Traditional Chinese medicine composition, traditional Chinese medicine compound composition and traditional Chinese medicine composition gel with acne removing effect as well as preparation method and application thereof

By combining the Chinese herbal ingredients of Forsythia suspensa, Sophora flavescens, Portulaca oleracea and Salvia miltiorrhiza with Artemisia annua essential oil, a compound Chinese herbal medicine composition and gel were prepared. This solved the problems of insufficient safety and effectiveness of existing acne treatment products, and achieved multi-target intervention for acne, with significant antibacterial, anti-inflammatory and oil-controlling acne treatment effects.

CN121466166APending Publication Date: 2026-02-06HEJIA HEALTH MANAGEMENT (SHANGHAI) CO LTD
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511212655.X
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-08-27
Publication Date
2026-02-06

AI Technical Summary

Technical Problem

Existing acne treatment products are insufficient in terms of safety and effectiveness, and are unable to effectively address the multiple pathogenic factors of acne, especially issues such as microbial infection, inflammatory response, and skin barrier damage.

Method used

A traditional Chinese medicine composition using Forsythia suspensa, Sophora flavescens, Portulaca oleracea and Salvia miltiorrhiza as main ingredients was prepared by ethanol reflux extraction and static concentration. Combined with Artemisia annua essential oil, a traditional Chinese medicine compound composition and gel were prepared. The compound composition and gel synergistically inhibit Propionibacterium acnes, improve microcirculation and reduce inflammatory response.

Benefits of technology

It significantly inhibits the growth of Propionibacterium acnes, reduces skin inflammation, and promotes skin barrier repair. It has obvious antibacterial, anti-inflammatory, oil-controlling, and acne-removing effects. It is suitable for a wide range of people, safe and non-irritating, and can be used for a long time.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121466166A_ABST
    Figure CN121466166A_ABST
Patent Text Reader

Abstract

The invention provides a traditional Chinese medicine composition, a traditional Chinese medicine compound composition and traditional Chinese medicine composition gel with an acne removing effect as well as a preparation method and application thereof, and belongs to the technical field of biological medicines. The traditional Chinese medicine composition with the acne removing effect is prepared from the following raw materials in parts by weight: 10 to 20 parts of fructus forsythiae, 5 to 15 parts of radix sophorae flavescentis, 2 to 8 parts of herba portulacae and 10 to 20 parts of radix salviae miltiorrhizae. Results of the invention prove that the traditional Chinese medicine composition, the traditional Chinese medicine compound composition and the gel containing the traditional Chinese medicine composition have obvious antibacterial, anti-inflammatory, oil-controlling and acne-removing functions at cell, animal and human body levels. Raw materials are easy to obtain, the preparation method is simple, suitable for a wide range of people, safe and non-irritant, can be used for a long time and has a good application prospect.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biomedical technology, and particularly relates to a traditional Chinese medicine composition, a traditional Chinese medicine compound composition, a traditional Chinese medicine composition gel, and their preparation methods and applications that have acne-removing effects. Background Technology

[0002] Acne (scientific name: acne vulgaris) is the most common chronic inflammatory pilosebaceous gland disease in dermatology, with a high global incidence rate and a recent trend of affecting both younger and older adults. Most people experience acne to varying degrees at different ages, and some patients develop scars, significantly impacting their physical and mental health. The causes of acne are complex, but the core mechanisms can be summarized as four elements: "oil, blockage, inflammation, and bacteria." "Oil" refers to androgen-driven sebum secretion: the development of the adrenal glands and gonads during puberty leads to increased androgen levels (such as testosterone), stimulating sebaceous gland hypertrophy and excessive sebum secretion. "Blockage" refers to abnormal follicular keratinization: excessive keratinization of the pilosebaceous duct leads to blockage, forming closed (whiteheads) or open (blackheads) comedones. "Inflammation and bacteria" refer to inflammation and bacterial infection: Propionibacterium acnes proliferates in anaerobic environments, decomposing sebum to produce free fatty acids, triggering an inflammatory response, forming papules, pustules, and even nodules and cysts.

[0003] Currently, acne management faces multiple challenges due to high social pressure, unhealthy lifestyles, and poor dietary habits. As people increasingly pursue green skincare concepts, traditional Chinese medicine, with its natural sources, multi-target repair capabilities, and cultural appeal, is demonstrating unique value in the contemporary skincare field. Therefore, developing a truly effective and safe natural product is extremely important for improving acne. Summary of the Invention

[0004] Therefore, the purpose of this invention is to provide a traditional Chinese medicine composition, a traditional Chinese medicine compound composition, a traditional Chinese medicine composition gel, and the preparation method and application thereof, which have the effect of removing acne.

[0005] To achieve the above-mentioned objectives, the present invention provides the following technical solution:

[0006] This invention provides a traditional Chinese medicine composition with acne-removing effects, comprising the following raw materials in parts by weight:

[0007] Forsythia suspensa 10-20 parts, Sophora flavescens 5-15 parts, Portulaca oleracea 2-8 parts and Salvia miltiorrhiza 10-20 parts.

[0008] Preferably, the raw materials include the following parts by weight:

[0009] Forsythia suspensa 13-17 parts, Sophora flavescens 7-13 parts, Portulaca oleracea 4-6 parts and Salvia miltiorrhiza 13-17 parts.

[0010] In this invention, the traditional Chinese medicine composition is made from the following raw materials in parts by weight: 10-20 parts of Forsythia suspensa, 5-15 parts of Sophora flavescens, 2-8 parts of Portulaca oleracea and 10-20 parts of Salvia miltiorrhiza, more preferably 13-17 parts of Forsythia suspensa, 7-13 parts of Sophora flavescens, 4-6 parts of Portulaca oleracea and 13-17 parts of Salvia miltiorrhiza, and more preferably 15 parts of Forsythia suspensa, 10 parts of Sophora flavescens, 5 parts of Portulaca oleracea and 15 parts of Salvia miltiorrhiza.

[0011] In this invention, the Sophora flavescens is a commercially available product in the field. The Sophora flavescens is bitter and cold in nature, and enters the heart, liver, stomach, large intestine, and bladder meridians. It has the effects of clearing heat and drying dampness, and possesses antibacterial, anti-inflammatory, and anti-allergic properties. It can be used to relieve symptoms such as eczema, weeping sores, and itchy skin, and can inhibit skin fungi and reduce skin inflammation.

[0012] In this invention, the Forsythia suspensa is a commercially available product in the art. The Forsythia suspensa has the effects of clearing heat and detoxifying, dispersing nodules and reducing swelling, and is especially suitable for clearing heat toxins from the upper burner. It can inhibit the growth of Propionibacterium acnes, reduce local redness and swelling of the skin, and regulate sebaceous gland secretion, making it suitable for improving oily skin.

[0013] In this invention, the purslane is a commercially available product in the field. The purslane is sour and cold in nature, and enters the liver and large intestine meridians. It has the effects of cooling the blood and detoxifying; after preparation by the method of this invention, it can reduce skin inflammation, relieve symptoms of redness, swelling, heat, and pain, and is especially suitable for pustular acne. It can also promote skin barrier repair function and help reduce post-acne pigmentation.

[0014] In this invention, the Danshen (Salvia miltiorrhiza) is a commercially available product in the field. The Danshen is slightly cold in nature, bitter in taste, and enters the heart and liver meridians. In this invention, it has the effect of improving microcirculation and inhibiting the proliferation of Propionibacterium acnes.

[0015] This invention provides a method for preparing the above-mentioned traditional Chinese medicine composition, comprising the following steps:

[0016] The forsythia, sophora flavescens, purslane, and salvia miltiorrhiza were mixed with an ethanol solution, refluxed for extraction, and the collected filtrate was concentrated in the first stage. After obtaining the concentrated solution, water was added, the solution was allowed to stand, filtered, and the collected filtrate was concentrated in the second stage to obtain the traditional Chinese medicine composition.

[0017] In this invention, Forsythia suspensa, Sophora flavescens, Portulaca oleracea, and Salvia miltiorrhiza are mixed with an ethanol solution, refluxed for extraction, and the collected filtrate is first concentrated to obtain a concentrated solution. The preferred volume ratio of the total mass of Forsythia suspensa, Sophora flavescens, Portulaca oleracea, and Salvia miltiorrhiza to the ethanol solution is 1g:6-10mL, more preferably 1g:7-9mL, and even more preferably 1g:8mL; the preferred volume percentage of the ethanol solution is 60-80%, more preferably 65-75%, and even more preferably 70%; water is used as the solvent in preparing the ethanol solution. In this invention, the 60-80% volume percentage ethanol solution is prepared by mixing 60-80mL of anhydrous ethanol with 20-40mL of water. The preferred number of reflux extractions is 1-3 times, more preferably 2 times, and the preferred extraction time for each extraction is 0.5-1.5h, more preferably 1h; the first concentration is performed to 1 / 7-1 / 9 of the filtrate volume, and even more preferably 1 / 8.

[0018] In this invention, after obtaining the concentrated solution, water is added, the solution is allowed to stand, filtered, and the collected filtrate (c) is subjected to a second concentration to obtain the traditional Chinese medicine composition. The volume ratio of the concentrated solution to water is preferably 1:3-5, more preferably 1:3.5-4.5, and even more preferably 1:4. The standing method is to stand at 2-6°C for 10-14 hours, more preferably at 3-5°C for 11-13 hours, and even more preferably at 4°C for 12 hours. The concentration of the traditional Chinese medicine composition obtained after the second concentration is 0.3-1.5 g / mL, such as 0.5 or 1 g / mL. The traditional Chinese medicine composition prepared by this invention has excellent anti-inflammatory, antibacterial, and repairing effects, and can effectively inhibit acne.

