Promoter PSCBV-FN39 and application thereof

Abstract

The invention discloses a promoter PSCBV-FN39 and application of the promoter PSCBV-FN39. The nucleotide sequence of the promoter PSCBV-FN39 is as shown in SEQ ID NO: 1. The promoter disclosed by the invention is a rhizome tissue high-expression promoter, can be applied to gene transformation of various crops, preparation of transgenic plants and breeding of the transgenic plants, and has an important value for promoting acquisition of plant strains with high quality, high yield, high disease resistance, high stress resistance and other special characters; the development of a modern genetic breeding technology can be effectively promoted.

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of plant genetic engineering and plant genetic breeding technology, and particularly relates to a rootstock tissue-specific high-expression promoter P SCBV-FN39 and application thereof. BACKGROUND

[0002] Plant production is related to human survival and development, and developing new plant varieties, improving plant yield and quality, and obtaining high-yield and high-quality plant varieties are beneficial to the healthy development of national economy and social stability. The rapid development of molecular biology technology provides great help for the development of modern agriculture, and the combination of plant genetic engineering and plant genetic breeding becomes a new breeding method at present, which greatly promotes the obtaining of plant varieties with high quality, high yield, high disease resistance, stress resistance and other special properties. The accelerated modification of biological genetic traits cannot be separated from transgenic technology, and the transgenic technology is to introduce artificially isolated and modified foreign genes into the genome of the target organism, so as to achieve the purpose of modifying biological traits.

[0003] Gene engineering provides an important means for plant genetic improvement and gene function verification, but the stable expression of genes is often restricted by transcriptional gene silencing or post-transcriptional silencing. The expression of genes is regulated by cis-acting elements and trans-acting factors, and the cis-acting elements include promoter, enhancer and silencer DNA sequences, and the promoter is one of the key factors affecting gene expression level. The regulation of the promoter has space-time expression characteristics, and can be divided into constitutive promoter, inducible promoter, specific promoter and the like according to the regulation mode. The regulation of tissue or organ-specific promoter is regulated by specific tissue cell structure and chemical and physical signals, so the expression of genes is often limited to certain specific organs or tissue sites or specific development periods. The tissue or organ-specific promoter (such as rootstock tissue-specific promoter) can not only make the expression product of the target gene accumulate in a certain organ or tissue site to improve the regional expression amount, but also can avoid the negative effects caused by the expression of the target gene in other tissues and organs. Therefore, it has important theoretical and practical significance to use the tissue-specific promoter to control the specific expression of the target gene.

[0004] In addition, homologous promoters are prone to promoter methylation in transgenic plants, resulting in reduced expression activity of foreign genes, and even gene silencing. It is very meaningful to explore more promoters of different sources for gene engineering to provide more selectable promoters. SUMMARY

[0005] Based on this, the purpose of the present application is to provide a promoter P SCBV-FN39 and application thereof, which is from sugarcane bacilliform virus and can drive the specific high-expression of target genes in plant rootstock tissue.

[0006] The specific technical solutions for achieving the above-mentioned objectives are as follows.

[0007] In a first aspect, the present invention provides a promoter P SCBV-FN39 Its nucleotide sequence is shown in SEQ ID NO:1.

[0008] In a second aspect, the present invention provides the aforementioned promoter P. SCBV-FN39 The amplification primers include the upstream primer shown in SEQ ID NO:4 and the downstream primer shown in SEQ ID NO:5.

[0009] A third aspect of the present invention provides an expression box including the aforementioned promoter P. SCBV-FN39 Target gene and terminator.

[0010] In a fourth aspect, the present invention provides a method comprising the promoter P described above. SCBV-FN39 Or a recombinant expression vector of an expression cassette.

[0011] In a fifth aspect, the present invention provides engineered bacteria for transforming the above-described recombinant expression vector.

[0012] In a sixth aspect, the present invention provides the aforementioned promoter P. SCBV-FN39 Applications of expression cassettes, recombinant expression vectors, or engineered bacteria in driving the specific expression of target genes in plant root and stem tissues, or in improving plant resistance to disease, pests, or abiotic stress.

[0013] A seventh aspect of the present invention provides a method for high expression of a foreign gene in plant root and stem tissues, comprising the following steps: expressing the above-mentioned promoter P... SCBV-FN39 Expression cassettes, recombinant expression vectors, or engineered bacteria are introduced into plants.

[0014] The present invention has the following beneficial effects:

[0015] This invention provides the first-ever isolation of a DNA molecule from the leaf genome of sugarcane variety FN39 infected with SCBV (sugarcane bacilliform viruses). This DNA molecule, derived from the SCBV virus, possesses promoter activity and is a highly expressed promoter in root and stem tissues. It can be used as an element in constructing plant recombinant expression vectors. By linking it before target genes (including insecticidal genes, disease-resistant genes, stress-resistant genes, weed-controlling genes, and other crop-related functional genes), it can efficiently drive the high expression of target genes in plant root and stem tissues, thereby improving the plant's disease resistance, pest resistance, and resistance to abiotic stress, or enhancing the plant's nutritional value.

[0016] The promoter of this invention is derived from the genome of the SCBV virus that infects sugarcane. Because it has no homology with the plant genome sequence, gene silencing can be avoided. Applying the promoter of this invention to gene transformation of various crops, preparing transgenic plants, and conducting transgenic plant breeding is of great value in promoting the acquisition of high-quality, high-yield, highly disease-resistant, stress-resistant, and other special trait plant lines, and can effectively promote the development of modern genetic breeding technology. Attached Figure Description

[0017] Figure 1 P in Embodiment 2 of the present invention SCBV-FN39 A map of the EYFP recombinant expression vector.

