Green white beard fungus and application thereof
By using *Bacillus virosa* and its inoculants, the problem of controlling rice sheath blight has been solved, achieving efficient and environmentally friendly biological control and reducing the severity of the disease.
Patent Information
- Application Number
- CN202511914482.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-18
- Publication Date
- 2026-02-06
AI Technical Summary
Existing technologies are insufficient to effectively control rice sheath blight, and traditional control methods pose environmental risks, raise public concerns, and have low antibacterial efficiency.
Biological control is achieved by using Albifimbriaviridis and its inoculants, which are applied to the rhizosphere soil of rice or soaked in seeds, combined with the spraying of spore suspension, to inhibit the growth of Rhizoctonia solani.
It significantly reduces the incidence and disease index of rice sheath blight, provides an efficient and environmentally friendly disease control solution, and promotes healthy rice production.
Smart Images
Figure CN121472049A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biotechnology, and in particular to a strain of *Phyllostachys edulis* and its applications. Background Technology
[0002] Rice sheath blight, caused by infection with Rhizoctonia solani (asexual stage), is a devastating soil-borne disease in rice production. In recent years, due to the promotion of high-yield varieties and excessive application of nitrogen fertilizer, the frequency of disease occurrence and the extent of yield reduction (often reaching 10%-20%, and exceeding 50% in severe cases) have increased significantly, threatening food security. Current control methods have obvious shortcomings: agricultural control (such as sclerotium retrieval and optimized cultivation) is insufficient to eradicate the disease; chemical agents (such as hexaconazole and Jinggang-hexaconazole) easily lead to pathogen resistance and environmental and food safety issues; and the promotion of genetically modified disease-resistant varieties is limited by public concerns about risks. Against this backdrop, green and sustainable biological control has become a core research direction.
[0003] Among the antagonistic microorganisms already in use, Trichoderma, biocontrol bacteria, and actinomycetes (such as Streptomyces hydrophila producing jinggangmycin) can exert their effects by inhibiting the growth of pathogens or producing antimicrobial substances. However, some of them suffer from limited antimicrobial efficiency, weak environmental adaptability, and difficulty in large-scale cultivation. In contrast, the *Trichoderma viride* strain studied in this study has shown outstanding antagonistic potential against rice sheath blight pathogens through previous validation. Compared with existing biocontrol bacteria, its core advantages are: potentially more efficient antimicrobial mechanisms (such as stronger hyphal competition and superior antimicrobial metabolites), wider environmental adaptability (such as a wide range of temperature and humidity tolerance), and ease of large-scale cultivation and application.
[0004] In summary, the in-depth development and application of *Clerodendrum cyrtonema* is expected to break through the existing technical bottlenecks in the biological control of rice sheath blight, providing a new solution for building an efficient, environmentally friendly, and sustainable disease control system, and has important practical significance for promoting green and safe rice production. Summary of the Invention
[0005] To address the aforementioned technical problems, the present invention aims to provide a strain of *Phyllostachys edulis* and its applications. This *Phyllostachys edulis* can effectively control rice sheath blight.
[0006] To achieve the above objectives, the first aspect of the present invention provides a strain of *Phyllostachys pubescens* (… Albifimbriaviridis Its accession number is: CCTCC NO: M 20251911.
[0007] A second aspect of the present invention provides a microbial agent, wherein the active ingredient of the microbial agent comprises the green and white mustard fungus of the first aspect.
[0008] The third aspect of this invention provides a method for preparing the second aspect of the bacterial agent.
[0009] The fourth aspect of the present application provides application of the green-white hypomyces of the first aspect and / or the microbial agent of the second aspect in the prevention and treatment of rice sheath blight.
[0010] The fifth aspect of the present application provides a method for preventing and treating rice sheath blight, which comprises applying the spore suspension of the green-white hypomyces of the first aspect with a concentration not less than 1x10 8 CFU / ml to the rhizosphere soil of rice or applying the microbial agent of the second aspect to the field soil before sowing or transplanting, or soaking the seeds with the microbial agent of the second aspect for 4-6h, and then spraying the spore suspension of the green-white hypomyces again at the 3-6 leaf stage of rice to consolidate the efficacy.