[0019] In the traditional Chinese medicine composition of this invention, the components are arranged according to their functional synergistic relationship as follows:

[0020] Main active ingredient: Forsythia extract, which provides core antibacterial and anti-inflammatory effects. Its active ingredients can effectively inhibit Propionibacterium acnes, reduce skin redness, swelling, heat and pain, and are especially suitable for inflammatory acne lesions;

[0021] Synergistic enhancing component: Sophora flavescens extract, which enhances antibacterial and anti-inflammatory effects, can inhibit skin fungi and relieve itching, and is suitable for skin lesions accompanied by exudation or itching;

[0022] Supporting regulatory components: Purslane extract, which enhances anti-inflammatory effects, promotes skin barrier repair, and reduces tissue fluid exudation;

[0023] Microcirculation-improving component: Salvia miltiorrhiza extract, which can improve local blood circulation, inhibit the accumulation of inflammatory factors, and help eliminate acne scars and pigmentation.

[0024] The traditional Chinese medicine composition of the present invention achieves multi-target intervention on the pathogenesis of acne (microbial infection, inflammatory response, skin barrier damage, and microcirculation disorder) through the synergistic effect of the above components.

[0025] This invention provides a traditional Chinese medicine compound composition with acne-removing effects, the traditional Chinese medicine compound composition comprising artemisia annua essential oil and a traditional Chinese medicine composition; the traditional Chinese medicine composition is the above-mentioned traditional Chinese medicine composition or a traditional Chinese medicine composition prepared by the preparation method;

[0026] The mass ratio of artemisia annua essential oil to the traditional Chinese medicine composition is 0.1:6.5 to 102. As a preferred embodiment, the mass ratio of artemisia annua essential oil to the traditional Chinese medicine composition is 0.1:6.65 to 100, such as 0.1:6.65 or 0.1:100.

[0027] The present invention provides a method for preparing the above-mentioned traditional Chinese medicine compound composition, comprising the following steps: mixing the artemisia annua essential oil and the traditional Chinese medicine composition to prepare the traditional Chinese medicine compound composition.

[0028] In this invention, the artemisia annua essential oil alleviates allergic reactions by inhibiting histamine release and promotes transdermal absorption of active ingredients. This invention obtains a traditional Chinese medicine compound composition by mixing a traditional Chinese medicine composition with artemisia annua essential oil. Compared with the acne-removing effect of the traditional Chinese medicine composition, the traditional Chinese medicine compound composition significantly improves the acne-removing effect. The artemisia annua essential oil of this invention was purchased from Mujiuye (Shanghai) Technology Co., Ltd., batch number 20250221, sample number TCM0186102.

[0029] This invention provides a traditional Chinese medicine composition gel with acne-removing effects, the traditional Chinese medicine composition gel comprising active ingredients and excipients; the mass ratio of the active ingredients to the excipients is (6.5-7):(93-93.5);

[0030] The active ingredient is selected from any of the following:

[0031] (a) The Chinese herbal medicine composition as described above;

[0032] (b) The traditional Chinese medicine composition prepared by the above preparation method;

[0033] (c) The above-mentioned traditional Chinese medicine compound composition;

[0034] (d) The traditional Chinese medicine compound composition prepared by the above preparation method.

[0035] In this invention, the traditional Chinese medicine composition gel is composed of active ingredients and excipients.

[0036] In this invention, the excipients include one or more of the following: butanediol, 1,2-pentanediol, polyglycerol-3, 1,2-hexanediol, hydrolyzed sodium hyaluronate, sodium hyaluronate, ammonium acryloyldimethyl taurate / VP copolymer, acrylate / C10-30 alkanol acrylate crosspolymer, cocoyl alcohol polyether-7, PPG-1-PEG-9 lauryl glycol ether, PEG-40 hydrogenated castor oil, p-hydroxyacetophenone, arginine, zinc gluconate, ethylhexylglycerin, and purified water.

[0037] The mass ratio of butanediol, 1,2-pentanediol, polyglycerol-3, 1,2-hexanediol, hydrolyzed sodium hyaluronate, sodium hyaluronate, ammonium acryloyldimethyl taurate / VP copolymer, acrylate / C10-30 alkanol acrylate crosspolymer, coconut oil polyether-7, PPG-1-PEG-9 lauryl glycol ether, PEG-40 hydrogenated castor oil, p-hydroxyacetophenone, arginine, zinc gluconate, ethylhexylglycerin, and pure water is 5.5:2:1:0.85:0.07:0.05:0.8:0.8:0.25:0.09:0.05:1.5:0.25:0.05:(79.74~79.84).

[0038] In this invention, as a preferred embodiment, the mass ratio of butanediol, 1,2-pentanediol, polyglycerol-3, 1,2-hexanediol, hydrolyzed sodium hyaluronate, sodium hyaluronate, ammonium acryloyldimethyl taurate / VP copolymer, acrylate / C10-30 alkanol acrylate crosspolymer, cocoyl alcohol polyether-7, PPG-1-PEG-9 lauryl glycol ether, PEG-40 hydrogenated castor oil, p-hydroxyacetophenone, arginine, zinc gluconate, ethylhexylglycerin, and pure water is 5.5:2:1:0.85:0.07:0.05:0.8:0.8:0.25:0.09:0.05:1.5:0.25:0.05:79.84. In another preferred embodiment, the mass ratio of butanediol, 1,2-pentanediol, polyglycerol-3, 1,2-hexanediol, hydrolyzed sodium hyaluronate, sodium hyaluronate, ammonium acryloyldimethyl taurate / VP copolymer, acrylate / C10-30 alkanol acrylate crosspolymer, coconut oil polyether-7, PPG-1-PEG-9 lauryl glycol ether, PEG-40 hydrogenated castor oil, p-hydroxyacetophenone, arginine, zinc gluconate, ethylhexylglycerin, and purified water is 5.5:2:1:0.85:0.07:0.05:0.8:0.8:0.25:0.09:0.05:1.5:0.25:0.05:79.74. This invention does not have specific limitations on the source of butanediol, 1,2-pentanediol, polyglycerol-3, 1,2-hexanediol, hydrolyzed sodium hyaluronate, sodium hyaluronate, ammonium acryloyldimethyl taurate / VP copolymer, acrylate / C10-30 alkanol acrylate crosspolymer, cocoyl alcohol polyether-7, PPG-1-PEG-9 lauryl glycol ether, PEG-40 hydrogenated castor oil, p-hydroxyacetophenone, arginine, zinc gluconate, and ethylhexylglycerin; any of these can be purchased from commercially available suppliers in the art. In this invention, the hydrolyzed sodium hyaluronate was purchased from Shandong Yinhe Biotechnology Co., Ltd., CAS No.: 9067-32-7, batch number: HA240419-6, molecular weight: 3000. The sodium hyaluronate itself was also purchased from Shandong Yinhe Biotechnology Co., Ltd., CAS No.: 9067-32-7, EINECS No.: 618-620-0, disaccharide unit relative molecular mass: 401.3.

[0039] This invention provides a method for preparing the above-mentioned traditional Chinese medicine composition gel, comprising the following steps:

[0040] (1) Mix water, butanediol, p-hydroxyacetophenone, hydrolyzed sodium hyaluronate, sodium hyaluronate and active ingredients, and heat to 80-85℃ to obtain mixture 1;

[0041] (2) Mix ammonium acryloyl dimethyl taurate / VP copolymer, acrylate / C10-30 alkanol acrylate crosslinking polymer and water to obtain mixture 2;

[0042] (3) Mix mixture 1 and mixture 2 to obtain mixture 3, and keep the temperature of mixture 3 at 80-85℃;

[0043] (4) Add arginine and water to mixture 3, stir evenly, and start cooling to 50-55℃. Then add 1,2-pentanediol, 1,2-hexanediol and ethylhexylglycerin, stir evenly, and cool to 45-50℃. Then add polyglycerol-3, zinc gluconate and water, stir evenly, and make the temperature 40-45℃. Add coconut oil alcohol polyether-7, PPG-1-PEG-9 lauryl glycol ether, PEG-40 hydrogenated castor oil and water, and make the temperature 35-40℃.

[0044] In this invention, in step (1), when the active ingredient is a traditional Chinese medicine composition, the mass ratio of water, butanediol, p-hydroxyacetophenone, hydrolyzed sodium hyaluronate, sodium hyaluronate, and the traditional Chinese medicine composition is 2.75:5.5:0.05:0.07:0.05:6.65. When the active ingredient is a traditional Chinese medicine composition and artemisia annua essential oil, the mass ratio of water, butanediol, p-hydroxyacetophenone, hydrolyzed sodium hyaluronate, sodium hyaluronate, the traditional Chinese medicine composition, and artemisia annua essential oil is 2.65:5.5:0.05:0.07:0.05:6.7:0.1; in step (2), the mass ratio of ammonium acryloyl dimethyl taurate / VP copolymer, acrylate / C10-30 alkanol acrylate crosspolymer, and water is 0.8:0.8:30; the mass ratio of acrylate / C10-30 alkanol acrylate crosspolymer is 0.8:0.8:30. The acrylic ester crosslinker is a pre-soaked acrylic (ester) / C10-30 alkanol acrylate crosslinker. The preparation method of the pre-soaked acrylic (ester) / C10-30 alkanol acrylate crosslinker includes: weighing 0.8g of the acrylic (ester) / C10-30 alkanol acrylate crosslinker, adding it to 40g of pure water while stirring, and then stirring it with a homogenizer at 500rpm until a uniform, particle-free suspension is formed, thus obtaining the pre-soaked acrylic (ester) / C10-30 alkanol acrylate crosslinker.

[0045] In step (4), the mass ratio of arginine to water is 1.5:6; the mass ratio of 1,2-pentanediol, 1,2-hexanediol and ethylhexylglycerin is 2:0.85:0.05; the mass ratio of polyglycerol-3, zinc gluconate and water is 1:0.25:1.05; and the mass ratio of coconut oil polyether-7, PPG-1-PEG-9 lauryl glycol ether, PEG-40 hydrogenated castor oil and water is 0.25:0.25:0.09:0.04.