[0018] Figure 2 P in Embodiment 2 of the present invention SCBV-FN39 :Map of GUS recombinant expression vector.

[0019] Figure 3 The promoter P in embodiment 3 of the present invention CaMV35S P Ubi1 and P SCBV-FN39 Transient expression of the driven EYFP gene in onion epidermal cells (A), Arabidopsis protoplasts (B), and sugarcane young leaf tissue (C). Scale bars in the figures represent 100 μm, 25 μm, and 250 μm, respectively.

[0020] Figure 4 P in Embodiment 4 of the present invention CaMV35S :GUS、P Ubi1 :GUS and P SCBV-FN39 GUS staining images of the whole plant, roots, stems and leaves of GUS transgenic Arabidopsis thaliana. The scale bar for the whole plant is 100 μm, and the scale bar for the roots, stems and leaves is 2 mm. Detailed Implementation

[0021] To facilitate understanding of the present invention, a more complete description will be provided below. The present invention can be implemented in many different forms and is not limited to the embodiments described herein. Rather, these embodiments are provided to provide a thorough and complete understanding of the disclosure of the present invention.

[0022] Unless otherwise defined, all technical and scientific terms used in this invention have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. The terminology used in this specification is for the purpose of describing particular embodiments only and is not intended to limit the invention. The term "and / or" as used in this invention includes any and all combinations of one or more of the associated listed items.

[0023] Unless otherwise specified, all examples were conducted under standard experimental conditions, such as those described in Sambrook et al.'s *Molecular Cloning: A Laboratory Manual* (Sambrook J & Russell DW, 2001), or as recommended by the manufacturer's instructions. All raw materials and reagents used in this invention are commercially available, and any biological germplasm material can be provided for scientific research purposes.

[0024] In this invention, firstly, leaf DNA from sugarcane variety FN39 infected with SCBV (sugarcane bacilliform viruses) is used as a template to clone a positive plasmid containing the SCBV-FN39 genomic fragment sequence. Then, PCR amplification is performed using this plasmid as a template, and the amplified product is purified and ligated. On Cloning Vector, positive clones were screened after transformation into E. coli and sequenced to obtain a DNA molecule with the nucleotide sequence shown in SEQ ID NO:1. The full-length DNA molecule is 853 bp, and bioinformatics analysis suggests it may have promoter activity (named P). SCBV-FN39 ).

[0025] To investigate P SCBV-FN39 Whether it has promoter activity and its expression type were further investigated, and P was obtained by further construction. SCBV-FN39 plant binary recombinant expression vector P SCBV-FN39 :EYFP(P CaMV35S The CaMV35S promoter sequence of the EYFP gene in the EYFP vector. CaMV35S Replace with P SCBV-FN39 ) and P SCBV-FN39 :GUS(P) Ubi1 The Ubi1 promoter sequence of the GUS gene in the GUS vector is replaced with P. SCBV-FN39 Using the gene gun method to... SCBV-FN39 The recombinant expression vector EYFP was transformed into onion epidermal cells, Arabidopsis protoplasts, and sugarcane young leaf tissues. Results showed that... SCBV-FN39 Yellow fluorescence was detected in EYFP transgenic onion epidermal cells, Arabidopsis protoplasts, and sugarcane young leaf tissues, indicating that P... SCBV-FN39 It can drive the expression of the EYFP gene in onion epidermal cells, Arabidopsis protoplasts, and sugarcane young leaf tissues. P SCBV-FN39 The GUS recombinant expression vector was transformed into Agrobacterium GV3101, and positive strains were obtained through screening. These strains were then infected with Arabidopsis thaliana. GUS staining and GUS protein activity analysis revealed that P... SCBV-FN39In GUS transgenic plants, GUS expression was high only in the root and stem tissues, while it showed lower expression activity in the vascular tissues of the leaves. These results confirm that P... SCBV-FN39 (The nucleotide sequence is shown in SEQ ID NO:1) does indeed have promoter function, and it is a promoter that is highly expressed specifically in rhizome tissue.

[0026] Those skilled in the art should understand that sequences that are completely complementary to the nucleotide sequence shown in SEQ ID NO:1, or sequences that have one or more nucleotides substituted, deleted, or added to the nucleotide sequence shown in SEQ ID NO:1, for example, by replacing one or more bases in a non-responsive element or an active element to obtain a nucleotide sequence with the same function, are all within the scope of protection of this invention.

[0027] In this invention, using onion, sugarcane, and Arabidopsis thaliana as examples, and taking exogenous EYFP and GUS genes as examples, it is demonstrated that exogenous genes are affected by the promoter P. SCBV-FN39 Driven by this, it is highly expressed in the root and stem tissues of transgenic plants. Utilizing the promoter P of this invention... SCBV-FN39 This invention can also be applied to the genetic engineering of other monocotyledonous and dicotyledonous plants to efficiently drive the high expression of target genes (other functional genes, such as insecticidal genes, disease-resistant genes, stress-resistant genes, weed-controlling genes, etc.) in plant root and stem tissues. This invention can also be applied to plant bioreactors to obtain transgenic plant bioreactors with high yields of target proteins in root and stem tissues. Specific experimental methods can be found in Examples 2-4 of this invention, and will not be repeated here.

[0028] In some embodiments of the present invention, a promoter P is disclosed. SCBV-FN39 Its nucleotide sequence is shown in SEQ ID NO:1.