[0011] In summary, the present application has the following beneficial effects: the green-white hypomyces provided by the present application can be used for preventing and treating rice sheath blight. BRIEF DESCRIPTION OF DRAWINGS
[0012] Figure 1 is a plate culture diagram of the green-white hypomyces of the present application, wherein the left diagram is a front view and the right diagram is a back view; Figure 2 is a morphological diagram of the spores of the green-white hypomyces of the present application under an optical microscope; Figure 3 is a morphological diagram of the mycelium of the green-white hypomyces of the present application under an optical microscope; Figure 4 is a phylogenetic tree of the green-white hypomyces of the present application; Figure 5 is a plate CK control diagram of the rice sheath blight fungus; Figure 6 is a four-point control diagram of the green-white hypomyces SJ-50F of the present application and the Rhizoctonia solani; Figure 7 is a potting experiment physical diagram of the green-white hypomyces of the present application; Figure 8 is an experiment diagram of the influence of the green-white hypomyces SJ-50F fermentation liquid of the present application with different concentrations on the mycelium growth of the Rhizoctonia solani; Figure 9 is a statistical columnar diagram of the influence of the green-white hypomyces SJ-50F fermentation liquid of the present application with different concentrations on the mycelium growth of the Rhizoctonia solani; Figure 10 is a statistical columnar diagram of the seed germination and growth situation after the green-white hypomyces SJ-50F crude extract of the present application is used for treatment; Figure 11 is an influence experiment physical diagram of the green-white hypomyces SJ-50F strain crude extract on the seed germination and seedling growth of rice.
[0013] BIOLOGICAL PRESERVATION The green-white hypomyces provided by the present application has the following advantages: AlbifimbriaviridisThe strain name is: SJ-50F, and its classification name is: *Clerodendrum chloroticum* SJ-50F. Albifimbria viridis SJ-50F was deposited on August 27, 2025, at the China Center for Type Culture Collection, No. 299 Bayi Road, Wuchang District, Wuhan, Hubei Province, China (Wuhan University), with accession number CCTCC NO: M20251911. Detailed Implementation
[0014] The endpoints and any values of the ranges disclosed herein are not limited to the precise ranges or values, and these ranges or values should be understood to include values close to these ranges or values. For numerical ranges, the endpoint values of the various ranges, the endpoint values of the various ranges and individual point values, and individual point values can be combined with each other to obtain one or more new numerical ranges, which should be considered as specifically disclosed herein.
[0015] In this invention, *Bacillus chloriti* SJ-50F and *Bacillus chloriti* CCTCC NO: M 20251911 are the same strain, and they have the same meaning. Their names (number SJ-50F) can be used interchangeably.
[0016] To make the objectives, technical solutions, and beneficial effects of the present invention clearer, the preferred embodiments of the present invention will be described in detail below to facilitate understanding by those skilled in the art. Example
[0017] 1. Isolation of strains In February 2024, a biocontrol fungus was isolated from rice and potato rotation soil in Shuangjiang County, Yunnan Province, and named: Green White Beard Fungus (SJ-50F).
[0018] 2. Identification of strains 2.1 Inoculate the strain onto PDA medium, as shown in the attached... Figure 1 As shown, the colonies are round with highly developed aerial hyphae, giving them a fluffy, velvety or felt-like appearance. The texture is loose and dry, with a noticeable "powdery" or "velvety" feel on the surface (due to the accumulation of numerous aerial hyphae and spores). The colonies exhibit a clear color gradient and layering, gradually thinning out radially / ringly from the center outwards, with the color also lightening accordingly, creating a striking "white and green" visual effect against the white substrate.
[0019] The colonies are powdery. Initially, the mycelium is white. Sporulation begins after about 7 days, and the spores are mostly dark green. After about 6 days, the center of the colony begins to turn dark green, and after about 15 days, almost all of them have changed color.
