the present invention also provide the application of the above-mentioned biomaterials in reducing the cadmium sensitivity of rice; and / or, in cultivating cadmium-tolerant rice varieties.
[0011] Compared with the prior art, the embodiments of the present invention have at least the following advantages or beneficial effects: 1. This invention is the first to clone and analyze rice. OsABI5 The gene was discovered, and its nucleotide sequence was published, providing a new perspective for elucidating the unknown molecular mechanism by which rice regulates Cd uptake.
[0012] 2. This invention is the first to use CRISPR / Cas9 technology to knock out rice. OsABI5 The gene was extracted, resulting in two homozygous mutant lines. Hydroponic experiments showed a significant increase in Cd content in the aboveground parts of the knockout lines. Net ion flux analysis revealed a significantly increased Cd uptake rate in the roots of the knockout lines. Furthermore, soil culture experiments showed a significantly increased Cd accumulation in brown rice from the knockout lines, demonstrating the gene's ability to regulate Cd accumulation in brown rice. OsABI5 It has the ability to inhibit the absorption of Cd ions by rice roots and thus regulate the accumulation of Cd in rice grains. Attached Figure Description
[0013] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on the provided drawings without creative effort.
[0014] Figure 1 In the CRISPR / Cas9 target system of Embodiment 1 of the present invention OsABI5 A schematic diagram of the target location; Figure 2 Wild-type rice seedlings in Example 2 of this invention and OsABI5 Growth plot of knockout mutant; Figure 3In Embodiment 2 of the present invention OsABI5 Knockout mutant and wild-type rice seedling biomass; Figure 4 In Embodiment 2 of the present invention OsABI5 Comparison of Cd accumulation characteristics in rice seedlings of knockout mutant and wild-type rice; Figure 5 In Embodiment 3 of the present invention OsABI5 Net ion flux of Cd absorption in knockout mutants and wild-type rice; Figure 6 In Embodiment 3 of the present invention OsABI5 Cd content in grains at maturity of knockout mutants and wild-type rice; Figure 7 Constructed in Embodiment 4 of the present invention OsABI5 A map of the vectors used to overexpress the mutants. Detailed Implementation
[0015] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below. Where specific conditions are not specified in the embodiments, conventional conditions or conditions recommended by the manufacturer shall apply. Reagents or instruments whose manufacturers are not specified are all conventional products that can be purchased commercially.
[0016] It should be noted that, unless otherwise specified, the embodiments and features described in this application can be combined with each other. The present invention will now be described in detail with reference to specific embodiments.
[0017] Example 1 To verify OsABI5 To assess the effect of reducing cadmium accumulation in rice, this embodiment first designed a control plant, i.e., [the following was performed / conducted / implemented]. OsABI5 The construction and identification of knockout mutants include the following steps: The rice seeds were purchased from Hangzhou Baige Biotechnology Co., Ltd. The information was based on the Rice Genome Annotation Project (http: / / rice.plantbiology.msu.edu / index.shtml). OsABI5The genome sequence information of (LOC_Os01g68370) was obtained, and the nucleotide sequence was then sequenced. The sequencing results are shown in SEQ ID No. 1. Based on the above sequencing results, target sites and sgRNA sequences were designed. The target site sequence is shown in SEQ ID No. 3, and the sgRNA sequence is shown in SEQ ID No. 4. Oligo dimers were then prepared based on the sgRNA sequences. The synthesized upstream and downstream Oligo were dissolved in water to a concentration of 10 μM, mixed according to the following reaction system (see Table 1), heated at 95°C for 3 minutes, and then slowly cooled to 20°C at approximately 0.2°C / second. After the Oligo dimers were prepared, they were constructed into a CRISPR / Cas vector. The components were mixed on ice according to the following reaction system (see Table 2), and after thorough mixing, the mixture was reacted at room temperature (20°C) for 1 hour to construct the knockout recombinant vector.