[0029] In other embodiments of the present invention, the above-described promoter P is disclosed. SCBV-FN39 The amplification primers include the upstream primer shown in SEQ ID NO:4 and the downstream primer shown in SEQ ID NO:5.

[0030] In other embodiments of the present invention, an expression cassette is disclosed, including the aforementioned promoter P. SCBV-FN39 The target gene and terminator, wherein the target gene is generated by the promoter P. SCBV-FN39 Driven expression.

[0031] In some embodiments, the target gene is an insecticidal gene, a disease-resistant gene, a stress-resistant gene, a weed-controlling gene, or a reporter gene.

[0032] In some embodiments, the reporter gene is the EYFP gene or the GUS gene.

[0033] In other embodiments of the present invention, a method containing the above-described promoter P is disclosed. SCBV-FN39 Or a recombinant expression vector of an expression cassette.

[0034] In some embodiments, the recombinant expression vector is P SCBV-FN39 :GUS or P SCBV-FN39 :EYFP;

[0035] In other embodiments of the present invention, engineered bacteria that transform the above-described recombinant expression vector are disclosed.

[0036] In some embodiments, the engineered bacteria are Escherichia coli or Agrobacterium, preferably Agrobacterium GV3101.

[0037] In other embodiments of the present invention, the above-described promoter P is disclosed. SCBV-FN39 Applications of expression cassettes, recombinant expression vectors, or engineered bacteria in driving the specific expression of target genes in plant root and stem tissues.

[0038] In other embodiments of the present invention, the above-described promoter P is disclosed. SCBV-FN39 Applications of expression cassettes, recombinant expression vectors, or engineered bacteria in improving plant resistance to disease, pests, or abiotic stress.

[0039] In other embodiments of the present invention, the above-described promoter P is disclosed. SCBV-FN39 Application of expression cassettes, recombinant expression vectors, or engineered bacteria in breeding to improve plant resistance to disease, pests, or abiotic stress.

[0040] In some embodiments, the plant is a monocotyledonous plant or a dicotyledonous plant.

[0041] In some embodiments, the plant is a grass (Poaceae).

[0042] In some embodiments, the plant is Arabidopsis thaliana, sugarcane, or onion.

[0043] In other embodiments of the present invention, a method for high expression of exogenous genes in plant root and stem tissues is disclosed, comprising the following steps: introducing the above-mentioned promoter, expression cassette, recombinant expression vector or engineered bacteria into the plant.

[0044] In the following embodiments, P 35S and P Ubi1 All are known constitutive strong promoter sequences, P Ubi1 :GUS、P CaMV35S :GUS、P Ubi1 :EYFP and P CaMV35S The EYFP vector is used as the basic vector framework and a dual control in this invention.Ubi1 The GUS vector is a pCAMBIA1305 vector (P CaMV35S The CaMV 35S primitive promoter sequence of the GUS gene in GUS) CaMV35S After double digestion with the restriction enzymes BamHI and HindIII, the sequence was replaced with the Ubi1 promoter sequence (P). Ubi1 It is constructed from ) P CaMV35S The EYFP vector is a pTEM12 vector (P Ubi1 The Ubi1 original promoter sequence (P) in EYFP) Ubi1 Double digestion with restriction enzymes XhoI and NcoI followed by replacement with P CaMV35S All methods described are well-known in the art. Unless otherwise specified, all percentage contents mentioned in the following embodiments are mass percentage contents.

[0045] The present invention will be described in detail below with reference to the accompanying drawings and specific embodiments.

[0046] Example 1 Promoter P SCBV-FN39 Cloning of nucleotide sequences

[0047] In this embodiment, promoter P was cloned. SCBV-FN39 The nucleotide sequence specifically includes the following steps:

[0048] 1. Total DNA extraction from sugarcane leaves

[0049] Leaf samples were collected from sugarcane variety FN39 (SCBV-FN39) infected with SCBV (sugarcane bacilliform viruses). The leaves were collected from sugarcane plants with one leaf (the thickest part of the leaf was visible) in the sugarcane field. After being brought back to the laboratory, the leaves were cleaned and disinfected with 75% alcohol, placed in resealable bags, and stored in an ultra-low temperature freezer at -80°C.

[0050] Total DNA was extracted from sugarcane leaves using a modified CTAB method (Sun et al., 2016). The absorbance and concentration of total DNA were determined using a NanoVue micro-spectrophotometer (GE Healthcare) protein and nucleic acid analyzer, and the integrity of the total DNA was detected by electrophoresis.

[0051] 2. Cloning of the SCBV-FN39 genome

[0052] Based on the two SCBV genome sequences currently published in the Genbank database, a pair of degenerate primers, SCBV-F5603 (SEQ ID NO:2): 5'-GAAGA GYGGSTTTCATCAAGT-3' and SCBV-R1002 (SEQ ID NO:3): 5'-CTCCGCTT CAGGTATTCCA-3', were designed using Primer Premier 5 software to clone the SCBV genome sequence.

[0053] Using 200 ng of total DNA as a template, LA was used Taq PCR amplification was performed using a kit (TaKaRa, China). The PCR reaction system was as follows: 10×LA PCRBuffer (Mg... 2+ The following reagents were added: 5.0 μL of Plus, 8.0 μL of dNTP Mixture (2.5 mM each), 2.0 μL of SCBV-F5603 (10 μM), 2.0 μL of SCBV-R1002 (10 μM), 0.5 μL of LATaq (5 U / μL), 31.5 μL of Pure H2O, and 1.0 μL of DNA. The PCR reaction program was as follows: 94℃ pre-denaturation for 6 min; 94℃ denaturation for 1 min, 58℃ annealing for 1 min, 72℃ extension for 5 min, for a total of 35 amplification cycles; and a final extension at 72℃ for 10 min.

