Construction method and application of pyruvate-producing kluyveromyces marxianus

Abstract

The invention discloses a construction method and application of pyruvate-producing Kluyveromyces marxianus, and belongs to the technical field of biology. According to the invention, an auxotroph strain of K. marxianus NBRC1777 is used as an original strain, and a kluyveromyces marxianus engineering strain K. marxianus PA6 for efficiently producing pyruvic acid is obtained through metabolic engineering transformation. The strain can produce 83.6 g / L pyruvic acid in the fermentation period of 60 hours in the fermentation at the level of a 5 L fermentation tank. The strain effectively blocks a by-product pathway and enhances key enzyme activity, realizes high concentration of carbon flow to pyruvic acid, obviously improves the yield and final production concentration in unit time, reduces pollution risk and saves cooling cost through high-temperature fermentation, improves the final production concentration and fermentation stability of pyruvic acid through acid resistance, and improves the yield of pyruvic acid. The industrial application potential of pyruvic acid production is realized.

Description

Technical Field

[0001] This invention relates to a method for constructing a pyruvate-producing strain of Kluyveromyces martensii and its application, belonging to the field of biotechnology. Background Technology

[0002] Pyruvic acid (PA) is an α-keto acid of significant industrial value, serving as a key intermediate in glycolysis and the synthesis of various substances. In the metabolic network of organisms, PA is located at the intersection of multiple metabolic pathways, including carbohydrates, fats, and amino acids. It can be further converted into acetyl-CoA, lactic acid, ethanol, amino acids, and various organic acids. Therefore, it is not only a crucial hub molecule in cellular energy metabolism but also a precursor to many high-value-added compounds. Pyruvic acid has wide applications in pharmaceuticals, cosmetics, food, and chemical industries. For example, in the pharmaceutical field, pyruvate can be used as a raw material for treating diseases such as cerebral ischemia, diabetic complications, and inflammatory reactions, exhibiting antioxidant properties, improving energy metabolism, and protecting cell function. In the cosmetics industry, pyruvate is widely used as a fruit acid skincare ingredient for exfoliation, lightening pigmentation, and promoting skin renewal. In the food industry, pyruvate and its salts (such as sodium pyruvate and calcium pyruvate) can be used as nutritional fortifiers, acidity regulators, and sports nutrition supplements. In the chemical industry, pyruvate is also a key raw material for synthesizing amino acids such as L-tryptophan and L-phenylalanine, as well as various fine chemical products. With the rapid development of the health industry, functional foods, and green chemicals, the market demand for pyruvate continues to grow, and its application areas are expected to expand further in the future.

[0003] Currently, pyruvate production methods mainly include chemical synthesis, fermentation, and enzymatic catalysis. Chemical synthesis typically uses tartaric acid, lactic acid, or acetaldehyde as starting materials, obtaining pyruvate through high-temperature oxidation, decarboxylation, or catalytic oxidation reactions. This method is fast and uses readily available raw materials, but suffers from low product purity, numerous byproducts, high energy consumption, and severe environmental pollution, which does not align with the trend of green and sustainable development. Enzymatic catalysis relies on purified enzyme systems (such as lactate oxidase and lactate dehydrogenase) to convert substrates into pyruvate. It offers advantages such as mild reaction conditions, high selectivity, and environmental friendliness. However, due to the high cost and poor stability of enzyme preparation, as well as the high cost of substrates, large-scale industrial application is currently difficult. In contrast, microbial fermentation utilizes renewable biomass as raw material, achieving efficient pyruvate synthesis through optimized strain metabolic pathways, and is a key development direction currently attracting attention from both academia and industry. Fermentation offers advantages such as controllable production processes, a wide range of raw material sources (such as glucose, xylose, and starch hydrolysate), high product purity, and low environmental burden, making it particularly suitable for large-scale and green production.