[0018] SEQ ID No.3: CCACCGGAGGTTGCAAGGGTGCC SEQ ID No.4: CCACCGGAGGTTGCAAGGGT Table 1 Preparation of Oligo dimer system
[0019] Table 2. Construction of Hybrid Systems of Knockout Recombinant Vectors
[0020] After construction, the knockout recombinant vector was transformed into callus tissue of rice Zhonghua 11 using Agrobacterium-mediated transformation. DNA was extracted from transgenic candidate plants and wild-type plants, and mutant plants were obtained through PCR amplification and sequencing verification. The verification primer F is shown in SEQ ID No. 5, primer R is shown in SEQ ID No. 6, and the amplification program is shown in Table 3. SEQ ID No.5:5' GCAGTCCAAGGAGAAGATGAA 3' SEQ ID No.6:5' CACACCAGAAGCAGGATGAG 3' Table 3 PCR amplification system
[0021] After identification and screening, two mutant plants with different knockout mutation types were obtained. abi5 1 and abi5 2 Stable strains were obtained by propagating two generations of each strain. For example... Figure 1 As shown, Figure 1 For CRISPR / Cas9 target systems OsABI5 The target site locations are shown in red triangles, with the specific locations of the knockout targets indicated by the arrows. The target site locations for these two mutation types are as follows: abi5 1 There is a 4-base deletion in it. abi5 2 There is an insertion of one base. This mutation makes the corresponding abi5 1 and abi5 2 Genes in strains OsABI5 The amino acid sequence formed by translation terminates prematurely. OsABI5 Unable to express itself normally, resulting in the corresponding strains OsABI5 Functionality missing.
[0022] Example 2 This embodiment verifies that... OsABI5 The analysis of differences in biomass and Cd content in different organs of the knockout mutant included the following steps: Wild-type rice Zhonghua 11 and OsABI5 Knockout mutant ( abi5 1 and abi5 2 Seeds were disinfected with 30% H₂O₂ for 30 min, then soaked in 0.1% NaClO for 1 day, and then germinated in a constant temperature and humidity chamber (35 ℃, 60% humidity). After the seeds sprouted, they were transferred to 1 L black hydroponic boxes and watered daily with an appropriate amount of deionized water to maintain a certain level of humidity. When the seedlings had three leaves and one bud, seedlings with uniform growth were selected for transplanting. The seedlings were then transplanted into 2.5 L black cultivation pots, 4 seedlings per pot, and cultured in complete nutrient solution for 14 days. Afterward, they were treated with 5 μmol / L Cd. During the culture period, the nutrient solution was changed every 3 days, and the pH of the nutrient solution was adjusted to 5.5 with HCl or NaOH. Natural light was used, and an appropriate amount of deionized water was added. Figure 2 As shown, samples were taken 7 days after Cd treatment (seedling stage). The samples were divided into underground and aboveground parts. After drying, the dry weight was taken as biomass, and the Cd content of the plants was determined according to the national standard (GB5009.268-2025).
[0023] Differences in biomass during hydroponic experiments, such as Figure 3 As shown, the scale is 10cm; *, ** and *** represent... OsABI5 Significant differences were observed between the knockout mutant and the wild type at p < 0.05, p < 0.01, and p < 0.001. Hydroponic results indicated that under Cd treatment, OsABI5 The knockout mutant showed no significant difference in plant height and root length compared to wild-type rice, but exhibited a decrease in biomass, indicating that the knockout mutant... OsABI5 Genes can affect Cd tolerance in rice.
[0024] Differences in Cd content in different parts of the hydroponic experiment, such as Figure 4 As shown, *, ** and *** represent... OsABI5 Knockout mutants and wild-type p <0.05、 p <0.01 and p Significant differences exist at <0.001. Then, the Cd accumulation was calculated using the following method: Cd accumulation = Cd content × biomass It can be concluded that in the hydroponic experiment, OsABI5 The Cd content in the underground part, the Cd content in the aboveground part, and the Cd accumulation in the knockout mutant were all significantly higher than those in wild-type rice.
[0025] Results of Cd uptake rate determination using non-destructive micrometry (NMT) in hydroponic experiments are as follows: Figure 5 As shown, *, ** and *** represent... OsABI5 Significant differences were observed between the knockout mutant and the wild type at p < 0.05, p < 0.01, and p < 0.001. In the non-invasive microtest, OsABI5 The instantaneous, mean, and peak Cd fluxes of the knockout mutant were significantly higher than those of wild-type rice, indicating that the knockout mutant... OsABI5 It increased the Cd absorption rate in rice.
[0026] The above results indicate that OsABI5 Cd accumulation in rice is regulated by limiting Cd absorption in the roots.