[0054] After the PCR amplification reaction, 5 μL of the PCR product was subjected to 1% agarose gel electrophoresis for detection. After purification using the Gel Extraction Kit (Omega, USA), the extract was ligated into the pMD19-T cloning vector and transformed into *E. coli* host DH5α competent cells. 100 μL of the transformed bacterial culture was plated on LB agar plates containing ampicillin (50 μg / mL) and incubated overnight at 37°C in the dark. Several white single colonies were then picked and inoculated into LB liquid agar plates containing ampicillin (50 μg / mL) and incubated at 37°C in the dark with shaking for 6–8 h. 0.5 μL of each culture was then used for PCR detection. The reaction system was as follows: 10×LA PCR Buffer (Mg... 2+The reaction mixture consisted of 2.5 μL of dNTP Mixture (2.5 mM each), 4.0 μL of SCBV-F5603 (10 μM), 1.0 μL of SCBV-R1002 (10 μM), 0.25 μL of LATaq (5 U / μL), 15.75 μL of Pure H2O, and 0.5 μL of bacterial culture. The reaction program was as follows: 94℃ pre-denaturation for 6 min; 94℃ denaturation for 1 min, 58℃ annealing for 1 min, 72℃ extension for 5 min, for a total of 30 amplification cycles; and a final extension at 72℃ for 10 min. After PCR detection of the bacterial culture, three positive clones were selected for sequencing verification. The results showed that the target fragment of approximately 3000 bp was obtained, which was consistent with the expectation.

[0055] 3. SCBV-FN39 promoter cloning

[0056] Based on the obtained SCBV-FN39 genome fragment sequence, bioinformatics software was used to predict and select a promoter homologous nucleotide sequence fragment (fragment size 853 bp). Promoter fragment cloning primer P was designed. SCBV-FN39 -F(SEQ IDNO:4): 5'-AAGAACCAACTCTGCTTTGTGGATG-3' and P SCBV-FN39 -R (SEQ ID NO: 5): 5'-CAAACTTGACTCAAATACTCATGTG-3'.

[0057] Using the SCBV-FN39 genome fragment plasmid as a template, PCR amplification was performed using the Max DNA Polymerase kit (TaKaRa, China). The PCR reaction mixture was as follows: 100 ng template, 25.0 μL PrimeSTAR Max Premix (2×), P SCBV-FN39 -F(10μM) 2.0μL, P SCBV-FN39 -R (10 μM) 2.0 μL, Pure H2O 20.0 μL. The PCR reaction program was as follows: 98℃ pre-denaturation for 2 min; 98℃ denaturation for 10 s, 55℃ annealing for 15 s, 72℃ extension for 2 min, for a total of 35 amplification cycles; final extension at 72℃ for 7 min. After the PCR amplification reaction, 5 μL of the PCR product was subjected to 1% agarose gel electrophoresis for detection. The PCR product was detected by... After purification using the Gel Extraction Kit, through... Simple Cloning Kit (Quan Shi Jin, China) connects to On the Cloning Vector, the reaction mixture was 5 μL, containing 4.0 μL of recovered product and 1.0 μL of cloning vector was used. The ligation reaction solution was transformed into DH5α competent cells, and single colonies were obtained by selection on LB agar plates containing ampicillin (50 μg / mL). After identification by bacterial culture PCR, three positive clones were sequenced. Sequencing showed that the ligation product contained the nucleotides shown in SEQ ID NO:1, and it was named promoter P. SCBV-FN39 .

[0058] SEQ ID NO:1

[0059] 5’-AAGAACCAACTCTGCTTTGTGGATGCAGGAAGCCTGCATATCAGTTCAC CTCAGGGACAAAGCTTAATCCTAGAAGGAGGTTCTACAAATGTGCCGGGAATCTCTGCCACGGCTGGTATTGGGAAGATTTGCTGGAAGAATATGTGCAGGAGAGAATTGAAGAGTTTATGGTCAGAGAATTTGACCAAAAAATGGGAAATTTGGCTGAACAGCCAAGTTCATCGACAACTCTACCAGTTAATTTTAAGTCTCTTGCAGATTTAAAGGCAGAACGAGAAAATATACTTGATAATCCCAGATCAAGTATCATCGACAGGCCTCGTCCAAGTGATGAGCATTTCAAGCCCGGATACATGTATCCGAATTCTTTGCAGAAGATCAAAGAAGACTACGCGAGCCCAAGTCAGGAGGAACCACCATGGGAGGACATCAACTTCTGGTTATGCAAGGAGGAAGAAGACTTCGCCGGGTACACGGAGGACAACAAGACGGAGGACGCACTCGATCTTACTGACGTAAGCAATGACGATCAGTGGCGAAGATCGTAAGCAATGACGTAACGGAAGCAATAATGGAGCGTGGAGGACCCATGAAGAGCACTCAGAAGGCATCTCTACTTTCGGCTTCATAATGGAGGTTGTTGGCATCCAGTGCGATGCATGTACCTTTAGTTAGTGGTGTGTCTTTTCGGCATCTGTGCCACCTTATCTTTGTCGGCCACGTTGCCTTTGCTTAGAATCGACGCAAAGCATAGCGCTCGGCTGAAGTGTGTTCCCTCTGCCTATATAAGGCATGGTTGTAAGACTCTTACACTCATCGGTAGTTCACCACATGAGTATTTGAGTCAAGTTTG-3’