[0020] 2.2 Morphological observation of mycelia and spores of the strain under an optical microscope As attached Figure 2As shown, the mycelium of the strain is colorless and smooth, with a diameter of 1.5-2.0 μm, and the conidial cells are densely clustered on the mycelium, conidiophores or swollen vesicles, spherical to bottle-shaped, with a size of 2.4-5.7 μm x 1.9-3.3 μm, and the conidiophore is about 14 μm long, with small teeth on the shaft, and is knee-shaped curved. The conidial cells and vesicles often multiply, and the conidial heads are quite dense on the conidiophores or mycelium. The conidia are colorless, smooth, single-celled, mostly short cylindrical, and a few oval, with blunt ends at both ends. The size of the conidia is 2.5-6.5 μm x 1.3-2.2 μm.
[0021] 2.3 Molecular identification After the target fungal strain was cultured and pretreated for genome DNA extraction, the core conserved fragment for fungal species identification, ITS (internal transcribed spacer, containing ITS1, 5.8S rDNA, ITS2), was used as the amplification target, and specific primer combination (forward primer ITS1: TCCGTAGGTGAACCTGCGG; reverse primer ITS4: TCCTCCGCTTATTGATATGC) was used for PCR amplification. After 1.5% agarose gel electrophoresis verification (confirming the presence of 500-700bp target band, no non-specific amplification), the qualified PCR amplification product was selected, and the sequence determination of the target fragment was completed by Sanger double-end sequencing technology by Shengong Bioengineering (Shanghai) Co., Ltd. The ITS sequence results of the target strain were submitted to the NCBI website (https:llblast.ncbi.nlm.nih.gov / Blast.cgi), and after BLAST comparison, sequences with high homology to the target strain were selected and downloaded, and then MEGA7.0 software was used to construct a phylogenetic tree by neighbor-joining method (neighbor-joining method, NJ) with 1000 times of bootstrap verification, as shown in the following figure. Figure 4
[0022] Strain and reference standard strain Albifimbriaviridis The similarity of the strain and the reference standard strain was 98.55%; combined with the morphological characteristics, it was determined that the SJ-50F strain was Albifimbria viridis .
[0023] Sequence (SEQ ID NO. 1): AACAATACTCCCCAAAACCACCTTTGTGACCTTACCATATTGTTGCTTCGGCGGGACCGCCCCGGCGCCTTCGGGCCCGGAACCAGGCGCCCGCCGGAGGCCCCAAACTCTTATGTCTTTAGTGGTTTTCTCCTCTGAGTGACACATAAACAAATAAATAAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAGGCCCCCAGTGCCTGGTGTTGGGGATCGGCCCAGCCTTCTCGCAAGGCCGCCGGCCCCGAAATCTAGTGGCGGTCTCGCTGTAGTCCTCCTCTGCGTAGTAGCACAACCTCGCAGTTGGAACGCGGCGGTGGCCATGCCGTTAAACACCCCACTTCTGAAAGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAAAAGCCGGAGGAA.
[0024] 2.4 Preparation of the green-white mushroom agent The green-white mushroom (SJ-50F) strain was inoculated on PDA medium and cultured at 25-30°C for 5-10 days to activate the strain.
[0025] 1. Preparation of the agent: Prepare the potato dextrose broth (PDB) and sterilize it by high-pressure steam at 121°C for 20 min, then cool it to room temperature for standby. After activation, the green-white mushroom (SJ-50F Albifimbria viridis SJ-50F) was inoculated into sterile PDB medium and placed in a constant temperature shaker at 28°C and 200 r·min⁻¹ for 72 h to obtain the fermentation broth. The fermentation broth was separated by centrifugation (4000-6000 r / min, 10-15 min) and other methods, and the bacterial precipitate was collected. Then the bacterial precipitate was mixed with an appropriate amount of carrier such as diatomite or corn cob powder, and the viable cell count of the green-white mushroom in the agent was adjusted to 1×10 8 - 1×10¹ 0CFU / g, the bacterial agent is made into granular formulation.