[0046] This invention provides an application of the above-mentioned traditional Chinese medicine composition, traditional Chinese medicine composition prepared by the preparation method, traditional Chinese medicine compound composition, traditional Chinese medicine compound composition prepared by the preparation method, traditional Chinese medicine composition gel, or traditional Chinese medicine composition gel prepared by the preparation method in at least one of the following (S1) to (S4):

[0047] (S1) Preparation of antibacterial products;

[0048] (S2) Preparation of oil-controlling products;

[0049] (S3) Preparation of anti-inflammatory products;

[0050] (S4) Prepare acne treatment products.

[0051] In this invention, the repair capacity of the herbal medicine was evaluated by measuring cell proliferation rate in a HaCaT keratinocyte model damaged by sodium dodecyl sulfate (SDS); its anti-inflammatory activity was evaluated by measuring NO levels in a lipopolysaccharide (LPS)-induced RAW264.7 macrophage inflammation model; its oil-controlling effect was evaluated by detecting neutrophil content in a testosterone-induced SZ95 sebaceous gland cell model; and its antibacterial activity was evaluated by determining the minimum inhibitory concentration against Propionibacterium acnes using the microbroth dilution method. Examples show that the composition prepared by the alcohol extraction and water precipitation method significantly reduced NO expression, effectively downregulated central lipid synthesis, increased the proliferation rate of HaCaT keratinocytes, and had a significant inhibitory effect on Propionibacterium acnes. In animal experiments, the gel prepared from the above-mentioned herbal composition could improve inflammatory symptoms such as ear lesions, swelling, telangiectasia, and scaling in acne model rats, reduce auricular swelling, improve histopathological changes, reduce epidermal thickening, and decrease the expression of inflammatory factors TNF-α, IL-1β, and IL-6. In human efficacy evaluation, after subjects used the topical gel prepared from the traditional Chinese medicine composition continuously for 4 weeks, whiteheads, inflammatory papules, non-inflammatory acne, and the total number of acne pimples were all effectively improved, with no adverse reactions such as erythema, edema, dryness, or scaling, demonstrating high safety and significant acne-removing efficacy. These results indicate that the traditional Chinese medicine composition and the gel containing it have significant antibacterial, anti-inflammatory, oil-controlling, and acne-removing functions at the cellular, animal, and human levels. Furthermore, the raw materials are readily available, the preparation method is simple, it is suitable for a wide range of people, and it is safe, non-irritating, and can be used long-term, showing promising application prospects.

[0052] In this invention, the dosage of the herbal composition gel is 0.1–10 g each time, preferably 0.5–5 g, more preferably 1–3 g. Alternatively, depending on the affected area, the amount of the herbal composition gel applied is 0.01–0.5 g per square centimeter of skin, preferably 0.05–0.2 g. The gel can be applied 1–4 times daily, preferably 1–2 times daily. The specific dosage and frequency can be appropriately adjusted according to the user's age, weight, specific acne area and severity, and individual response.

[0053] In this invention, the product includes pharmaceuticals or skincare products.

[0054] Compared with the prior art, the present invention has the following beneficial effects:

[0055] This invention provides a traditional Chinese medicine composition, a compound traditional Chinese medicine composition, a gel containing the traditional Chinese medicine composition, and their preparation methods and applications, all with acne-removing effects. Results of this invention demonstrate that the traditional Chinese medicine composition, the compound traditional Chinese medicine composition, and the gel containing the traditional Chinese medicine composition exhibit significant antibacterial, anti-inflammatory, oil-controlling, and acne-removing functions at the cellular, animal, and human levels. Furthermore, the raw materials are readily available, the preparation method is simple, it is suitable for a wide range of people, and it is safe, non-irritating, and can be used long-term, showing promising application prospects. Attached Figure Description

[0056] Figure 1 The effects of Chinese herbal extracts obtained through different extraction methods on the viability of normal HaCaT cells;

[0057] Figure 2 The effects of different extraction methods of traditional Chinese medicine extracts on proliferation in an SDS-induced HaCaT injury model;

[0058] Figure 3 The effects of Chinese herbal extracts obtained through different extraction methods on NO production in RAW264.7 cells;

[0059] Figure 4 The effects of Chinese herbal extracts obtained through different extraction methods on abnormal sebum secretion by SZ95 sebaceous gland cells;

[0060] Figure 5 The effects of traditional Chinese medicine extracts obtained through different extraction methods on Propionibacterium acnes;

[0061] Figure 6 A comparison of the anti-inflammatory effects of the original and current acne treatment formulas;

[0062] Figure 7 A comparison of the antibacterial effects of the original and current acne treatment formulas;

[0063] Figure 8 A comparison of the oil-controlling effects of the original and current acne treatment formulas;

[0064] Figure 9 A comparison of the repair efficacy of the original acne treatment formula and the current acne treatment formula;

[0065] Figure 10 The image shows the appearance of the traditional Chinese medicine composition gel product prepared in Example 8;

[0066] Figure 11 To investigate the effect of gel containing this traditional Chinese medicine composition on the body weight of rats with acne;

[0067] Figure 12 To investigate the effects of a gel containing this traditional Chinese medicine composition on auricular skin lesions in acne model rats;

[0068] Figure 13 To investigate the effects of a gel containing this traditional Chinese medicine composition on the histopathological changes of the ear tissue in an acne model rat;

[0069] Figure 14 To investigate the effect of a gel containing this traditional Chinese medicine composition on the thickness of the ear epidermis in an acne model rat;

[0070] Figure 15 The effect of this traditional Chinese medicine composition gel on the level of IL-1β mRNA secreted by ear tissue in acne model rats was detected by qRT-PCR.

[0071] Figure 16 To detect the effect of this traditional Chinese medicine composition gel on the level of IL-6 mRNA secreted by ear tissue in acne model rats using qRT-PCR;

[0072] Figure 17 The effect of this traditional Chinese medicine composition gel on the level of TNF-α mRNA secreted by ear tissue in acne model rats was detected by qRT-PCR.

[0073] Figure 18 To detect the effect of this traditional Chinese medicine composition gel on IL-1β expression in the ear tissue of acne model rats using ELISA;

[0074] Figure 19 The effect of this traditional Chinese medicine composition gel on IL-6 expression in the ear tissue of acne model rats was detected by ELISA. Detailed Implementation

[0075] In this invention, unless otherwise specified, all raw material components are commercially available products well known to those skilled in the art.

[0076] The technical solutions provided by the present invention will be described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0077] Example 1

[0078] A traditional Chinese medicine composition with acne-removing effects is made from the following ingredients by weight: 15g of Forsythia suspensa, 10g of Sophora flavescens, 5g of Portulaca oleracea and 15g of Salvia miltiorrhiza.

[0079] The preparation method of the traditional Chinese medicine composition includes the following steps:

[0080] Take 15g of Forsythia suspensa, 10g of Sophora flavescens, 5g of Portulaca oleracea, and 15g of Salvia miltiorrhiza. Add 360mL of water and extract at 100℃ for 1 hour. Filter and collect the first filtrate and the first residue. Add 360mL of water to the first residue and extract at 100℃ for 1 hour. Filter and collect the second filtrate. Combine the first and second filtrates and concentrate the total filtrate to 1g / mL extract for later use.

[0081] Example 2

[0082] A traditional Chinese medicine composition with acne-removing effects is made from the following ingredients by weight: 15g of Forsythia suspensa, 10g of Sophora flavescens, 5g of Portulaca oleracea and 15g of Salvia miltiorrhiza.

[0083] The preparation method of the traditional Chinese medicine composition includes the following steps:

[0084] Take 15g of Forsythia suspensa, 10g of Sophora flavescens, 5g of Portulaca oleracea, and 15g of Salvia miltiorrhiza. Add 360mL of water and extract at 100℃ for 1h. Filter and collect the first filtrate and the first residue. Add 360mL of water to the first residue and extract at 100℃ for 1h. Filter and collect the second filtrate. Combine the first and second filtrates and concentrate the total filtrate to 90mL. Add 360mL of 70% ethanol solution and let stand overnight at 4℃ for 12h. Filter to remove the precipitate and collect the third filtrate. Concentrate the third filtrate by rotary evaporation to 1g / mL of extract for later use.

[0085] Example 3

[0086] A traditional Chinese medicine composition with acne-removing effects is made from the following ingredients by weight: 15g of Forsythia suspensa, 10g of Sophora flavescens, 5g of Portulaca oleracea and 15g of Salvia miltiorrhiza.

[0087] The preparation method of the traditional Chinese medicine composition includes the following steps:

[0088] Take 15g of Forsythia suspensa, 10g of Sophora flavescens, 5g of Portulaca oleracea, and 15g of Salvia miltiorrhiza. Add 360mL of 70% ethanol solution and reflux for 1 hour. Filter and collect filtrate a and residue a. Add 360mL of 70% ethanol solution to residue a and reflux for 1 hour. Filter and collect filtrate b. Combine filtrate a and filtrate b. Concentrate the total filtrate to 1g / mL of extract for later use.

[0089] Example 4

[0090] A traditional Chinese medicine composition with acne-removing effects is made from the following ingredients by weight: 15g of Forsythia suspensa, 10g of Sophora flavescens, 5g of Portulaca oleracea and 15g of Salvia miltiorrhiza.

[0091] The preparation method of the traditional Chinese medicine composition includes the following steps:

[0092] Take 15g of Forsythia suspensa, 10g of Sophora flavescens, 5g of Portulaca oleracea, and 15g of Salvia miltiorrhiza. Add 360mL of 70% ethanol solution and reflux for 1 hour. Filter and collect filtrate a and residue a. Add 360mL of 70% ethanol solution to residue a and reflux for 1 hour. Filter and collect filtrate b. Combine filtrate a and filtrate b. Concentrate the total filtrate to 90mL. Add 360mL of pure water and let stand overnight at 4℃ for 12 hours. Filter to remove the precipitate and collect filtrate c. Concentrate filtrate c to 1g / mL of extract for later use.