[0060] Example 2 Construction of a plant recombinant expression vector containing P SCBV-FN39 promoter

[0061] In this example, a plant recombinant expression vector P SCBV-FN39 containing the promoter was constructed SCBV-FN39:EYFP and P SCBV-FN39 :GUS, including the following steps:

[0062] 1. Construct P SCBV-FN39 EYFP recombinant expression vector

[0063] Preparation of plant expression vector backbone: P was expressed using rapid restriction endonucleases XhoI and NcoI (Fermentas, USA). CaMV 35S The EYFP vector was digested with enzymes. The 25 μL double digestion reaction system contained 2.5 μL of 10×FastDigestBuffer, 0.5 μL of XhoI, 0.5 μL of NcoI, and 1 μg of the target plasmid (P). CaMV35S (EYFP vector). After incubating in a water bath at 37°C for 30 min, electrophoresis was performed on a 1% agarose gel. The large fragment, i.e., the target vector backbone (EYFP gene expression vector backbone), was recovered and stored at -20°C for later use.

[0064] PCR amplification: The amplification promoter P was designed using a seamless cloning primer design tool (http: / / 123.56.75.195 / ). SCBV-FN39 The primers for the sequence are IF-EYFP-FN39-F (SEQ ID NO:6): 5'-CGGGCCCCCCCTCGAGAAGAACCAACTCTGCTTTGTGGATG-3' and IF-EYFP-FN39-R (SEQ ID NO:7): '-CCCTTGCTCACCATGGCAAACTTGACTCAAATACTCATGTG-3'. (The sequence is obtained through...) Max DNA Polymerase kit was used to amplify P cells with adapters. SCBV-FN39 The promoter fragment was annealed at 60°C, purified and recovered by agarose gel electrophoresis, and stored at -20°C for later use. The PCR system and reaction procedure were the same as step 3 in Example 1.

[0065] Vector ligation: Ligation was performed using the In-Fusion kit (TaKaRa, China), connecting the P vector with the adapter. SCBV-FN39The promoter sequence was ligated into the double-digested EYFP gene expression vector backbone. The 10 μL ligation reaction mixture contained: 2 μL 5×In-Fusion HD enzyme Premix, 2 μL linearized plasmid vector (EYFP gene expression vector backbone), and 4 μL PCR product. The ligation mixture was gently tapped to mix, incubated at 50°C for 15 min, then placed on ice. The ligation product was transformed into DH5α competent cells, plated on LB agar plates containing ampicillin (50 μg / mL), and incubated in the dark at 37°C for 12 h. Single colonies were picked, identified by colony PCR, and three positive clones were sequenced to obtain the recombinant expression vector P. SCBV-FN39 EYFP, this plasmid was amplified and stored at -20℃ for later use. SCBV-FN39 The map of the EYFP recombinant expression vector is as follows: Figure 1 As shown.

[0066] 2. Construct P SCBV-FN39 :GUS recombinant expression vector

[0067] Linearization of P using the rapid restriction endonucleases HindШ and BamHI (Fermentas, USA) Ubi1 GUS vector; Amplification promoter P was designed using a seamless cloning primer design tool (http: / / 123.56.75.195 / ). SCBV-FN39 The GUS vector sequence was ligated to primers IF-GUS-FN39-F (SEQ ID NO:8): 5'-GG CCAGTGCCAAGCTTAAGAACCAACTCTGCTTTGTGGATG-3' and IF-GUS-FN39-R (SEQ ID NO:9): 5'-GACCACCCGGGGATCCCAAACTTGACTCAAATACTCATGTG-3', via... Max DNA Polymerase kit was used to amplify P-type DNA polymerase with adapters. SCBV-FN39 The promoter fragment was annealed at 60°C, and the target fragment was purified and recovered by agarose gel electrophoresis. Ligation was then performed using an In-Fusion kit, connecting the promoter fragment to the target fragment. SCBV-FN39 The sequence was ligated into the double-digested GUS gene expression vector to obtain the recombinant expression vector P. SCBV-FN39 :GUS, expand the vector and store it at -20℃ for later use. Refer to the construction of the EYFP recombinant expression vector for specific steps. P SCBV-FN39 GUS plasmid map as follows Figure 2 As shown.

[0068] Example 3P SCBV-FN39Transient expression of the EYFP recombinant expression vector in onion epidermal cells, Arabidopsis protoplasts, and sugarcane young leaf tissues.

[0069] 1. Preparation of onion scale epidermis and plasmid transformation

[0070] Wash the onion with sterile water and soak it in 75% alcohol for 1 minute; remove the top and base of the onion, as well as the two outer layers of onion scales; cut the onion in half four times, take the outer three layers, peel off the inner skin of the onion scales, and cut it into pieces about 2cm in size. 2 The onion scales were placed in square pieces, smooth side up and inner surface down, on MS osmotic medium (4.4 g / L MS medium base salts (containing vitamins), 36.4 g / L mannitol, 0.6 mg / L 2,4-D, 6 g / L agar powder, pH 5.8–6.2). The osmotic medium containing the onion scales was then placed in the dark and incubated at 28°C for 4 hours before use.