[0004] In research on the microbial fermentation production of pyruvate, commonly used chassis strains include Escherichia coli (E. coli).Escherichia coli Bacillus subtilis ( Bacillus subtilis ), brewer's yeast ( Saccharomyces cerevisiae These strains have advantages such as clear metabolic background and mature genetic manipulation, but they also have certain limitations. For example, although *E. coli* grows rapidly and has a high yield, it easily accumulates toxic byproducts and is not suitable for direct use in food-grade or pharmaceutical-grade applications; although *Bacillus subtilis* is a recognized safe (GRAS) strain, its ability to utilize some carbon sources is limited; *Saccharomyces cerevisiae* has excellent acid and alcohol tolerance, but it is prone to ethanol bypass metabolism during pyruvate fermentation, leading to product loss. Therefore, there is an urgent need to obtain a new type of genetically engineered strain that produces pyruvate. *Kluyveromyces martensii* (Kluyveromyces 'Marx') Kluyveromyces marxianus This is a widely recognized safe (GRAS) non-traditional yeast that combines high-temperature tolerance, rapid growth, broad-spectrum carbon source utilization, and low ethanol production. It can also efficiently secrete products at higher temperatures, significantly reducing contamination risk and cooling energy consumption. Its genome has been sequenced, providing an editable genetic toolkit suitable for metabolic engineering. Compared to traditional chassis strains, K. marxianus Not only can it utilize low-cost raw materials such as whey and xylose, but it can also reduce the generation of by-products, better meeting the needs of green and low-carbon industrial production. Therefore, it will... K. marxianus The development of engineered strains for high pyruvate production is expected to break through the bottlenecks of traditional fermentation systems, increase pyruvate yield and purity, reduce production costs, and broaden application scenarios. Summary of the Invention

[0005] To address the existing technical problems, the present invention aims to provide a method for constructing a *Kluyveromyces martensii* strain with significantly enhanced pyruvate production capacity, and its application, thereby achieving green and efficient pyruvate production and expanding its application scope in the pharmaceutical, food, and chemical industries. This invention provides a method for producing pyruvate from *Kluyveromyces martensii*, using the wild-type strain NBRC 1777 as the starting strain, and obtaining a high-pyruvate-producing engineered strain through a series of metabolic engineering modifications. K. marxianus PA6 further optimized the fermentation medium composition and fermentation conditions of the engineered strain, enabling the engineered strain to tolerate low pH, while the pyruvate yield can reach 83.6 g / L.

[0006] The first technical solution provided by this invention is a genetically engineered bacterium that produces pyruvate, wherein the genetically engineered bacterium is based on Kluyveromyces martensii as the starting strain and pyruvate decarboxylase is knocked out. PDC1 Genes and glycerol 3-phosphate dehydrogenase gpd1Genes are modified to reduce byproducts by shifting the carbon flow towards pyruvate production. This is achieved by weakening pyruvate dehydrogenase while ensuring the host's basic metabolic needs are met. PDH1 The expression of [a specific protein] reduces pyruvate consumption to increase pyruvate production. This was subsequently achieved through overexpression of mitochondrial pyruvate carrier protein. MPC1 It promotes the excretion of pyruvate.

[0007] In some embodiments, the PDC1 Gene, gpd1 The nucleotide sequences of the genes are shown in SEQ ID NO.3~4, respectively.

[0008] In some embodiments, the PDH1 The nucleotide sequence of the gene is shown in SEQ ID NO.5.

[0009] In some implementations, by truncating the Kluyveromyces macrocephalae... PDH1 Genes, to achieve PDH1 Attenuated gene expression, truncated PDH1 The nucleotide sequence of the gene is shown in SEQ ID NO.10.

[0010] In some embodiments, the protein encoding mitochondrial pyruvate carriers is... MPC1 The nucleotide sequence of the gene is shown in SEQ ID NO. 6.

[0011] In some embodiments, the starting strain is a Kluyveromyces masculinii uracil-deficient strain ( K. marxianus PA2).

[0012] In some embodiments, the *Kluyveromyces martensii* uracil-deficient strain ( K. marxianus PA2 is a strain of wild-type Kluyveromyces martensii. K. marxianus Based on NBRC1777, the original orotic acid-5'-phosphate decarboxylase was knocked out. ura3 Gene, knockout of ATP-dependent DNA helicase II Ku70 Gene.

[0013] In some embodiments, the ura3 Gene, Ku70 The nucleotide sequences of the genes are shown in SEQ ID NO.1~2, respectively.