[0026] 2.5 Greenish-white mushroom SJ-50F strain of Rhizoctonia solani (AG-1) Rhizoctoniasolani ) YM-Q-7 plate confrontation Experimental procedure: 1. Preparation of culture medium: Prepare sterilized basic medium (such as PDA), pour flat plate and cool and solidify, set 3 repeated dishes and blank control.
[0027] 2. Strain pretreatment: Greenish-white mushroom and rhizoctonia solani are activated in advance, rhizoctonia solani takes the active area of mycelium edge, and greenish-white mushroom picks mycelium block.
[0028] 3. Four-point inoculation: In a sterile operation table, position the culture dish with cross lines, inoculate greenish-white mushroom 1 block at each of the four points equidistant from the dish wall (2-3 cm from the dish wall), and inoculate rhizoctonia solani at the center point. The blank control plate only inoculates rhizoctonia solani.
[0029] 4. Constant temperature culture: Place the plate upside down in a 28℃ constant temperature incubator and culture for 3-7 days until the rhizoctonia solani on the blank control plate grows more than 2 / 3 of the plate.
[0030] Inhibition rate = [1 - actual growth area of pathogen S in treatment group / theoretical growth area of pathogen S0 in control group] x 100% Experimental results: As shown in Figure 5 and Figure 6 , compared with the blank control, an antibacterial zone appears between greenish-white mushroom and rhizoctonia solani, and statistical analysis shows that the inhibition rate is as high as 82.36%.
[0031] 2.6 Greenish-white mushroom SJ-50F strain pot verification experiment Preparation of bacterial solution: Wash the mature fungal colonies with sterile water, add a small amount of sterile Tween-80 (final concentration 0.05%), gently shake for 10 min, filter through 3 layers of sterile gauze to remove mycelium fragments, obtain spore suspension, and adjust the spore concentration to 10 8 ~10 9 CFU・mL⁻¹.
[0032] Strain application: After transplanting rice seedlings into pots, inoculate the greenish-white mushroom SJ-50F spore suspension with a concentration of 1×10 8 CFU / ml along the roots, ensure that the bacterial solution penetrates evenly around the roots, set up a control group inoculated with only the pathogen and a treatment group inoculated with SJ-50F antagonistic bacteria 24 hours before inoculation with rhizoctonia solani, each treatment has 3 repeats, and 2-3 rice seedlings are planted in each bottle.
[0033] Pathogen inoculation: 24 h after the strain application, at the near-water sheath of rice plants (2-3 cm from the base), 1 Rhizoctonia cerealis infected fully barley grain was clamped with a sterile forceps, fixed tightly to the sheath, and wrapped with wet defatted cotton (to keep humidity to promote sclerotium germination). After inoculation, the pots were placed in an artificial climate chamber (temperature 28℃, relative humidity 85%, light 12h / d) for culture.
[0034] Investigation time: CK disease occurred after pathogen inoculation, samples were taken and photographed.
[0035] The disease classification standard table is shown in Table 1 below: Table 1 Disease classification standard table
[0036] Incidence rate = {number of diseased plants / total number of plants surveyed} × 100%; Disease index = {sum (number of plants at each level × corresponding level) / total number of plants surveyed × highest disease level} × 100.