[0071] The P prepared in Example 2 SCBV-FN39 EYFP plasmid was coated in tungsten powder (1.1 μm) and then coated with P. CaMV 35S :EYFP and P Ubi1 EYFP plasmid was used as a control. Specific operational procedures were described by Gao et al. (2013). Gene gun bombardment parameters were 1300 psi and bombardment distance was 6 cm. CaMV35S :EYFP and P Ubi1 EYFP was used as a positive control. After gene gun bombardment, the cells were cultured overnight in osmotic medium at 28°C in the dark. Then, the onion epidermal cells were placed in MS medium (4.4 g / L MS medium base salt (containing vitamins), 0.6 g / L 2,4-D, 6 g / L agar powder, pH 5.8–6.2) and cultured in the dark at room temperature for 24–48 h. The cells were then observed and photographed using a fluorescence microscope (YFP fluorescence filter).

[0072] The results are as follows Figure 3 As shown in A, compared with control P CaMV35S :EYFP and P Ubi1 As observed in EYFP onion epidermal cells, in P SCBV-FN39 Yellow fluorescence was observed in EYFP onion epidermal cells, indicating that the promoter P... SCBV-FN39 It can drive the expression of the EYFP gene in onion epidermal cells.

[0073] 2. Preparation of Arabidopsis protoplasts and P SCBV-FN39 EYFP plasmid transformation

[0074] The specific steps for preparing protoplasts from wild-type Arabidopsis thaliana leaves and transforming them using the PEG-CaCl2 percolation method are as follows:

[0075] (1) Take leaves of suitable size, cut them into strips of 0.5-1.0 mm, immerse them in the prepared enzymatic hydrolysis solution, and carry out enzymatic hydrolysis at room temperature and in the dark for about 3-4 hours, shaking them slightly during the process to ensure complete enzymatic hydrolysis.

[0076] (2) Add an equal volume of W5 solution pre-cooled at 4°C (154mM NaCl, 125mM CaCl2, 2mM MES (pH 5.7)) to terminate the reaction;

[0077] (3) Filter the mixture through a 75μm nylon mesh into a 50mL round-bottom centrifuge tube;

[0078] (4) After centrifuging horizontally at 1400 rpm for 2 min, quickly discard the supernatant to avoid loss of protoplasts;

[0079] (5) Add 10 mL of W5 solution (pre-cooled at 4℃) to wash the precipitate;

[0080] (6) After centrifuging horizontally at 1400 rpm for 2 min, quickly pour out the supernatant, add 10 mL of W5 solution (pre-cooled at 4℃), and incubate in an ice bath in the dark for 30 min.

[0081] (7) After gently removing the supernatant with a pipette, add 10 mL of MMG solution (0.4 M Mannitol, 15 mM MgCl2, 4 mM MES (pH 5.7)) and gently mix the protoplasts.

[0082] (8) Take another 2.0 mL centrifuge tube and add 20 μL (1000 ng / μL) P SCBV-FN39 EYFP and control P CaMV35S :EYFP and P Ubi1 After adding the EYFP plasmid, add 200 μL of protoplasts;

[0083] (9) Add 220 μL of PEG / Ca 2+ Solution (40% (w / v) PEG 4000, 0.2M Mannitol, 100mM CaCl2), gently tap with your hand to mix (mix each sample for 20-30 seconds);

[0084] (10) After standing for 5 minutes, add 5 times the volume of W5 solution (5 times the volume of protoplast + plasmid) and mix gently.

[0085] (11) After centrifuging at 1400 rpm for 2 min, remove the supernatant, add 150 μL of W5 solution, and mix gently.

[0086] (12) Block the 6-well microplate with 5% BSA solution and air dry (imported cell culture plates do not need to be rinsed and blocked with BSA beforehand). Then, add 1 mL of WI solution and 150 μL of the plasmid transformation protoplast solution from the above steps into the microplate.

[0087] (13) Place the above enzyme-labeled plate on white paper and incubate at room temperature for 16-18 hours;

[0088] (14) Observe the P-transfer under a laser confocal microscope (Zeiss LSM880, Zeiss GmbH, Germany). SCBV-FN39 Fluorescent expression of EYFP plasmid in Arabidopsis protoplasts.

[0089] The results are as follows Figure 3 As shown in B, compared with control P CaMV35S :EYFP and P Ubi1 :EYFP Arabidopsis protoplasts are similar to those in P SCBV-FN39 Yellow fluorescent protein was also observed in Arabidopsis protoplasts (EYFP), indicating that the promoter P... SCBV-FN39 It can drive the expression of the EYFP gene in Arabidopsis protoplasts.

[0090] 3. Preparation of sugarcane young leaf tissue and gene gun bombardment

[0091] (1) Preparation of sugarcane tender leaf tissue

[0092] Take the tops of healthy, disease-free sugarcane (ROC22) plants, remove the leaves and stems, leaving 20-30 cm of tissue. Disinfect the tissue with 75% ethanol solution and transfer it to a sterile laminar flow hood. Remove leaves from -1 and -2 and all others, and take young leaves from -3 and -4. After removing the midrib, cut the basal young leaves into 2 cm × 2 cm cubes and lay them flat on MS solid induction medium, top surface down. After incubating the small cubes of young leaves in the dark at 28℃ for 3-5 days, they can be used as leaf recipient material for transient transgenic expression in sugarcane.

[0093] (2) Gene gun bombardment

[0094] P SCBV-FN39 The EYFP plasmid was coated in tungsten powder (1.1 μm). Specific procedures were described by Gao et al. (2013). Gene gun bombardment parameters were 1300 psi and a bombardment distance of 6 cm. CaMV 35S :EYFP and P Ubi1 EYFP plasmid was used as a positive control. EYFP gene expression was observed in sugarcane young leaves after bombardment at 60 h using a stereofluorescence microscope (SteREO Lumar.V12, ZEISS, Germany) with an EYFP filter at 25x magnification.