[0014] The second technical solution provided by this invention is a method for constructing genetically engineered bacteria, wherein the method involves knocking out a uracil-deficient strain of Kluyveromyces martensii (Kluyveromyces 'Max'). K. marxianus PA2) PDC1 Genes and gpd1Genes, through truncation PDH1 Gene attenuated expression and overexpression of mitochondrial pyruvate carrier protein MPC1 .

[0015] In some embodiments, the PDC1 Gene, gpd1 The nucleotide sequences of the genes are shown in SEQ ID NO.3~4, respectively.

[0016] In some embodiments, the PDH1 The nucleotide sequence of the gene is shown in SEQ ID NO.5.

[0017] In some implementations, truncated PDH1 The nucleotide sequence of the gene is shown in SEQ ID NO.10.

[0018] In some embodiments, the protein encoding mitochondrial pyruvate carriers is... MPC1 The nucleotide sequence is shown in SEQ ID NO. 6.

[0019] In some embodiments, the *Kluyveromyces martensii* uracil-deficient strain ( K. marxianus PA2 is a strain of wild-type Kluyveromyces martensii that has had its original orotic acid-5'-phosphate decarboxylase knocked out. ura3 Gene, knockout of ATP-dependent DNA helicase II Ku70 Gene.

[0020] In some embodiments, the ura3 Gene, Ku70 The nucleotide sequences of the genes are shown in SEQ ID NO.1~2, respectively.

[0021] The third technical solution provided by the present invention is a method for producing pyruvate by fermentation. The method involves adding the genetically engineered bacteria described in the first technical solution to a fermentation system using sodium hydroxide as a neutralizing agent, glucose as a basic carbon source, and ammonium sulfate as a basic nitrogen source for fermentation culture.

[0022] In some embodiments, the concentration of sodium hydroxide in the fermentation system is 8 mol / L.

[0023] In some implementations, the initial glucose concentration is 100 g / L.

[0024] In some embodiments, the pH of the fermentation process is controlled at 5 to 6.

[0025] In some embodiments, the aeration rate of the fermentation process is 3 to 5 L min⁻¹.

[0026] In some embodiments, the stirring speed during the fermentation process is 100-400 rpm.

[0027] In some embodiments, the fermentation process is carried out at a temperature of 37-40 °C.

[0028] The fourth technical solution provided by the present invention is the application of the genetically engineered bacteria described in the first technical solution, or the method described in the second technical solution, or the method described in the third technical solution in the preparation of pyruvate or products containing pyruvate.

[0029] Compared with the prior art, the beneficial effects of the present invention are as follows: This invention is based on K. marxianus Starting with an auxotrophic strain of NBRC1777, a Kluyveromyces martensii strain that efficiently produces pyruvate was obtained through metabolic engineering. K. marxianus PA6. In a 5 L fermenter, this strain can produce 83.6 g / L of pyruvate over a 60-hour fermentation cycle. The strain described in this invention effectively blocks byproduct pathways and enhances the activity of key enzymes, achieving a high concentration of carbon flow to pyruvate, significantly increasing yield per unit time and final product concentration. Furthermore, high-temperature fermentation reduces contamination risk and saves cooling costs. The acid resistance of the engineered strain improves the final pyruvate concentration and fermentation stability, demonstrating its potential for industrial application in pyruvate production. Attached Figure Description

[0030] Figure 1 for K. marxianus Metabolic pathway diagram of PA6 production of pyruvate.

[0031] Figure 2 The recombinant plasmid pY26- in Example 1 of this invention MPC1 The plasmid spectrum.

[0032] Figure 3 The recombinant plasmid pUCC01- in Example 5 of this invention NS3 The plasmid spectrum.

[0033] Figure 4 The strain in Example 2 of this invention K. marxianus PA3 PDC1 The gene knockout PCR products were verified by agarose gel electrophoresis. Lane M represents the 10000 bp marker, lanes 1-11 represent the bands of different transformants, and lane 12 is the control strain.

[0034] Figure 5 The strain in Example 3 of this invention K. marxianus PA4 gpd1Gene knockout PCR products were verified by agarose gel electrophoresis. Lane M represents a 10,000 bp marker, lane 1 is the control strain, and lanes 2-8 represent bands of different transformants.

[0035] Figure 6 The strain in Example 4 of this invention K. marxianus PA5 PDH1 The PCR products of gene truncation were verified by agarose gel electrophoresis. Lane M represents a 10,000 bp marker, lanes 1-5 are bands of different transformants, and lane 6 represents the control strain.