[0037] Experimental results: This experiment set two groups of treatment, and compared the regulatory effect of SJ-50F antagonistic bacteria on the pathogenic process of Rhizoctonia cerealis through quantitative indicators. The specific data are as follows: The SJ-50F pretreatment group (inoculated with SJ-50F antagonistic bacteria 24 h before Rhizoctonia cerealis): the leaf disease rate was 90.90%, and the disease index was 49.21 (the disease index classification refers to the "Plant Disease Classification Standard", the value range is 0-100, the higher the value represents the more serious disease). The pathogen control group (only inoculated with Rhizoctonia cerealis): the leaf disease rate reached 100%, and the disease index was 61.76. Compared with the control group, the disease rate of the SJ-50F pretreatment group decreased by 12.55 percentage points, and the disease index decreased significantly by 20.33%, indicating that the SJ-50F antagonistic bacteria can effectively inhibit the pathogenic intensity of Rhizoctonia cerealis and reduce the degree of disease occurrence. 2.7 Fermentation liquid experiment Strains and medium pretreatment, the strains were inoculated on the corresponding plate medium for activation, and the liquid fermentation medium (green white mushroom with liquid PDA) and the base medium for plate were prepared, which were sterilized at 121°C for 20-30 minutes. Liquid fermentation, the activated strains were inoculated into the liquid medium under sterile conditions, and incubated at 28°C with constant temperature oscillation at 200 rpm for 24 hours. The crude fermentation broth was prepared, and the fermentation broth was filtered with sterile gauze or 0.22 μm filter membrane to collect the filtrate. The plate containing the fermentation broth was prepared, different concentrations of crude fermentation broth (set gradient 0, 10%, 30%, 50%) were mixed with 50-60°C base medium, and poured into the plate to solidify, and multiple groups of controls were set. Inoculation of the rhizoctonia, the activated rhizoctonia solani cake was inoculated in the center of the plate, and the plate was incubated at 28°C for 3-7 days. Subsequent detection, the growth rate of rhizoctonia was determined, the inhibition zone and mycelial morphology were observed, and the antagonistic effect of the fermentation broth was evaluated.
[0038] The experimental results are as follows: Figure 8 And Figure 9 It can be seen from The mycelial radius of the control group (CK) was the largest, which was 4.5 cm, which was significantly higher than that of each treatment group (marked as a).
[0039] The concentration gradient of green white mushroom crude extract was set as 10%, 30%, and 50%, and the mycelial radius gradually decreased with the increase of concentration, which was about 2.1 cm, 1.5 cm, and 1.1 cm, respectively, and the difference between groups was significant (marked as a, b, and c, respectively). In summary, the green white mushroom crude extract has an inhibitory effect on mycelial growth, and the higher the concentration, the stronger the inhibitory effect.
[0040] 2.8 Determination of the effect of strain crude extract on rice seed germination and seedling growth 1. Seed pretreatment: Select rice seeds with full grains and uniform size, surface sterilize with 75% ethanol solution for 30 s, then rinse with sterile water for 3 times; then immerse in sodium hypochlorite solution with effective chlorine content of 1% for 10 min, and rinse with sterile water for 5 times to remove residual disinfectant. The disinfected seeds were placed in a clean bench and soaked with sterile water for 24 h, and the sterile water was replaced once during the period.
[0041] 2. Preparation of crude extract: Prepare the potato dextrose broth (PDB) and sterilize it by high-pressure steam at 121°C for 20 min, then cool it to room temperature for standby. After activation, inoculate the green-white mushroom into sterile PDB medium, and place it in a constant temperature shaker at 28°C and 200 r·min⁻¹ for 72 h to obtain the fermentation broth. Centrifuge the fermentation broth in sterile 50 mL centrifuge tubes at 8000 r·min⁻¹ for 20 min, and collect the supernatant. Use a sterile syringe to extract the supernatant, filter it through a 0.22 μm sterile needle filter to remove bacteria, and collect the filtered clear liquid, which is the green-white mushroom crude extract, and store it at 4°C for standby.
[0042] 3. Test design: Use the Petri dish filter paper germination method, and place 2 layers of sterilized qualitative filter paper at the bottom of each Petri dish as the germination substrate. The test has 6 treatment groups, namely the control group (PDB medium filtrate) and the strain crude extract gradient treatment group (original solution, 5-fold dilution, 10-fold dilution, 15-fold dilution, 20-fold dilution, and the diluent is sterile water). Each treatment has 3 biological replicates, and 6 pre-treated seeds are placed in each replicate and evenly arranged on the filter paper.