[0093] Example 5

[0094] This embodiment verifies the functions of the traditional Chinese medicine composition prepared in Example 1 (referred to as the water extraction group), the traditional Chinese medicine composition prepared in Example 2 (referred to as the water extraction and alcohol precipitation group), the traditional Chinese medicine composition prepared in Example 3 (referred to as the alcohol extraction group), and the traditional Chinese medicine composition prepared in Example 4 (referred to as the alcohol extraction and water precipitation group).

[0095] (1) Evaluation experiment on the repair efficacy of HaCaT cells

[0096] HaCaT cell lines were cultured in DMEM containing 10% FBS in a 37°C incubator, with the medium changed every 24 hours. Cells were passaged at 70%–80% confluence, maintaining logarithmic growth. After passage 3 and achieving stable cell counts, the cells were used for experiments.

[0097] HaCaT cell viability assay:

[0098] HaCaT cells in the logarithmic growth phase were digested and dispersed into single cells using a pipette. Cells were counted to obtain the appropriate number, and appropriate culture medium was added. Cells were seeded at a density of 10,000 cells / well in 96-well plates (200 μL per well) to allow adherence. A control group was included: wells with the same volume of PBS were added, and the absorbance was measured. Experimental groups consisted of the herbal compositions prepared in Examples 1-4 at final concentrations of 25 μg / mL, 50 μg / mL, 100 μg / mL, 150 μg / mL, and 200 μg / mL, respectively, representing the water extraction group, water extraction and alcohol precipitation group, alcohol extraction group, and alcohol extraction and alcohol precipitation group, with 6 replicates per group. A blank group was added with the appropriate volume of cell culture medium and incubated for 24 h. The top layer of culture medium in the 96-well plates was discarded, and 100 μL of 10% CCK8 serum-free DMEM solution was added. The plates were incubated at 37°C in a 5% CO2 cell culture incubator for 1 h, and the OD was measured using a microplate reader. 450 Cell viability is calculated using the following formula: Cell viability (%) = (Experimental group OD value - Control group OD value) / (Blank group OD value - Control group OD value) × 100%.

[0099] like Figure 1The results showed that, within the drug concentration range of 25–50 μg / mL, the proliferative capacity of the traditional Chinese medicine composition on HaCaT cells was: alcohol extraction > alcohol extraction and water precipitation > water extraction > water extraction and alcohol precipitation.

[0100] (2) Effect on cell survival in the SDS-induced HaCaT cell injury model

[0101] HaCaT cells were seeded at a density of 5000 cells per well in 96-well plates (100 μL of culture medium) and incubated overnight. The supernatant was then aspirated, and 100 μL of 80 μg / mL SDS solution was added, followed by incubation for another 24 h. After aspirating the supernatant, culture medium containing 25, 50, and 100 μg / mL of the herbal compositions prepared in Examples 1-4 was added, respectively. A model group was also added with the same volume of culture medium as the treatment group, and incubation continued for another 24 h. Finally, cell viability was detected using the CCK-8 assay. The control group received the same volume of PBS.

[0102] like Figure 2 The results showed that HaCaT cell viability significantly decreased after SDS treatment (P<0.001). Water extraction, water extraction with alcohol precipitation, alcohol extraction, and alcohol extraction with water precipitation (i.e., the herbal compositions prepared in Examples 1-4) all exhibited repair effects on HaCaT cell growth in the range of 25-100 μg / mL, but water extraction showed no significant difference. The herbal composition prepared by water extraction with alcohol precipitation significantly promoted cell growth at 25 μg / mL (P<0.05), with a cell viability of 30.11%. However, at concentrations of 50-100 μg / mL, the repair ability of the herbal composition decreased, but the difference was not significant. In contrast, the herbal extracts prepared by alcohol extraction and alcohol extraction with water precipitation showed significant differences in cell viability at a concentration of 50 μg / mL, with viability of 34.27% and 34.90%, respectively (P<0.01, P<0.01). Furthermore, the cell repair promotion ability of the herbal compositions decreased with further increases in concentration. In summary, the repair ability of traditional Chinese medicine compositions on HaCaT cells is as follows: alcohol extraction ≈ alcohol extraction and water precipitation > water extraction and alcohol precipitation > water extraction.

[0103] (2) Evaluation experiment on the anti-inflammatory efficacy of RAW264.7 cells

[0104] RAW 264.7 cells were planted at a density of 20 × 10⁶ cells per well. 5Cells were seeded at a density of 0.5 mL per well in 24-well plates, with four replicates per group. After cell attachment, the control group (wells seeded with cells were left untreated) and the model group and treatment group (0.5 μL of 1 mg / mL lipopolysaccharide) were added. After incubation for 1 h, the treatment group was treated with the traditional Chinese medicine composition prepared in Examples 1-4 to achieve a final concentration of 100 μg / mL of raw drug. Simultaneously, the same volume of culture medium as the treatment group was added as the model group. Incubation continued for 24 h. The supernatant was collected, and the NO concentration was detected according to the NO kit instructions at a wavelength of 540 nm using a microplate reader. The NO concentration in the cells after extraction was calculated, and the NO inhibition rate was calculated. NO inhibition rate (%) = (NO content in the model group - NO content in the treatment group) / NO content in the model group × 100%.

[0105] like Figure 3 The results showed that when the final drug concentration was 100 μg / mL, the inhibitory effect of the traditional Chinese medicine composition on NO was: alcohol extraction ≈ alcohol extraction and water precipitation > water extraction > water extraction and alcohol precipitation.

[0106] (3) Evaluation experiment on the oil-controlling efficacy of SZ95 sebaceous gland cells

[0107] SZ95 cells were seeded into 6-well cell culture plates at 15 × 10⁶ cells per well. 4 Cells were cultured for 24 hours, and then cultured in a medium containing the test drug (the traditional Chinese medicine composition prepared in Examples 1-4) at a final concentration of 200 μg / mL. After 24 hours, testosterone was added to both untreated and drug-treated wells to create a model, with a testosterone concentration of 5 μg / mL (while maintaining the test drug concentration). These were designated as the model group, water extraction group, water extraction-alcohol precipitation group, alcohol extraction group, and alcohol extraction-water precipitation group, respectively. After another 24 hours of culture, the cells were scraped off with a cell scraper, washed with PBS, and a single-cell suspension was prepared (in PBS). Nile red fluorescent dye was added to the suspension at a final concentration of 100 ng / mL, and the cells were incubated at room temperature for 15 minutes. The cells were washed twice with PBS, and 10,000 cells in each sample were analyzed using flow cytometry. The average fluorescence intensity of each cell was calculated (excitation wavelength 485 nm, emission wavelength 565 nm). Each drug concentration was tested in triplicate. The blank group consisted of cells inoculated in wells without any treatment.

[0108] Figure 4 The results showed that, upon stimulation with testosterone, the fluorescence intensity of neutral lipids secreted by sebaceous gland cells was significantly increased (P<0.05). After treatment with the traditional Chinese medicine compositions prepared in Examples 1-4, the average fluorescence intensity of neutral lipids secreted by sebaceous gland cells decreased, indicating that the traditional Chinese medicine compositions prepared in Examples 1-4 all had good oil-controlling ability, with the order being: water extraction > water extraction with alcohol precipitation > alcohol extraction > alcohol extraction with water precipitation.

[0109] (4) Evaluation test of antibacterial efficacy of Propionibacterium acnes

[0110] The specific experimental steps are as follows: ① Under aseptic conditions, add 100 μL of brain and heart extract broth (Lablead brand: catalog number LM1135B) to each well of a 96-well plate; ② Add 100 μL of the traditional Chinese medicine composition prepared in Examples 1, 2, 3, or 4 to well 1, mix it with the culture medium in the well by pipetting, then aspirate 100 μL of the suspension from well 1 and add it to well 2. Repeat the above operation to serially dilute the acne-removing formula extract solution to well 8. After completing the above operation, aspirate 100 μL of the suspension from well 8 and discard it, ensuring that wells 1 to 8 each contain 100 μL of serially diluted traditional Chinese medicine composition solution and culture medium suspension. Each dilution has 3 replicates. Wells without traditional Chinese medicine composition are also set up as negative controls; ③ Add 100 μL of diluted bacterial solution to each well and make the final concentration of bacterial solution in each well 1×10⁻⁶. 6 CFU / mL, and a blank control was set up (culture medium containing different serial dilutions of the traditional Chinese medicine composition to remove background OD of the traditional Chinese medicine composition). 600 ④ After incubation for 24 hours, the OD was measured. 600 And calculate bacterial activity. Bacterial activity (%) = 100 - (OD of the treated group) 600 - Blank control OD 600 ) / (Negative control OD 600 - Blank control OD 600 )×100%.

[0111] Figure 5 The results showed that the traditional Chinese medicine composition prepared by water extraction exhibited strong antibacterial activity against *Propionibacterium acnes* (>90% inhibition rate) at a 4-fold dilution concentration, and still maintained antibacterial activity at a 32-fold dilution concentration (>50% inhibition rate). The traditional Chinese medicine composition prepared by water extraction and alcohol precipitation also showed antibacterial activity against *Propionibacterium acnes* (>50% inhibition rate) at a 32-fold dilution concentration. The traditional Chinese medicine composition prepared by alcohol extraction exhibited strong antibacterial activity against *Propionibacterium acnes* (>90% inhibition rate) at a 16-fold dilution concentration, and still maintained antibacterial activity at a 32-fold dilution concentration (>50% inhibition rate). The traditional Chinese medicine composition prepared by alcohol extraction and water precipitation also showed strong antibacterial activity against *Propionibacterium acnes* (>90% inhibition rate) at an 8-fold dilution concentration, and still maintained antibacterial activity at a 32-fold dilution concentration (>50% inhibition rate). Calculations showed that the MIC values ​​for water extraction, water extraction with alcohol precipitation, alcohol extraction, and alcohol extraction with water precipitation were 250 mg / mL, >250 mg / mL, 62.5 mg / mL, and 125 mg / mL, respectively. Therefore, the antibacterial activity was: alcohol extraction > alcohol extraction with water precipitation > water extraction > water extraction with alcohol precipitation.