[0036] Figure 7 The strain in Example 5 of this invention K. marxianus PA6 MPC1 The PCR products of the gene integrated into the genome were verified by agarose gel electrophoresis. Lane M represents the 5000 bp marker, lane 1 is the control strain, and lanes 2-8 represent the bands of different transformants.

[0037] Figure 8 The genetically engineered strain of Example 6 of this invention K. marxianus The results of fed-batch fermentation of PA6 in a 5 L fermenter. Figure A shows the fermentation results of different strains, Figure B shows the pH levels during fermentation, and Figure C shows the OD levels during fermentation. 600 The production of residual sugar and pyruvate. Detailed Implementation

[0038] Reference Appendix Figures 1-8 The preferred embodiments of the present invention will be described below. It should be understood that the embodiments are for better explanation of the present invention and are not intended to limit the present invention.

[0039] Test method: Pyruvate detection method: Centrifuge 1 mL of fermentation broth at 12000 r / min for 10 min and collect the supernatant. After appropriate dilution, filter the sample through a 0.22 μm filter membrane and detect it using a high-performance liquid chromatograph (Dionex UltiMate 3000 Series, Thermo Scientific, USA). The chromatographic column for pyruvate detection was BioRad Aminex HPX-87H, the mobile phase was 5 mmol / L dilute sulfuric acid, the flow rate was 0.6 mL / min, the column temperature was 50 ℃, the injection volume was 10 μL, and a UV detector was used at a wavelength of 210 nm. Glycerol and ethanol were detected using an Atlantis® C18 (5 μm 4.6 × 250 mm) column, the mobile phase was 5 mmol / L dilute sulfuric acid, the column temperature was 50 ℃, the flow rate was 0.6 mL / min, the injection volume was 10 µL, and a differential detector was used.

[0040] Glucose determination method: The content of residual glucose was detected using the Shenzhen Silman Biosensor Analyzer M-100.

[0041] Biomass determination method: Shimadzu UV-Vis spectrophotometer was used for detection. First, the residual sodium hydroxide in the fermentation broth was neutralized with 200mM dilute hydrochloric acid, and the reaction was allowed to stand for 10 min. Then, it was diluted with water to an appropriate factor, and the absorbance value at a wavelength of 600 nm was measured.

[0042] Raw materials used in the examples: LB medium: 10 g / L sodium chloride, 5 g / L yeast extract, 10 g / L peptone. LB medium is used for constructing free expression vectors and extracting plasmids. For solid medium, approximately 2% agar powder needs to be added before sterilization. The final concentrations of the corresponding antibiotics added to the medium are: ampicillin sodium 100 mg / L and kanamycin 50 mg / L.

[0043] YPD medium: 20 g / L glucose, 10 g / L yeast extract, 20 g / L peptone.

[0044] YNB medium: 6.67 g / L yeast basal nitrogen source, 20 g / L glucose, with an appropriate concentration of auxotrophic amino acid mixture added if necessary.

[0045] Fermentation medium (g / L): (NH4)2SO4: 5, KH2PO4: 3, MgSO4·7H2O: 0.5, Glucose: 100, autoclaved at 115 ℃ for 15 min; EDTA: 15 mg / L, ZnSO4·7H2O: 4.5 mg / L, CoCl2·6H2O: 0.3 mg / L, MnCl2·4H2O: 1.0 mg / L, CuSO4·5H2O: 0.3 mg / L, CaCl2·2H2O: 4.5 mg / L, FeSO4·7H2O: 3.0 mg / L, Na2MoO4·2H2O: 0.4 mg / L, H3BO3: 1.0 mg / L, KI: 0.1 mg / L, sterilized by filtration; Biotin: 0.05 mg / L, Calcium pantothenate: 1.0 mg / L, Nicotinic acid: 1.0 mg / L, Inositol: 25 Vitamin B1: 1.0 mg / L, pyridoxine: 1.0 mg / L, para-aminobenzoic acid: 0.2 mg / L, sterilized by filtration; uracil: 20 mg / L, sterilized by filtration.

[0046] YPD and YNB media were sterilized at 115℃ for 15 min, and other media were sterilized at 121℃ for 15 min.