[0095] The results are as follows Figure 3 As shown in C, compared with control P CaMV35S :EYFP and P Ubi1 :EYFP is the same as that in the tissue of young sugarcane leaves, in P SCBV-FN39 Yellow fluorescent protein was observed in sugarcane young leaf tissue, indicating that the promoter P... SCBV-FN39 It can drive the expression of the EYFP gene in sugarcane young leaf tissue.

[0096] The above results indicate that promoter P SCBV-FN39 It has strong promoter activity and can efficiently drive the expression of exogenous genes in both monocot and dicot cells.

[0097] Example 4: Preparation of stable expression materials from Arabidopsis thaliana and method for determining GUS protein activity

[0098] 1. Plasmid transformation of Agrobacterium competent cells

[0099] P CaMV 35S :GUS、P Ubi1 :GUS and the recombinant expression vector P extracted and preserved in Example 2 SCBV-FN39 GUS was used to transform Agrobacterium competent cells GV3101. The transformation steps were as follows: (1) 1 μg of plasmid DNA from each group was added to 200 μL of prepared GV3101 competent cells and gently mixed. (2) The mixture was placed in liquid nitrogen for 10 min and then placed on ice for 5 min. (3) 200 μL of antibiotic-free LB liquid medium was added to the mixture and activated at 28°C and 200 rpm / min for 2 h. (4) The activated transformation solution was placed in a sterile laminar flow hood and 100 μL was spread on LB solid plate medium containing 50 μg / mL kanamycin and rifampin. The plate was inverted and cultured at 28°C for 2 days. (5) Single colonies were picked, and after shaking, bacterial PCR was performed. The presence of the target band was detected by gel running. Positive Agrobacterium bacterial cultures with the target plasmid were selected for expansion culture and stored at -80°C for later use.

[0100] 2. Arabidopsis thaliana transformation and transgenic seedling screening

[0101] The specific steps are as follows: (1) Take 10 μL of the above positive Agrobacterium bacterial suspension into 10 mL of LB liquid medium (50 μg / mL kanamycin and rifampin), and activate overnight at 28℃ and 200 rpm / min; (2) Inoculate 10 mL of Agrobacterium bacterial suspension into 200 mL of LB liquid medium (50 μg / mL kanamycin and rifampin), and activate at 28℃ and 200 rpm / min until OD. 600=0.8~1.0, centrifuge at 5000rpm / min at room temperature for 5min, and collect the bacterial cells; (3) discard the supernatant, add 10mL of infection solution (1 / 2MS, 2.215mg / mL; sucrose, 5% (W / V); Silwet 77, 0.02% (W / V)) resuspend the bacterial cells, centrifuge at 5000 rpm / min at room temperature for 5 min, and collect the bacterial cells; (4) discard the supernatant, add 200 mL of infection solution to resuspend the bacterial cells; (5) select healthy Arabidopsis thaliana in the early fruiting stage, remove the pods, keep only the unopened inflorescences, lay the plants flat so that the inflorescences are completely immersed in the infection solution, soak for 1 min, then lay the plants flat in a new tray, cover with plastic wrap and culture in the dark for 24 h; (6) after 1 day of dark treatment, take out the plants and place them in an artificial climate culture room for normal culture. The plants mature in about a month, and harvest T0 generation seeds for screening transgenic plants; (7) prepare resistance plates, spread the sterilized T0 generation seeds flat on the plates, vernalize in the dark at 4℃ for 2-4 days, take them out, and culture in a constant temperature incubator at 23℃ for 2-3 weeks. Take out positive seedlings and transplant them into nutrient soil. PCR is used to identify positive seedlings again. Continue to culture until T3 homozygous seeds are obtained for subsequent experiments.

[0102] 3. GUS staining method

[0103] GUS histochemical staining was performed according to the method of Jefferson et al. (1987): transgenic Arabidopsis thaliana was immersed in GUS staining buffer, stained at 37°C for 6–12 h, and destained with 70% ethanol until destaining was complete. The staining was then observed and photographed.

[0104] GUS staining buffer: 50 mM phosphate buffer (pH = 7.0), 0.5 mM K3Fe(CN)6, 0.5 mM K4Fe(CN)6, 10 mM Na2EDTA, 0.1% (v / v) Triton X-100 and 1 mg / mL X-Gluc, wherein X-Gluc should be dissolved in DMSO before being added. Store at -20°C protected from light.

[0105] The results are as follows Figure 4 As shown, the control group formed the promoter P CaMV35S :GUS and P Ubi1 GUS expression was detected in the root, stem, and leaf tissues of GUS transgenic plants, while P... SCBV-FN39 In GUS transgenic plants, GUS is expressed only in the vascular bundle tissues of the roots, stems, and some leaves, indicating that P SCBV-FN39 The promoter is a promoter that is specifically highly expressed in rhizome tissue.

[0106] 4. GUS protein activity analysis

[0107] (1) Solution preparation:

[0108] GUS termination solution: 0.2M Na2CO3.

[0109] GUS reaction solution: 50 mM phosphate buffer (pH = 7.0), 10 mM Na2EDTA (pH = 8.0), 0.1% (v / v) Triton X-100, 0.07% (v / v) β-mercaptoethanol and 1 mM 4-methylumbellifery-β-D-glucuronide (4-MUG), freshly prepared and used immediately.

[0110] 4-Methylumbelliferone (4-MU) 1mM stock solution: Weigh 0.04404g of 4-MU and dilute to 250mL with GUS termination solution; 4-MU 1μM stock solution: Dilute 0.5mL of 1mM 4-MU stock solution to 500mL.