[0027] Example 3 This embodiment further describes... OsABI5 The analysis of Cd content in the mature grains of the knockout mutant included the following steps: The experiment was conducted in soil with slight Cd contamination, and the soil was sieved through a 2 mm sieve and thoroughly mixed. Each pot contained 15 kg of soil (based on air-dried soil). The application rates of nitrogen (N), phosphorus (P2O5), and potassium (K2O) fertilizers were 150, 100, and 105 mg / kg soil, respectively, with per pot the corresponding amounts of urea (4.82 g), potassium dihydrogen phosphate (2.88 g), and potassium chloride (0.95 g). Rice seedlings of uniform growth at the three-leaf stage were transplanted, with two seedlings per pot. The experiment was conducted in a rainproof greenhouse in the teaching and research park of Sichuan Agricultural University, using natural light and conventional water and fertilizer management. At rice maturity, individual grains were collected, hulled, and the Cd content of the brown rice was determined.
[0028] Results of differences in Cd content in seeds during soil culture experiments are as follows: Figure 6 As shown, *, ** and *** represent... OsABI5 Significant differences were observed between the knockout mutant and the wild type at p < 0.05, p < 0.01, and p < 0.001. In the soil culture experiment, OsABI5 The Cd accumulation in the grains of the knockout mutant was significantly higher than that in wild-type rice.
[0029] The above results indicate that OsABI5 By reducing the absorption of Cd by rice, the accumulation of Cd in rice grains can be reduced.
[0030] Example 4 This embodiment has been implemented. OsABI5 The construction of overexpression lines includes the following steps: Using rice ZH11 cDNA as a template, OsABI5 The gene CDS sequence was amplified to obtain PCR amplification products, which were then forward-ligated into the overexpression vector pCAMBIA1300. OsABI5 The CDS sequence is shown in SEQ ID No. 2, and the overexpression vector map is shown in... Figure 7 As shown. The ligation product was transformed into *E. coli* DH5α competent cells, positive clones were selected, plasmids were amplified, and then transformed into *Agrobacterium*. Callus infiltration and tissue culture were used to obtain... OsABI5 Enhanced expression OsABI5 Overexpression strains.
[0031] Then, the non-destructive micromeasuring technique in Example 2 is used to compare the two different techniques in Example 1 and Example 4. OsABI5 Strain, discovered OsABI5 The instantaneous, average, and peak Cd fluxes of the knockout mutant were significantly higher than those of the knockout mutant. OsABI5 Overexpression lines indicate OsABI5 Overexpression significantly reduced the rate of Cd absorption in rice. Therefore, based on this conclusion, rice-containing [materials] can be prepared. OsABI5Genetic biomaterials are used to reduce the cadmium sensitivity of rice; or to breed cadmium-tolerant rice varieties based on them.
[0032] In summary, the embodiments of the present invention provide rice OsABI5 and its genes OsABI5 In its application to reducing cadmium absorption in rice, this invention is the first to clone and analyze rice. OsABI5 The gene was discovered, and its nucleotide sequence was published, providing a new perspective for elucidating the unknown molecular mechanism by which rice regulates Cd uptake.
[0033] This invention is the first to knock out rice using CRISPR / Cas9 technology. OsABI5 The gene was extracted, resulting in two homozygous mutant lines. Hydroponic experiments showed a significant increase in Cd content in the aboveground parts of the knockout lines. Net ion flux analysis revealed a significantly increased Cd uptake rate in the roots of the knockout lines. Furthermore, soil culture experiments showed a significantly increased Cd accumulation in brown rice from the knockout lines, demonstrating the gene's ability to regulate Cd accumulation in brown rice. OsABI5 It has the ability to inhibit the absorption of Cd ions by rice roots and thus regulate the accumulation of Cd in rice grains.
[0034] The embodiments described above are some, but not all, embodiments of the present invention. The detailed description of the embodiments of the present invention is not intended to limit the scope of the claimed invention, but merely to illustrate selected embodiments. All other embodiments obtained by those skilled in the art based on the embodiments of the present invention without inventive effort are within the scope of protection of the present invention.
Claims
1. Rice OsABI5 The application of genes in reducing cadmium absorption in rice is characterized by, The nucleotide sequence of the gene is shown in SEQ ID No.
1.
2. The application according to claim 1, characterized in that, It also includes using CRISPR / Cas9 technology to perform targeted editing of the gene to obtain mutant lines.
3. The application according to claim 2, characterized in that, The targeted editing includes the following steps: S1: Perform PCR amplification on the gene to obtain the amplification product; S2: Link the product onto an expression vector to construct a recombination-editing expression vector; S3: The recombinant editing expression vector was transformed into rice callus tissue using Agrobacterium-mediated transformation to obtain mutant lines.
4. A biomaterial, characterized in that, Includes the gene as described in claim 1.
5. The application of the biomaterial as described in claim 4 in reducing cadmium sensitivity in rice; and / or in breeding cadmium-tolerant rice varieties.