[0047] The primers used in the following examples are shown in Table 1.

[0048] Table 1 Primers required for PCR amplification

[0049] Example 1: Recombinant plasmid pY26- MPC1 Construction In this embodiment, a linearized plasmid was used after double enzyme digestion. BamHI and EcoRI Plasmid pY26 was treated with restriction endonucleases. The fragment MPC1 shown in SEQ ID NO. 6 was amplified using the pY26-MPC1-F / R primers. The promoter GPD (shown in SEQ ID NO. 7) was amplified by PCR using the GPD-F / R primers, and the terminator TCYC (shown in SEQ ID NO. 8) was amplified by PCR using the TCYC-F / R primers. The promoters GPD, MPC1, and TCYC were then ligated together via homologous recombination to obtain an expression cassette. GPD + MPC1 + TCYC (As shown in SEQ ID NO. 9). The expression cassette was ligated to the linearized plasmid pY26 using homologous recombination to obtain the ligated recombinant plasmid pY26- MPC1 The products of homologous recombination were digested and then transformed into a chemical conversion method. E. coli JM109 competent cells were screened on LB agar plates containing ampicillin sodium. Selected positive transformants were verified by colony PCR. Plasmids were extracted from transformants that initially confirmed positive results by colony PCR, followed by sequencing verification. The plasmid with correct sequencing results was named pY26- MPC1 Plasmid map as follows Figure 2 As shown.

[0050] Example 2: Engineered strain K. marxianus Construction of PA1~3 engineered strains K. marxianus Construction of PA1~2: Based on Max Kluyveromyces ura3 Genes and Ku70 Primers were designed to locate upstream and downstream sequences of the gene region. Based on the genome sequence of *Kluyveromyces martensii* NBRC 1777 published on NCBI, primers were found... ura3 Genes and Ku70 The locus region and its nucleotide sequence were used to select the cleavage site N20- within the region. ura3 (CTTAGTAACTATTCCAATGG), N20- Ku70(TCCCTAATCATTATCAATGC) via primers sgRNA-F, sgRNA- ura3 -R and sgRNA-F, sgRNA- Ku70 -R were used to amplify the pUCC01 full plasmid in reverse order, resulting in pUCC01- ura3 and pUCC01- Ku70 Knockout plasmid. Transform the recombinant plasmid into the target cell using chemical transformation. E. coli JM109 competent cells were screened on LB agar plates containing ampicillin sodium. Selected positive transformants were verified by colony PCR. Plasmids were extracted from transformants that initially confirmed positive results by colony PCR, and then sequenced for verification. The plasmid with correct sequencing results was named pUCC01- ura3 and pUCC01- Ku70 Amplification was performed using PCR. ura3 and Ku70 The upstream and downstream homologous arms, the primers are ura3 -UF and ura3 -UR, ura3 -DF and ura3 -DR, Ku70 -UF and Ku70 -UR, Ku70 -DF and Ku70 -DR, through homologous recombination... ura3 and Ku70 The upstream and downstream homologous arms are connected together to obtain ura3 and Ku70 The knockout box. Then pUCC01- ura3 and ura3 The knockout box was converted into K. marxianus In wild-type strains, CRISPR-Cas9 technology was used to complete... ura3 Gene knockout was performed using validation primer YZ- ura3 -F / R and successful knockout was obtained by screening on a plate. ura3 Genetically engineered bacteria K. marxianus PA1. Then pUCC01- Ku70 and Ku70 The knockout box was converted into K. marxianus In PA1, CRISPR-Cas9 technology is used to complete... Ku70 Gene knockout to validate primer YZ- Ku70 -F / R filtering and successful knockout were achieved by filtering on a plate. Ku70 Genetically engineered bacteria K. marxianus PA2.