[0111] (2) Extraction of GUS protein: The crude plant protein was extracted using a plant protein extraction kit (Solepro, Beijing). The Arabidopsis tissue material was ground into powder with liquid nitrogen, and 1 mL of extraction solution was added and mixed. The mixture was placed on ice for 20 min, with shaking every 5 min. The mixture was then centrifuged at 14000 rpm for 30 min at 4 °C. The supernatant was then transferred to a new centrifuge tube for later use.

[0112] (3) Protein concentration determination: The protein concentration determination kit (Solepro, Beijing) was used. Different concentration gradients of BSA (0 μg / μL, 0.0625 μg / μL, 0.125 μg / μL, 0.5 μg / μL, 1 μg / μL, and 2 μg / μL gradient solutions) were prepared. 20 μL of each concentration gradient was pipetted into a 96-well plate, and 200 μL of BCA working solution (BCA:Cu) was added to each well. 2+ =50:1), mix well, incubate at 37℃ for 15-30 min, and measure the absorbance at 595 nm using an ELISA reader. Each concentration gradient is repeated 3 times. Plot a protein concentration standard curve based on the absorbance and the corresponding protein concentration. Take 20 μL of crude protein extract, add 200 μL of LCA working solution, mix well, incubate at 37℃ for 15-30 min, and measure the absorbance at 595 nm using an ELISA reader. Calculate the protein content of the sample based on the protein concentration standard curve.

[0113] (4) GUS fluorescence assay: Using 1 μM 4-MU as a fluorescence standard, different concentration gradients of 4-MU (0 nM, 50 nM, 100 nM, 200 nM, 400 nM, 600 nM, 800 nM and 1000 nM) were prepared. 200 μL of each concentration gradient was pipetted into the microplate. After removing air bubbles, the fluorescence value of 4-MU at different concentration gradients was measured using a microplate reader under the conditions of excitation light 365 nm and emission light 455 nm. Each concentration gradient was repeated 3 times. A standard curve of 4-MU was plotted based on the fluorescence value and the corresponding concentration. Take 20 μL of crude protein extract and add 480 μL of GUS reaction solution. Mix well and incubate at 37℃. At 0 min and 60 min, take 100 μL of the reaction solution and quickly add it to 0.9 mL of GUS termination solution to stop the reaction. Transfer 200 μL to an ELISA plate, remove air bubbles, and measure the fluorescence value of the sample using an ELISA reader under excitation light of 365 nm and emission light of 455 nm. Calculate the GUS protein activity in the sample based on the 4-MU standard curve.

[0114] GUS enzyme activity assay results are as follows: Figure 4 As shown in Table 1.

[0115] Table 1. Protein expression activities of GUS driven by different promoters in various tissues of transgenic Arabidopsis thaliana.

[0116]

[0117] Figure 4 The results in Table 1 show that P SCBV-FN39 In GUS transgenic plants, the activity of GUS protein was highest in the root and stem tissues, significantly higher than that of GUS enzyme in the leaves. In contrast, the control P... CaMV35S :GUS and P Ubi1 There was no significant difference in GUS enzyme activity among roots, stems, and leaves in GUS transgenic plants (P>0.05), indicating that the promoter P SCBV-FN39 It is a promoter that is specifically highly expressed in root and stem tissues and can be used to promote the specific high expression of target genes in root and stem tissues.

[0118] The technical features of the above embodiments can be combined in any way. For the sake of brevity, not all possible combinations of the technical features in the above embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0119] The embodiments described above are merely illustrative of several implementations of the present invention, and while the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the invention patent. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these all fall within the protection scope of the present invention. Therefore, the protection scope of this invention patent should be determined by the appended claims.

Claims

1. A promoter P SCBV-FN39 Its characteristics are, Its nucleotide sequence is shown in SEQ ID NO:

1.

2. The promoter P as described in claim 1 SCBV-FN39 The amplification primers are characterized by, The amplification primers include the upstream primer shown in SEQ ID NO:4 and the downstream primer shown in SEQ ID NO:

5.

3. An expression box, characterized in that, Including the promoter P as described in claim 1 SCBV-FN39 Target gene and terminator.

4. The expression box according to claim 3, characterized in that, The target gene is an insecticidal gene, a disease-resistant gene, a stress-resistant gene, a weed-controlling gene, or a reporter gene; and / or, the reporter gene is an EYFP gene or a GUS gene.

5. Containing the promoter P as described in claim 1 SCBV-FN39 Or the recombinant expression vector of the expression cassette as described in claim 3 or 4.

6. The recombinant expression vector according to claim 5, characterized in that, The recombinant expression vector is P. SCBV-FN39 :GUS or P SCBV-FN39 :EYFP.

7. The engineered bacteria that transform the recombinant expression vector according to claim 5 or 6.

8. The promoter P as described in claim 1 SCBV-FN39 The application of the expression cassette of claim 3 or 4, the recombinant expression vector of claim 5 or 6, or the engineered bacteria of claim 7 in driving the specific expression of the target gene in plant root and stem tissues.

9. The promoter P according to claim 1 SCBV-FN39 The application of the expression cassette of claim 3 or 4, the recombinant expression vector of claim 5 or 6, or the engineered bacteria of claim 7 in improving the plant's resistance to disease, pests, or abiotic stress.

10. A method for high expression of exogenous genes in plant root and stem tissues, characterized in that, Includes the following steps: using the promoter P as described in claim 1 SCBV-FN39 The expression cassette of claim 3 or 4, the recombinant expression vector of claim 5 or 6, or the engineered bacteria of claim 7 are introduced into plants.

Images