[0112] Conclusions of the optimized extraction process screening:

[0113] 1. SDS-induced HaCaT damage repair effect: proliferation effect is alcohol extraction ≈ alcohol extraction and water precipitation > water extraction and alcohol precipitation > water extraction.

[0114] 2. Anti-inflammatory effect of macrophages (RAW264.7): alcohol extraction ≈ alcohol extraction and water precipitation > water extraction > water extraction and alcohol precipitation.

[0115] 3. Oil control effect: Water extraction group > Water extraction and alcohol precipitation method > Alcohol extraction method > Alcohol extraction and water precipitation method.

[0116] 4. Antibacterial effect: alcohol extraction > alcohol extraction and water precipitation > water extraction > water extraction and alcohol precipitation.

[0117] Based on a comprehensive assessment of efficacy balance and safety:

[0118] Core efficacy weighting: For acne treatment, anti-inflammatory (40%) and antibacterial (25%) functions should be prioritized, while oil control (20%) and repair are secondary functions (15%). In this invention, alcohol extraction and alcohol extraction with water precipitation methods show the best performance in core efficacy (anti-inflammatory, antibacterial, and repair). Based on safety considerations, alcohol extraction with water precipitation method was ultimately determined to be the optimal process.

[0119] Example 6

[0120] The original acne treatment formula consists of a traditional Chinese medicine composition prepared by extraction in Example 4, which is referred to as the original formula.

[0121] The current acne treatment formula is composed of 100g of the traditional Chinese medicine composition prepared in Example 4, plus 0.1g of artemisia annua essential oil, and is referred to as the current formula (Example 6).

[0122] The efficacy of the original acne treatment formula and the current acne treatment formula was evaluated and compared from four aspects: anti-inflammatory, antibacterial, oil control, and repair.

[0123] (1) Comparison of anti-inflammatory effects

[0124] RAW 264.7 cells were planted at a density of 20 × 10⁶ cells per well. 5 Cells were seeded at a density of 0.5 mL per well in 24-well plates, with 4 accessory wells per group. After cell attachment, the control group was left untreated in the wells containing cells. Both the model group and the treatment group received an equal volume of 0.5 μL LPS (to a final LPS concentration of 1 μg / mL). After 1 h of incubation, the treatment groups received the original acne-removing formula and the new acne-removing formula, respectively, to final concentrations of 25 and 50 μg / mL of raw drug. Incubation continued for 24 h. The supernatant was collected, and NO concentration was detected at 540 nm using a microplate reader according to the NO kit instructions. The NO concentration in the cells after extraction was calculated, and the NO inhibition rate was also calculated.

[0125] Figure 6The results showed that at concentrations of 25 and 50 μg / mL, the current acne-removing formula significantly inhibited NO more effectively than the original formula, indicating that the current formula has superior anti-inflammatory capabilities.

[0126] (2) Comparison of antibacterial effects

[0127] The specific experimental steps are as follows: ① Under aseptic conditions, add 100 μL of nutrient broth culture medium (brain and heart extract broth culture medium) to each well of a 96-well plate; ② Add 100 μL of the traditional Chinese medicine composition prepared in Example 4 or 6 to well 1, mix it with the culture medium in the well by pipetting, then aspirate 100 μL of the suspension from well 1 and add it to well 2. Repeat the above operation to serially dilute the acne-removing formula extract solution to well 8. After completing the above operation, aspirate 100 μL of the suspension from well 8 and discard it, ensuring that wells 1 to 8 each contain 100 μL of serially diluted traditional Chinese medicine composition solution and culture medium suspension. Each dilution has 3 replicates. Wells without traditional Chinese medicine composition are also set up as negative controls; ③ Add 100 μL of diluted bacterial solution to each well and make the final concentration of bacterial solution in each well 1×10⁻⁶. 6 CFU / mL, and a blank control was set up (culture medium containing different serial dilutions of the traditional Chinese medicine composition to remove the background OD600 of the traditional Chinese medicine composition); ④ After incubation for 24 h, OD was measured. 600 And calculate bacterial activity. Bacterial activity (%) = 100 - (OD of the treated group) 600 - Blank control OD 600 ) / (Negative control OD 600 - Blank control OD 600 )×100%.

[0128] Figure 7 The results showed that, compared with Example 4 (i.e., the original acne treatment formula), there was no significant difference in the antibacterial effect of Example 6 (i.e., the current acne treatment formula).

[0129] (3) Comparison of oil control effects

[0130] SZ95 cells were seeded in 6-well cell culture plates at 150,000 cells per well and cultured for 24 h. Medium containing the test drug (original or current acne treatment formula) was added to each well to a final concentration of 200 μg / mL. After 24 h, testosterone was added to wells treated with the test drug and wells treated with the test drug to create a model at a concentration of 5 μg / mL (while maintaining the test drug concentration). These were designated as the model group, original formula group, and current formula group, respectively. After another 24 h of culture, cells were scraped off with a cell scraper, washed with PBS, and a single-cell suspension was prepared (in PBS). Nile red fluorescent dye was added to this suspension to a final concentration of 100 ng / mL. The suspension was incubated at room temperature for 15 min, washed twice with PBS, and 10,000 cells from each sample were analyzed using flow cytometry. The average fluorescence intensity of each cell (excitation wavelength 485 nm, emission wavelength 565 nm) was calculated. Each drug concentration was tested in triplicate. The blank group consisted of wells inoculated with cells that were left untreated.

[0131] Figure 8 The results showed that, compared with the original acne treatment formula, the current acne treatment formula significantly inhibited the synthesis of neutral lipids (P<0.01), indicating that the current acne treatment formula has better oil control ability.

[0132] (4) Comparison of repair efficacy

[0133] HaCaT cells were seeded at a density of 5000 cells per well in 96-well plates (100 μL of culture medium) and incubated overnight in a cell culture incubator. The supernatant was then aspirated, and 100 μL of 80 μg / mL SDS solution was added, followed by incubation for another 24 h. After aspirating the supernatant, culture medium containing 50 or 100 μg / mL of the drug (either the original or current acne treatment formula) was added, and the cells were incubated for 24 h. Finally, cell viability was assessed using the CCK-8 assay.

[0134] Figure 9 The results showed that, compared with the original acne treatment formula, the current acne treatment formula at concentrations of 50 and 100 μg / mL significantly improved the activity of damaged HaCaT cells (P<0.05), indicating that the current acne treatment formula has better repair capabilities.

[0135] Example 7

[0136] A traditional Chinese medicine composition gel with antibacterial, anti-inflammatory, oil-controlling, and acne-reducing effects, comprising 6.65g of active ingredient and 93.35g of excipients per 100g. The active ingredient is the traditional Chinese medicine composition prepared in Example 4 (i.e., the composition prepared by alcohol extraction and water precipitation). The excipients consist of 5.5g butylene glycol, 2g 1,2-pentanediol, 31g polyglycerol-31g, 0.85g 1,2-hexanediol, 0.07g hydrolyzed sodium hyaluronate, and 0.0g sodium hyaluronate. The composition includes 5g of ammonium acryloyl dimethyl taurate / VP copolymer, 0.8g of acrylate / C10-30 alkanol acrylate crosspolymer, 0.25g of coconut oil polyether-7, 0.25g of PPG-1-PEG-9 lauryl glycol ether, 0.09g of PEG-40 hydrogenated castor oil, 0.05g of p-hydroxyacetophenone, 1.5g of arginine, 0.25g of zinc gluconate, 0.05g of ethylhexylglycerin, and 79.84g of purified water.

[0137] The preparation method is as follows: 2.75g water, 5.5g butanediol, 0.05g p-hydroxyacetophenone, 0.07g hydrolyzed sodium hyaluronate, 0.05g sodium hyaluronate, and 6.65g of the traditional Chinese medicine composition are added to a water bath (referred to as phase A). The temperature is raised to 83℃. 0.8g ammonium acryloyldimethyl taurate / VP copolymer, 30g water, and 40.8g of soaked acrylic (ester) / C10-30 alkanol acrylate crosspolymer are added to an emulsifying pot. Phase A is then drawn into the emulsifying pot, ensuring the temperature remains at 83℃. 1.5g arginine and 6g water are added, and the mixture is stirred until homogeneous. Cooling begins. Stir and cool to 53°C, add 2g of 1,2-pentanediol, 0.85g of 1,2-hexanediol, and 0.05g of ethylhexylglycerin, stir until homogeneous, cool to 48°C, add 31g of polyglycerol-, 0.25g of zinc gluconate, and 1.05g of water, stir until homogeneous, cool to 43°C, add 0.25g of coconut oil alcohol polyether-7, 0.25g of PPG-1-PEG-9 lauryl glycol ether, 0.09g of PEG-40 hydrogenated castor oil, and 0.04g of water, and cool to 38°C to obtain a gel. The preparation method of the soaked acrylate / C10-30 alkanol acrylate crosslinked polymer is as follows: Weigh 0.8g of the acrylate / C10-30 alkanol acrylate crosslinked polymer and add it to 40g of pure water while stirring. After the addition is complete, use a homogenizer to stir at 500rpm until a uniform suspension without particles is formed, thus obtaining the soaked acrylate / C10-30 alkanol acrylate crosslinked polymer.