[0043] 4. Culture conditions: Add 3 mL of the corresponding treatment liquid to each Petri dish (add the same amount of PDB filtrate to the control group), seal it, and place it in an intelligent artificial climate incubator for culture. The culture conditions are set as follows: temperature 28°C, light intensity 3000 lx, light-dark cycle 12 h / 12 h, and continuous culture for 5-7 d, during which the filter paper is kept moist (add a small amount of corresponding treatment liquid as needed to avoid seed water shortage).
[0044] 5. Index determination: After the culture ends, count the seed germination, and use a vernier caliper (accuracy 0.01 mm) to measure the root length (the straight-line distance from the seed radicle base to the root tip) and the bud length (the straight-line distance from the seed bud base to the bud tip) of each germinated seed, and record the data for subsequent statistical analysis.
[0045] Experimental results: As Figure 10 and 11The average length of the seedlings of the control group (PDB medium filtrate) was 2.26 cm, and the average root length was 3.92 cm. The average length of the seedlings of the strain crude extract original liquid treatment group was 2.06 cm, and the average root length was only 0.58 cm. The average length of the seedlings of the 5-fold dilution liquid treatment group was 2.2 cm, and the average root length was 2.71 cm. The average length of the seedlings of the 10-fold dilution liquid treatment group was 2.53 cm, and the average root length was 3.94 cm. The average length of the seedlings of the 15-fold dilution liquid treatment group was 2.63 cm, and the average root length was 4.44 cm. The average length of the seedlings of the 20-fold dilution liquid treatment group reached 3.96 cm, and the average root length was 4.54 cm. As can be seen from the root length column chart, the crude extract of the green-white mycelium had a strong inhibitory effect on the root growth of the seeds when the concentration was 0 times. The inhibitory effect still existed when the concentration was 5 times. When the concentration was 10 times, 15 times, or 20 times, the root length had no significant difference with the control group, and even had a slight promotion. As can be seen from the seedling length column chart, the crude extract of the green-white mycelium had a significant promoting effect on the seedling growth when the concentration was 20 times. When the concentration was 0 times, 5 times, 10 times, or 15 times, the seedling length had no significant difference with the control group, and even had a slight promotion.
Claims
1. A strain of green and white beard fungus ( Albifimbria viridis Its accession number is: CCTCC NO: M 20251911.
2. A microbial agent, wherein the active ingredient of the microbial agent comprises *Clerodendrum thomsoniae* as described in claim 1.
3. The method for preparing the microbial agent as described in claim 2, characterized in that: The method includes S1 strain was inoculated onto PDA medium and cultured at 25-30℃ for 5-10 days to activate the strain; S2, Preparation of bacterial agent: Centrifuge the fermentation broth at 4000-6000 r / min for 10-15 minutes to separate the solid and liquid components, and collect the bacterial precipitate; then mix the bacterial precipitate evenly with diatomaceous earth and corn cob powder, and adjust the viable count of *Bacillus thunbergii* in the bacterial agent to 1×10⁻⁶. 8 - 1×10¹ 0 CFU / g, formulated as granules for bacterial preparation.
4. The application of the *Clerodendrum cyrtonema* as described in claim 1, and / or the fungal agent as described in claim 2, in the control of rice sheath blight.
5. A method for controlling rice sheath blight, characterized in that: The method includes using a concentration of not less than 1×10 8 Apply the CFU / ml *Vibrio vulgaris* spore suspension as described in claim 1 to the rice rhizosphere soil, or apply the fungal agent as described in claim 2 or 3 to the field soil before sowing or transplanting, or soak the seeds in water with the fungal agent as described in claim 2 or 3 for 4-6 hours, and spray the *Vibrio vulgaris* spore suspension again at the 3-6 leaf stage of rice to consolidate the efficacy.
6. In the application of claim 4 or the method of claim 5, the pathogen of rice sheath blight is Rhizoctonia solani (… Rhizoctonia solani ).