[0051] engineered strains K. marxianus Construction of PA3: Based on Max Kluyveromyces PDC1 Primers were designed to locate upstream and downstream sequences of the gene region. Based on the genome sequence of *Kluyveromyces martensii* NBRC 1777 published on NCBI, primers were found... PDC1 The locus region and its nucleotide sequence were used to select the cleavage site N20- within the region. PDC1 (CTTAACTTCTGGAGAAGACA), using primers sgRNA-F, sgRNA- PDC1 -R reverse amplification of the pUCC01 full plasmid yields pUCC01- PDC1 Knockout plasmid. Transform the recombinant plasmid into the target cell using chemical transformation. E. coli JM109 competent cells were screened on LB agar plates containing ampicillin sodium. Selected positive transformants were verified by colony PCR. Plasmids were extracted from transformants that initially confirmed positive results by colony PCR, and then sequenced for verification. The plasmid with correct sequencing results was named pUCC01- PDC1 Amplification was performed using PCR. PDC1 The upstream and downstream homologous arms, the primers are PDC1 -UF and PDC1 -UR, PDC1 -DF and PDC1 -DR, through homologous recombination... PDC1 The upstream and downstream homologous arms are connected together to obtain PDC1 The knockout box. Then pUCC01- PDC1 and PDC1 The knockout box was converted into K. marxianus In PA2, CRISPR-Cas9 technology is used to complete... PDC1 Gene knockout was performed to verify successful knockout of primer YZ-PDC1-F / R on uracil-deficient plates. PDC1 Genetically engineered bacteria K. marxianus PA3, gel electrophoresis verification as follows Figure 4 As shown.

[0052] Example 3: Engineered strain K. marxianus Construction of PA4 The specific implementation method is as follows: Based on Kluyveromycin (Max Kluyveromycin) gpd1 Primers were designed to locate upstream and downstream sequences of the gene region. Based on the genome sequence of *Kluyveromyces martensii* NBRC 1777 published on NCBI, primers were found... gpd1 The locus region and its nucleotide sequence were used to select the cleavage site N20- within the region. gpd1 (AGCACCGGCAACGGAAATA), using primers sgRNA-F, sgRNA- gpd1 -R reverse amplification of the pUCC01 full plasmid yields pUCC01- gpd1 Knockout plasmid. Transform the recombinant plasmid into the target cell using chemical transformation. E. coli JM109 competent cells were screened on LB agar plates containing ampicillin sodium. Selected positive transformants were verified by colony PCR. Plasmids were extracted from transformants that initially confirmed positive results by colony PCR, and then sequenced for verification. The plasmid with correct sequencing results was named pUCC01- gpd1 .

[0053] Amplification using PCR gpd1 The upstream and downstream homologous arms, the primers are gpd1 -UF and gpd1 -UR, gpd1 -DF and gpd1 -DR, through homologous recombination... gpd1 The upstream and downstream homologous arms are connected together to obtain gpd1 The knockout box. Then pUCC01- gpd1 and gpd1 The knockout box was converted into K. marxianus In PA3, CRISPR-Cas9 technology is used to complete... gpd1 Gene knockout to validate primers gpd1 -UF and gpd1 -DR was successfully screened and knocked out on uracil-deficient plates. gpd1 Genetically engineered bacteria K. marxianus PA4, gel electrophoresis verification as follows Figure 5 As shown.

[0054] Example 4: Engineered strain K. marxianus Construction of PA5 The specific implementation method is as follows: Based on Kluyveromycin (Max Kluyveromycin) PDH1 Primers were designed to locate the upstream and downstream sequences of the truncated gene region. Based on the genome sequence of *Kluyveromyces martensii* NBRC 1777 published on NCBI, primers were found... PDH1 The truncated gene region and its nucleotide sequence were selected, and the N20 cleavage site was chosen within the region. PDH1 (TCCAAGAACGACCCTATTGC), using primers sgRNA-F, sgRNA- PDH1 -R reverse amplification of the pUCC01 full plasmid yields pUCC01- PDH1 Targeted plasmids. The recombinant plasmid is transformed and introduced into the target plasmid using chemical transformation methods. E. coliJM109 competent cells were screened on LB agar plates containing ampicillin sodium. Selected positive transformants were verified by colony PCR. Plasmids were extracted from transformants that initially confirmed positive results by colony PCR, and then sequenced for verification. The plasmid with correct sequencing results was named pUCC01- PDH1 .