[0138] Example 8

[0139] A traditional Chinese medicine composition gel with antibacterial, anti-inflammatory, oil-controlling, and acne-reducing effects. Each 100g of the gel consists of 6.75g of active ingredients and 93.25g of excipients. The active ingredients are 6.65g of the composition from Example 4 (i.e., the traditional Chinese medicine composition prepared by alcohol extraction and water precipitation) and 0.1g of artemisia annua essential oil. The excipients are 5.5g of butylene glycol, 2g of 1,2-pentanediol, 31g of polyglycerol-31g, 0.85g of 1,2-hexanediol, 0.07g of hydrolyzed sodium hyaluronate, and [other ingredients not specified]. The composition includes 0.05g sodium hyaluronate, 0.8g ammonium acryloyl dimethyl taurate / VP copolymer, 0.8g acrylate / C10-30 alkanol acrylate crosspolymer, 0.25g coconut oil polyether-7, 0.25g PPG-1-PEG-9 lauryl glycol ether, 0.09g PEG-40 hydrogenated castor oil, 0.05g p-hydroxyacetophenone, 1.5g arginine, 0.25g zinc gluconate, 0.05g ethylhexylglycerin, and 79.74g purified water.

[0140] The preparation method of the traditional Chinese medicine composition gel is as follows: 2.65g water, 5.5g butanediol, 0.05g p-hydroxyacetophenone, 0.07g hydrolyzed sodium hyaluronate, 0.05g sodium hyaluronate, 6.7g of the traditional Chinese medicine composition, and 0.1g of artemisinin essential oil are added to a water bath (denoted as phase A). The temperature is raised to 83℃. 0.8g of ammonium acryloyldimethyl taurate / VP copolymer and 30g water are added to an emulsifying pot. 40.8g of the soaked acrylic (ester) / C10-30 alkanol acrylate crosspolymer is added to the emulsifying pot. Phase A is then pumped into the emulsifying pot, ensuring the temperature reaches 83℃. 1.5g arginine and 6g water are added, and the mixture is stirred evenly before cooling begins. Stir and cool to 53°C, add 2g of 1,2-pentanediol, 0.85g of 1,2-hexanediol, and 0.05g of ethylhexylglycerin, stir until homogeneous, cool to 48°C, add 31g of polyglycerol-, 0.25g of zinc gluconate, and 1.05g of water, stir until homogeneous, cool to 43°C, add 0.25g of coconut oil alcohol polyether-7, 0.25g of PPG-1-PEG-9 lauryl glycol ether, 0.09g of PEG-40 hydrogenated castor oil, and 0.04g of water, and cool to 38°C to obtain a gel. The preparation method of the soaked acrylate / C10-30 alkanol acrylate crosslinked polymer is as follows: Weigh 0.8g of the acrylate / C10-30 alkanol acrylate crosslinked polymer and add it to 40g of pure water while stirring. After the addition is complete, use a homogenizer to stir at 500rpm until a uniform suspension without particles is formed, thus obtaining the soaked acrylate / C10-30 alkanol acrylate crosslinked polymer.

[0141] Figure 10 The results showed that the traditional Chinese medicine composition gel prepared by the present invention was brownish-black semi-solid with a uniform texture.

[0142] Example 9

[0143] (1) Modeling and testing methods

[0144] Establishment of an acne rat model: Thirty SD rats (weighing 180–220 g) were randomly divided into four groups using a random number table: a control group (n = 6, half male and half female), a model group (n = 7, 3 females and 4 males), a blank matrix group (n = 6, 3 females and 3 males), a pre-gel group (n = 4, 2 females and 2 males), and a current gel group (n = 7, 4 females and 3 males). Except for the control group, all other groups received an intradermal injection of Propionibacterium acnes suspension (6 × 10⁻⁶) into the right auricle. 7 The bacteria were administered 50 μL of Propionibacterium acnes suspension (cfu / mL) once daily for 12 consecutive days, along with topical application of oleic acid to accelerate acne formation. The left ear served as a control with no treatment. On day 13, the blank matrix group received a blank gel; the model group received intradermal injections of Propionibacterium acnes suspension (7 × 10⁻⁶ CFU / mL) daily into the right auricle. 7 The original gel group received the herbal composition gel prepared in Example 7, while the current gel group received the herbal composition gel prepared in Example 8. An appropriate amount was applied evenly to the auricle using a cotton swab, twice daily for 8 consecutive days. During the treatment period, both the original gel group and the current gel group received an intradermal injection of Propionibacterium acnes suspension (7 × 10⁻⁶ CFU / mL) into the right auricle daily. 7 The herbal composition was administered at a dose of 20 μL (cfu / mL) once daily to maintain inflammation. Twenty-four hours after the last administration, comparative images of the left and right ears and a photograph of the right ear were taken for each rat. The acne-reducing effect of the herbal composition was quantitatively analyzed using the apparent indicators in Table 1. The ear thickness of the rats was measured using calipers, and the ear swelling rate was calculated. Ear swelling rate = (ear thickness after injection - ear thickness before injection) / ear thickness before injection × 100%.

[0145] Table 1. Evaluation Subscale of Apparent Indicators in Rat Auricular Acne Model

[0146]

[0147]

[0148] The hair around the back of the rat's ear was shaved, and the rat was anesthetized with isoflurane. After anesthesia, the abdomen was opened, the abdominal aorta was separated, and blood was collected from the aorta. The blood was placed in a vacuum-coagulated blood collection tube for 2 hours until coagulation. After coagulation, the blood was centrifuged at 3000 rpm for 15 minutes at 4°C, and serum was collected to detect the expression of inflammatory factors TNF-α, IL-1β, and IL-6. Ear tissue from the lesion site was taken, fixed in 4% paraformaldehyde solution, embedded, sectioned, and stained with hematoxylin and eosin (HE) for histopathological analysis. Ear tissue from the lesion site was also taken, and the expression of inflammatory factors IL-1β and IL-6 was detected using qRT-PCR. Primer information is shown in Table 2; primers were purchased from Sangon Biotech Co., Ltd.

[0149] The above rats were purchased from Spiff Biotechnology Co., Ltd., with the production license number SCXK(Beijing)2024-0001.

[0150] Table 2 Primer Information

[0151] Primer name Nucleotide sequence (5'-3') Number of bases Purification method rat-IL-1β-F gcagctttcgacagtgaggag(SEQ ID NO.1) 21 PAGE rat-IL-1β-R tcatctggacagcccaagtc(SEQ ID NO.2) 20 PAGE rat-IL-6-F cacttcacaagtcggaggct(SEQ ID NO.3) 20 PAGE rat-IL-6-R tctgacagtgcatcatcgct(SEQ ID NO.4) 20 PAGE rat-TNF-F gatcggtcccaacaaggagg(SEQ ID NO.5) 20 PAGE rat-TNF-R cttggtggtttgctacgacg(SEQ ID NO.6) 20 PAGE rat-GAPDH-F gtcggtgtgaacggatttgg(SEQ ID NO.7) 20 PAGE rat-GAPDH-R cttgccgtgggtagagtcat(SEQ ID NO.8) 20 PAGE

[0152] 2. Experimental Results

[0153] 2.1 Effects of the Traditional Chinese Medicine Composition Gel in Examples 7-8 on the Body Weight of Acne Model Rats

[0154] Figure 11 It shows that there is little difference in the body weight of rats in each group, and there is no obvious trend of weight loss. This indicates that the use of the anti-acne formula does not affect the body weight of rats and has good safety.

[0155] 2.2 Effects of the Traditional Chinese Medicine Composition Gel in Examples 7-8 on the Auricular Skin Lesions of Acne Model Rats

[0156] Figure 12 It shows that the auricular tissue of the blank group is soft, delicate, light pink in color, with no dilation of subcutaneous capillaries, and no dilation of hair follicle openings or keratin accumulation. There is no obvious change compared with the left ear. In the model group, the right auricle is red in color, significantly swollen, with a higher skin temperature when touched, the auricular tissue is significantly thicker than the left ear, the epidermis is rough with horny scales (arrow), and the subcutaneous capillaries are significantly dilated. There is obvious scabbing at the opening of the ear duct (arrow). In the blank matrix group, obvious swelling, scales, and scabbing are still visible on the auricles of rats. The auricles of rats given the two gels are light red, with improvement in auricular thickening, mild swelling, reduced capillary dilation, reduced surface scales, and smoother skin.

[0157] 2.3 Effects of the Gels in Examples 7-8 on the Auricular Swelling Degree of Acne Model Rats

[0158] The results in Table 3 show that compared with the model group, there is no significant difference in the apparent index scores of the blank matrix group, indicating that the gel excipient has no anti-acne effect. After treatment with the original gel group (Example 7) and the current gel group (Example 8), the apparent index scores of rats both decreased significantly (P<0.001, P<0.001), indicating that the gel prepared from the traditional Chinese medicine composition composed of forsythia, sophora flavescens, portulaca oleracea, and salvia miltiorrhiza has good anti-acne effects. Further analysis based on the scores found that the score of the current gel is lower than that of the original gel, indicating that after adding artemisia annua essential oil, the anti-acne effect of the formula is further improved.

[0159] Table 3 Apparent Auricular Scores and Auricular Swelling Rates of Rats in Each Group 8 Days after Administration

[0160] Group Apparent indicator score Blank group 0.00 Model group 10.71±1.11 Blank matrix group 9.5±1.38 Original acne gel set 4.75 ± 1.5 ### ]] Acne Gel Set 4.29 ± 2.21 ### ]]

[0161] Compared with the model group: ##P<0.01, ### P<0.001.

[0162] 2.4 Effects of the herbal composition gel from Examples 7-8 on the histopathological changes of ear skin tissue in acne model rats

[0163] HE staining of ear skin tissue was used to evaluate the degree of skin inflammation. Figure 13 The results showed that in the control group, the squamous epithelium on the skin surface was intact with no obvious damage, and sebaceous glands and hair follicles were visible in the dermis, with a few cartilage structures in the subcutaneous tissue. In the model group, the squamous epithelium on the skin surface (red arrow) was thickened, with hyperkeratosis visible on the surface, and focally slightly loose edema in the dermis, with mature sebaceous glands and hair follicles visible. Fibrous tissue hyperplasia and a large number of inflammatory cells (blue arrow) infiltrated in the subcutaneous tissue, with a few vasodilation and congestion were visible. The blank matrix group was consistent with the model group, with thickened squamous epithelium on the surface without obvious damage, hyperkeratosis visible on the surface, and sebaceous glands and hair follicles visible in the dermis, with inflammatory cell infiltration, and a few cartilage structures in the subcutaneous tissue. The original acne gel group and the current acne gel group had milder lesions, with slightly thickened squamous epithelium on the skin surface, focally slightly loose edema in the dermis, and mature sebaceous glands and hair follicles visible. Fibrous tissue hyperplasia and a few inflammatory cells were less visible in the subcutaneous tissue, with a few vasodilations, no damage or degeneration of some muscle tissue, and visible cartilage structures.

[0164] 2.5 Effect of the herbal composition gel from Examples 7-8 on the epidermal thickness of the ear skin tissue in acne model rats

[0165] The thickness of the epidermis was quantified using software, and the results are as follows: Figure 14 As shown, the epidermal thickness of the ear in the blank group was 13.78±3.25 μm. After induction with Propionibacterium acnes, the epidermal thickness in the model group was 29.12±8.40 μm, indicating a significant increase in epidermal thickness in the model group after modeling (P<0.001). Compared with the model group, applying the blank matrix did not reduce the epidermal thickness, while the epidermal thickness of mice treated with the original acne gel group (21.52±3.69 μm) and the current acne gel group (19.22±3.09 μm) both decreased significantly (P<0.001), but there was no significant difference between the two acne gel groups.

[0166] 2.5 Effects of Gels 7-8 in Examples on the Secretion of Inflammatory Factors in the Ear Skin of Acne Model Rats

[0167] The effect of the gel of this invention on the expression of inflammatory factors related to ear skin in rats with acne: Figures 15-19 As shown. The results of the qRT-PCR experiment showed ( Figures 15-17Compared with the control group, the levels of IL-1β and IL-6 mRNA in the model group were significantly increased (P<0.001). After applying the original acne treatment gel and the current acne treatment gel, the level of IL-1β mRNA was significantly decreased (P<0.001); after applying the blank matrix, the original acne treatment gel, and the current acne treatment gel, the level of IL-6 mRNA was significantly decreased (P<0.001). Compared with the control group, only the current acne treatment gel showed a significant inhibitory effect on the expression of IL-1β and IL-6 mRNA (P<0.05, P<0.05), while the original acne treatment gel showed no significant difference.

[0168] ELISA test results show ( Figures 18-19 Compared with the control group, the levels of TNF-α, IL-1β, and IL-6 in the ears of rats treated with Propionibacterium acnes were significantly increased (P<0.001, P<0.001, P<0.01). Compared with the model group, the control group, the original acne-removing gel group, and the current acne-removing gel group all significantly reduced the levels of TNF-α and IL-1β (P values ​​all less than 0.001). Compared with the control group, the original acne-removing gel and the current acne-removing gel showed significant differences in their inhibitory effects on TNF-α and IL-1β (P<0.01, P<0.001), suggesting that the herbal composition gel of this patent has anti-inflammatory effects. Compared with the original acne-removing gel, the current acne-removing gel showed a more significant inhibitory effect on TNF-α and IL-1β (P<0.01, P<0.001), suggesting that Artemisia annua essential oil can further enhance the anti-inflammatory effect and is beneficial for acne removal. Compared with the model group, both the original acne gel group and the current acne gel group significantly reduced IL-6 levels (P<0.01), but there was no significant difference between the two acne gel groups.

[0169] Animal experiments have shown that the addition of artemisia annua essential oil can enhance the anti-inflammatory effects of the combination of traditional Chinese medicines such as forsythia, sophora flavescens, purslane, and salvia miltiorrhiza.

[0170] Example 10

[0171] Human efficacy and safety evaluation

[0172] I. Experimental Objective

[0173] This study aimed to evaluate the safety and efficacy of acne-reducing gel after subjects used it continuously for 28 days through clinical assessment of the skin and non-invasive instrumental testing.

[0174] II. Materials and Methods

[0175] 1. Subjects: At least 30 subjects must be included.

[0176] Selection criteria:

[0177] (1) Healthy men or women aged 18 to 40;

[0178] (2) Individuals with dry skin (facial skin stratum corneum moisture content < 50 a.u.);

[0179] (3) Patients with acne grades I to III according to the Pillsbury classification;

[0180] (4) Those who have no history of allergies to cosmetics or other topical preparations within the past year;

[0181] (5) Those whose facial skin has no birthmarks, scratches, white spots, pigmented nevi, etc. that would affect the test results;

[0182] (6) Those who have not received physical / chemical treatments such as photon, blue light, or chemical peels within 1 month, and have not taken orally or used topical corticosteroids, antibiotics, or anti-inflammatory drugs for facial acne; and have not taken oral retinoids within 3 months.

[0183] (7) Those who can understand the trial process, voluntarily participate in the trial, and sign a written informed consent form.

[0184] Exclusion criteria:

[0185] (S1) Patients with severe acne whose skin lesions are mainly nodules and cysts;

[0186] (S2) Those who have used cosmetics or medicines with acne-removing effects or undergone other acne treatments within the past month;

[0187] (S3) Individuals with highly sensitive constitutions;

[0188] (S4) Individuals who have participated in other clinical trials within the past two months that may affect the results;

[0189] (S5) Other individuals deemed unsuitable for participation in the trial by the researchers.

[0190] 2. Test material

[0191] 2.1 Test Products

[0192] The test product was the traditional Chinese medicine composition gel (CS-2025-024-01) prepared in Example 7.

[0193] 2.2 Usage Method

[0194] Acne-reducing gel: After cleansing your face morning and night, take an appropriate amount of this product and apply it to one side of the face with acne according to the random table. Gently massage until absorbed. During the trial period, do not use any other skin care products besides the test product.

[0195] 3. Test methods

[0196] 3.1 Screening

[0197] All volunteers signed informed consent forms during their initial visit and were then screened according to inclusion and exclusion criteria. They then cleansed their faces with warm water and sat quietly for 30 minutes in a temperature- and humidity-controlled environment. A dermatologist assessed their facial skin condition and tested the moisture content of their stratum corneum. Only those who met the criteria were allowed to enter the formal trial.

[0198] 3.2 Formal Test

[0199] The formal trial lasted for 4 weeks, with participants visiting 5 times in total: before product use (baseline, BL) and on day 3 (D3), day 7 (D7), week 2 (W2), and week 4 (W4) after product use.

[0200] Upon initial screening and the first visit of qualified participants, they cleansed their faces with warm water and sat quietly for 30 minutes in a temperature- and humidity-controlled laboratory (temperature 20.0±2℃, relative humidity 50±10%) before undergoing clinical assessment, Visia-CR image acquisition, and Antera 3D detection. After completing these assessments, each participant received an acne treatment gel and applied it to one side of their face (the test side) according to a randomization table. After receiving the product, technicians guided participants on its use and recorded a usage diary, including the duration of use and any discomfort experienced.

[0201] All subjects returned to the laboratory on the 3rd, 7th, 2nd and 4th weeks after product use. They cleaned their faces with warm water, sat quietly in the constant temperature and humidity laboratory for 30 minutes, and then underwent clinical evaluation, non-invasive instrument testing and self-assessment. The operation steps were the same as the first visit.

[0202] 3.3 Clinical Assessment

[0203] The safety and efficacy were evaluated by a dermatologist on the subjects' facial skin condition.

[0204] 3.3.1 Security Assessment

[0205] Evaluation indicators: erythema, edema, dryness, and scaling.

[0206] Assessment criteria: 0-3 point 4-level rating scale: 0 = none, 1 = mild, 2 = moderate, 3 = severe; the lower the score, the better the skin tolerance.

[0207] 3.3.2 Efficacy Evaluation

[0208] Evaluation parameters: Acne count (including inflammatory papules, pustules, whiteheads, and blackheads).

[0209] 3.4 Instrument Testing

[0210] 3.4.1 Facial Image Acquisition and Analysis System (Visia-CR 4.3, Canfield Scientific, Inc., USA)

[0211] This device features multiple light sources, including standard light, cross-polarized light, and parallel-polarized light, enabling image capture from three angles. Combined with specialized analysis software, it can quantitatively evaluate facial features.

[0212] (Miravex Limited, Ireland)

[0213] Spatial and spectral analysis using 24 LEDs of 7 different wavelengths can reconstruct skin surface features, which can then be analyzed using specialized software to determine skin surface characteristics and color.

[0214] All the above tests were conducted in a laboratory environment with a controlled temperature of 18–22°C and a relative humidity of 40–60%. Subjects were not allowed to leave the laboratory environment during the testing period.

[0215] 4. Statistical methods

[0216] The experimental results were statistically analyzed using SPSS Statistics 22.0. Mean and standard deviation were calculated for continuous data, and the Shapiro-Wilk method was applied for normality testing. Paired t-tests were used for data conforming to a normal distribution; otherwise, the relevant sample rank-sum test was used. Ordinal data were expressed as sums (minimum, median, maximum), and the relevant sample rank-sum test was used for statistical analysis. Net change = evaluation value after product use - baseline value. Total number of inflammatory pimples = inflammatory papules + pustules; total number of non-inflammatory pimples = whiteheads + blackheads; total number of pimples = inflammatory pimples + non-inflammatory pimples. A significance level of P < 0.05 was defined as follows.

[0217] III. Test Results

[0218] 1. Subjects

[0219] A total of 35 eligible participants were recruited for this trial. Three participants were lost to follow-up, and one participant was excluded due to non-compliance with trial requirements; their data were not included in the statistical analysis. Ultimately, 31 participants completed the entire trial, and their data were included in this study report for statistical analysis. The participants' ages ranged from 18 to 39 years, with a mean age of 29.1 ± 6.7 years. Detailed participant information is shown in Table 4.