[0055] Amplification using PCR PDH11 The upstream and downstream homologous arms of the truncated region, the primers are PDH1 -UF and PDH1 -UR, PDH1 -DF and PDH1 -DR connects upstream and downstream homologous arms through homologous recombination, resulting in... PDH1 The knockout box for the truncated region. Then pUCC01- PDH1 and PDH1 The knockout box was converted into K. marxianus In PA4, CRISPR-Cas9 technology is used to complete... PDH1 Gene attenuation to validate primers PDH1 -UF and PDH1 -DR screening and successful attenuation were achieved on uracil-deficient plates. PDH1 Genetically engineered bacteria K. marxianus PA5, gel electrophoresis verification as follows Figure 6 As shown.

[0056] Example 5: Engineered strain K. marxianus Construction of PA6 The specific implementation method is as follows: Based on the neutral site 3 of *Kluyveromyces martensii* (… NS3 Primers were designed to identify upstream and downstream sequences of the gene region. Based on the genome sequence of *Kluyveromyces martensii* NBRC 1777 published on NCBI, primers were found... NS3 The locus region and its nucleotide sequence were used to select the cleavage site N20- within the region. NS3 (ACGTTTGCAGAGGATCTGCG). Using primers sgRNA-F, sgRNA- NS3 -R reverse amplification of the pUCC01 full plasmid yields pUCC01- NS3 Knockout plasmids (e.g.) Figure 3 (As shown). The recombinant plasmid was transformed and introduced into the culture medium using a chemical transformation method. E. coliJM109 competent cells were screened on LB agar plates containing ampicillin sodium. Selected positive transformants were verified by colony PCR. Plasmids were extracted from transformants that initially confirmed positive results by colony PCR, and then sequenced for verification. The plasmid with correct sequencing results was named pUCC01- NS3 .

[0057] Amplification using PCR NS3 The upstream and downstream homologous arms were determined using primers NS3-UF and NS3-UR, and NS3-DF and NS3-DR. Using MPC1-F / R as primers, the recombinant plasmid pY26- MPC1 Using a template, PCR amplification of gene fragments GPD + MPC1 + TCYC Gene fragments are transferred through homologous recombination. GPD + MPC1 + TCYC and NS3 The upstream and downstream homologous arms are connected together to obtain MPC1 The integration box. Then pUCC01- NS3 and MPC1 The integration framework was converted into K. marxianus In PA5, CRISPR-Cas9 technology is used to complete... MPC1 The integration was verified using primers NS3-UF / NP3-DR and successfully screened on uracil-deficient plates. MPC1 Genetically engineered bacteria K. marxianus PA6, gel electrophoresis verification as follows Figure 7 As shown.

[0058] Example 6: Recombinant strain K. marxianus PA2 ~ PA6 Feeding fermenters for batch fermentation The recombinant strain for producing pyruvate described in Example 5 was genetically engineered. K. marxianus PA2~PA6 were subjected to fed-batch fermentation in a 5 L fermenter, and the specific implementation method is as follows: Primary seed culture: Using an inoculation loop, collect bacterial suspension from a glycerol tube and streak it across four zones on a YPD plate. Incubate at 37 °C for 24 hours. Pick a single colony and inoculate it into 50 mL of primary seed culture medium. Incubate for 12 hours at 37 °C and 200 rpm. Primary seed OD... 600 It needs to be kept between 6.0 and 10.0.

[0059] Secondary seed culture: The primary seed culture is prepared with OD... 600=1 transferred to 100 mL of fermentation medium, cultured for 12 h, and then incubated at 200 rpm and 37 ℃. OD 600 Keep it between 8.0 and 12.0.

[0060] Feed-and-batch fermentation was performed in a 5L fermenter: 10% of the secondary seed culture was inoculated into 5L of fermentation medium, resulting in a 60% culture volume. 8 mol / L NaOH was used as a neutralizing agent to maintain the pH of the fermentation medium at 5.5 ± 0.5. The temperature was 37℃, the aeration rate was 4.5 L / min, the aeration speed was 300 rpm, and the fermentation cycle was 60 h. Samples were taken every 12 h to determine the glucose, ethanol, pyruvate, and OD content of the fermentation broth. 600 The initial glucose concentration was 100 g / L. When the glucose concentration fell below 10 g / L, glucose was fed in a continuous flow to replenish the feed. Figure 8 The final fermentation result shown is that after 60 hours of fermentation, K. marxianus OD of PA2 600 The highest value was 38.85, and the yield of pyruvic acid was 22.04 g / L; K. marxianus PA3 bacterial OD 600 The highest value was 27.61, and the yield of pyruvate was 60.1 g / L; K. marxianus PA4 bacterial OD 600 The highest value was 25.94, and the yield of pyruvic acid was 69.4 g / L; K. marxianus PA5 bacterial OD 600 The highest value was 21.36, and the yield of pyruvate was 78.5 g / L; K. marxianus PA6 bacterial OD 600 The highest value was 20.5, and the yield of pyruvic acid was 83.6 g / L.