[0220] Table 4 Subject Information

[0221] Number of male cases 9 Number of female cases 22 Mean age (mean ± standard deviation, years) 29.1±6.7 Minimum age (years) 18 Maximum age (years) 39

[0222] 2. Clinical assessment

[0223] 2.1 Security Assessment

[0224] The results in Table 5 show that, compared with the baseline values, there were no significant changes in the safety assessment parameter scores of both the experimental and control sides after 3 days, 7 days, 2 weeks, and 4 weeks of product use (P>0.05). See Table 5 for the results.

[0225] Table 5. Security Assessment Results [Sum (Minimum, Median, Maximum)]

[0226]

[0227]

[0228] Note: The lower the score, the better the skin tolerance.

[0229] 2.2 Acne Evaluation

[0230] The results in Table 6 show that, compared with the baseline values, the total number of inflammatory papules, inflammatory pimples, and pimples was significantly reduced after 7 days, 2 weeks, and 4 weeks of use of the herbal composition gel of the present invention (P<0.05); the number of whiteheads and non-inflammatory pimples was significantly reduced after 2 weeks and 4 weeks of use (P<0.05).

[0231] Compared with the baseline, the total number of inflammatory papules and pimples on the control side was significantly reduced after 2 weeks, and the difference was statistically significant (P<0.05).

[0232] The results in Table 7 show that after 7 days of use, the net changes in blackheads, inflammatory acne, and total number of acne were significantly lower than those in the control group (P<0.05); after 2 weeks of use, the net changes in blackheads and total number of acne were significantly lower than those in the control group (P<0.05); and after 4 weeks of use, the net changes in whiteheads, inflammatory papules, non-inflammatory acne, and total number of acne were significantly lower than those in the control group (P<0.05).

[0233] Table 6. Acne Count Assessment Results [Total (Minimum, Median, Maximum)]

[0234]

[0235] Note: The differences compared with the baseline values ​​are statistically significant, *P<0.05,**P<0.01,***P<0.001.

[0236] Table 7. Net Change in Pimple Count [Sum (Minimum, Median, Maximum)]

[0237]

[0238]

[0239] Note: The difference was statistically significant compared with the control group, *P<0.05, **P<0.01.

[0240] 3. Subject self-assessment

[0241] The self-assessment results of the participants are shown in Table 8.

[0242] Table 8. Self-assessment results of the 4-week continuous use trial [n(%)]

[0243]

[0244] 4. Adverse events / reactions of subjects

[0245] No adverse reactions occurred in any of the subjects during the trial.

[0246] IV. Deviation from the Plan

[0247] No deviation from the protocol was observed in this experiment.

[0248] V. Conclusion

[0249] 1. Compared with the baseline values, the safety assessment parameters showed no significant changes at 3 days, 7 days, 2 weeks, and 4 weeks after using the herbal composition gel product of this invention. Therefore, it can be concluded that under the conditions of this experiment, the acne-removing gel is mild (non-irritating) and has good safety.

[0250] 2. Compared with baseline values, after 7 days, 2 weeks, and 4 weeks of using the herbal composition gel of the present invention, the counts of inflammatory papules, inflammatory pimples, and total pimples were significantly reduced; after 2 weeks and 4 weeks of using the acne-removing gel, the counts of whiteheads and non-inflammatory pimples were significantly reduced. After 7 days of using the acne-removing gel, the net change in the counts of blackheads, inflammatory pimples, and total pimples was significantly lower than that of the control; after 2 weeks of use, the net change in the counts of blackheads and total pimples was significantly lower than that of the control; after 4 weeks of use, the net change in the counts of whiteheads, inflammatory papules, non-inflammatory pimples, and total pimples was significantly lower than that of the control. Therefore, it can be concluded that under the conditions of this experiment, the acne-removing gel has acne-removing efficacy.

[0251] 3. No adverse events / reactions related to the study product occurred during this study.

[0252] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A traditional Chinese medicine composition with acne-removing effects, characterized in that, Including the following parts by weight of raw materials: Forsythia suspensa 10-20 parts, Sophora flavescens 5-15 parts, Portulaca oleracea 2-8 parts and Salvia miltiorrhiza 10-20 parts.

2. The traditional Chinese medicine composition according to claim 1, characterized in that, Including the following parts by weight of raw materials: Forsythia suspensa 13-17 parts, Sophora flavescens 7-13 parts, Portulaca oleracea 4-6 parts and Salvia miltiorrhiza 13-17 parts.

3. The method for preparing the traditional Chinese medicine composition according to claim 1 or 2, characterized in that, Includes the following steps: The forsythia, sophora flavescens, purslane, and salvia miltiorrhiza were mixed with an ethanol solution, refluxed for extraction, and the collected filtrate was concentrated in the first stage. After obtaining the concentrated solution, water was added, the solution was allowed to stand, filtered, and the collected filtrate was concentrated in the second stage to obtain the traditional Chinese medicine composition.

4. The preparation method according to claim 3, characterized in that, The total mass ratio of Forsythia suspensa, Sophora flavescens, Portulaca oleracea, and Salvia miltiorrhiza to the volume ratio of the ethanol solution is 1 g: 6-10 mL; the volume percentage of the ethanol solution is 60-80%; the reflux extraction is performed 1-3 times, with each extraction lasting 0.5-1.5 h; the volume ratio of the concentrate to water is 1:3-5; and the settling method is to let it stand at 2-6°C for 10-14 h.

5. A traditional Chinese medicine compound composition with acne-removing effects, characterized in that, The traditional Chinese medicine compound composition includes artemisia annua essential oil and a traditional Chinese medicine composition; the traditional Chinese medicine composition is the traditional Chinese medicine composition according to claim 1 or 2 or the traditional Chinese medicine composition prepared by the preparation method according to claim 3 or 4; The mass ratio of the artemisia annua essential oil to the traditional Chinese medicine composition is 0.1:6.5-102.

6. A method for preparing the traditional Chinese medicine compound composition according to claim 5, characterized in that, Includes the following steps: The artemisia annua essential oil and the traditional Chinese medicine composition were mixed to prepare a traditional Chinese medicine compound composition.

7. A traditional Chinese medicine composition gel with acne-removing effects, characterized in that, The traditional Chinese medicine composition gel includes active ingredients and excipients; the mass ratio of the active ingredients to the excipients is (6.5-7):(93-93.5); The active ingredient is selected from any of the following: (a) The traditional Chinese medicine composition as described in claim 1 or 2; (b) A traditional Chinese medicine composition prepared by the preparation method according to claim 3 or 4; (c) The traditional Chinese medicine compound composition as described in claim 5; (d) A traditional Chinese medicine compound composition prepared by the preparation method described in claim 6.

8. The traditional Chinese medicine composition gel according to claim 7, characterized in that, The excipients include one or more of the following: butanediol, 1,2-pentanediol, polyglycerol-3, 1,2-hexanediol, hydrolyzed sodium hyaluronate, sodium hyaluronate, ammonium acryloyldimethyl taurate / VP copolymer, acrylate / C10-30 alkanol acrylate crosspolymer, cocoyl alcohol polyether-7, PPG-1-PEG-9 lauryl glycol ether, PEG-40 hydrogenated castor oil, p-hydroxyacetophenone, arginine, zinc gluconate, ethylhexylglycerin, and purified water. The mass ratio of butanediol, 1,2-pentanediol, polyglycerol-3, 1,2-hexanediol, hydrolyzed sodium hyaluronate, sodium hyaluronate, ammonium acryloyldimethyl taurate / VP copolymer, acrylate / C10-30 alkanol acrylate crosspolymer, coconut oil polyether-7, PPG-1-PEG-9 lauryl glycol ether, PEG-40 hydrogenated castor oil, p-hydroxyacetophenone, arginine, zinc gluconate, ethylhexylglycerin, and pure water is 5.5:2:1:0.85:0.07:0.05:0.8:0.8:0.25:0.09:0.05:1.5:0.25:0.05:(79.74~79.84).

9. The method for preparing the traditional Chinese medicine composition gel according to claim 8, characterized in that, Includes the following steps: (1) Mix water, butanediol, p-hydroxyacetophenone, hydrolyzed sodium hyaluronate, sodium hyaluronate and the active ingredient described in claim 7, and heat to 80-85°C to obtain mixture 1; (2) Mix ammonium acryloyl dimethyl taurate / VP copolymer, acrylate / C10-30 alkanol acrylate crosslinking polymer and water to obtain mixture 2; (3) Mix mixture 1 and mixture 2 to obtain mixture 3, and keep the temperature of mixture 3 at 80-85℃; (4) Add arginine and water to mixture 3, stir evenly, and start cooling to 50-55℃. Then add 1,2-pentanediol, 1,2-hexanediol and ethylhexylglycerin, stir evenly, and cool to 45-50℃. Then add polyglycerol-3, zinc gluconate and water, stir evenly, and make the temperature 40-45℃. Add coconut oil alcohol polyether-7, PPG-1-PEG-9 lauryl glycol ether, PEG-40 hydrogenated castor oil and water, and make the temperature 35-40℃.

10. The use of the traditional Chinese medicine composition according to claim 1 or 2, the traditional Chinese medicine composition prepared by the preparation method according to claim 3 or 4, the traditional Chinese medicine compound composition according to claim 5, the traditional Chinese medicine compound composition prepared by the preparation method according to claim 6, the traditional Chinese medicine composition gel according to claim 7 or 8, or the traditional Chinese medicine composition gel prepared by the preparation method according to claim 9 in at least one of the following (S1) to (S4): (S1) Preparation of antibacterial products; (S2) Preparation of oil-controlling products; (S3) Preparation of anti-inflammatory products; (S4) Prepare acne treatment products.