[0061] Although the present invention has been disclosed above with reference to preferred embodiments, it is not intended to limit the present invention. Anyone skilled in the art can make various modifications and alterations without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be determined by the claims.

Claims

1. A genetically engineered bacterium that produces pyruvate, characterized in that, The genetically engineered bacteria used Kluyveromyces martensii as the starting strain, with pyruvate decarboxylase knocked out. PDC1 Genes and glycerol 3-phosphate dehydrogenase gpd1 Genes that weaken pyruvate dehydrogenase PDH1 The expression of mitochondrial pyruvate carrier protein, and overexpression of mitochondrial pyruvate carrier protein. MPC1 Encoding mitochondrial pyruvate carrier protein MPC1 The nucleotide sequence of the gene is shown in SEQ ID NO.

6.

2. The genetically engineered bacterium according to claim 1, characterized in that, By truncating the Kluyveromyces yeast PDH1 Genes, to achieve PDH1 Attenuated gene expression, truncated PDH1 The nucleotide sequence of the gene is shown in SEQ ID NO.

10.

3. The genetically engineered bacterium according to claim 1, characterized in that, The PDC1 Gene, gpd1 The nucleotide sequences of the genes are shown in SEQ ID NO.3~4, respectively.

4. The genetically engineered bacterium according to claim 1, characterized in that, The starting strain is a *Kluyveromyces martensii* uracil-deficient strain, which is a wild-type *Kluyveromyces martensii*. K. marxianus Based on the NBRC1777 strain, the original orotic acid-5'-phosphate decarboxylase was knocked out. ura3 Gene, knockout of ATP-dependent DNA helicase II Ku70 Gene.

5. The genetically engineered bacterium according to claim 4, characterized in that, The ura3 Gene, Ku70 The nucleotide sequences of the genes are shown in SEQ ID NO.1~2, respectively.

6. A method for constructing a genetically engineered bacterium, characterized in that, The method described is to knock out uracil-deficient strains of *Kluyveromyces martensii*. PDC1 Genes and gpd1 Genes, through truncation PDH1 Gene attenuated expression and overexpression of mitochondrial pyruvate carrier protein MPC1 Encoding mitochondrial pyruvate carrier protein MPC1 The nucleotide sequence of the gene is shown in SEQ ID NO.6, obtained by truncation of Kluyveromyces marxburghii. PDH1 Genes, to achieve PDH1 Attenuated gene expression, truncated PDH1 The nucleotide sequence of the gene is shown in SEQ ID NO.

10.

7. The method according to claim 6, characterized in that, The uracil-deficient strain of *Kluyveromyces martensii* is found in wild-type *Kluyveromyces martensii*. K. marxianus Based on the NBRC1777 strain, the original orotic acid-5'-phosphate decarboxylase was knocked out. ura3 Gene, knockout of ATP-dependent DNA helicase II Ku70 Gene.

8. A method for producing pyruvic acid by fermentation, characterized in that, The method involves adding the genetically engineered bacteria described in any one of claims 1 to 5 to a fermentation system using sodium hydroxide as a neutralizing agent, glucose as a carbon source, and ammonium sulfate as a nitrogen source, and then carrying out fermentation culture.

9. The method according to claim 8, characterized in that, In the fermentation system, the concentration of sodium hydroxide is 8 mol / L and the initial concentration of glucose is 100 g / L. The pH of the fermentation process is controlled at 5-6, the fermentation aeration rate is 3-5 L / min, the fermentation stirring speed is 100-400 rpm, and the fermentation temperature is 37-40 ℃.

10. The use of the genetically engineered bacteria according to any one of claims 1 to 5, or the method according to claim 6 or 7, or the method according to claim 8 or 9, in the preparation of pyruvate or products containing pyruvate.

Images