CD34 + cell gene editing compound and application thereof

By optimizing the CRISPR-Cas9 system for gene editing in CD34+ cells and utilizing a specific molar ratio of sgRNA, Cas9 nuclease, and ssODN, highly efficient mutation of the HBG gene in CD34+ cells was achieved, overcoming the limitations of existing treatment methods and providing a safe and effective new approach for the treatment of β-hemoglobinopathies.

CN121472227APending Publication Date: 2026-02-06GUANGZHOU REFORGENE MEDICINE CO LTD

Patent Information

Application Number
CN202610024984.X
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-01-09
Publication Date
2026-02-06

AI Technical Summary

Technical Problem

Existing treatments for β-hemoglobinopathies, such as allogeneic hematopoietic stem cell transplantation, have low bone marrow matching success rates and risks of immune rejection. Furthermore, long-term blood transfusion therapy poses safety risks, making it imperative to develop new, safe, and effective treatment methods.

Method used

By optimizing the molar ratio of sgRNA to Cas9 nuclease in the CRISPR-Cas9 system and combining it with single-stranded oligonucleotides (ssODN), gene editing was performed in CD34+ cells to induce the expression of the γ-globin gene, forming an efficient RNP complex and electroporation composition, thereby achieving the target mutation of the HBG gene in the CD34+ cell genome.

Benefits of technology

This improved gene editing efficiency and promoted the expression of the γ-globin gene in mature red blood cells, providing a potential new approach to treat β-hemoglobinopathies and reducing patients' transfusion needs and the risk of immune rejection.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121472227A_ABST
    Figure CN121472227A_ABST
Patent Text Reader

Abstract

The invention provides an RNP compound, an electrotransfection composition and a pharmaceutical composition thereof, a CD34 + cell gene editing method using the composition, and a method for obtaining HBG gene target mutation in a CD34 + cell genome.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of gene editing, specifically to a CD34+ cell gene editing complex and its applications. Background Technology

[0002] CD34+ cells are cells with self-renewal and multi-lineage differentiation potential, capable of differentiating into various blood cells, and play an important role in the treatment of hematological diseases. The development of gene editing technology has provided new means for the genetic modification of hematopoietic stem cells. In particular, the CRISPR-Cas9 system, due to its simplicity and high efficiency, has become the main tool for hematopoietic stem cell gene editing.

[0003] Hemoglobin (Hb) is a specialized protein in red blood cells that carries and transports oxygen. Hemoglobin is composed of globin and heme. In adults, hemoglobin is primarily a tetramer (α2β2) composed of two α-globin and two β-globin molecules, known as adult hemoglobin (HbA). Mutations in the β-globin gene (HBB) can cause β-hemoglobin disorders (also called β-hemoglobinopathies), including sickle cell disease (SCD) and β-thalassemia (β-thal). Sickle cell disease is caused by point mutations in the β-globin structural gene, resulting in the production of abnormal hemoglobin (HbS). β-thalassemia is caused by partial or complete defects in the expression of the β-globin gene, leading to defects or absence of adult hemoglobin (HbA). A reduction or absence of globin chains in hemoglobin leads to abnormal hemoglobin structure. Red blood cells containing this abnormal hemoglobin exhibit reduced deformability and shortened lifespan. In situ hemolysis may occur in the bone marrow, and the cells may be prematurely destroyed by organs such as the spleen after entering the peripheral blood circulation, resulting in anemia, iron deposition, and even developmental abnormalities. Patients with thalassemia and sickle cell disease primarily manage their symptoms through standardized long-term blood transfusions and iron chelation therapy. However, this approach not only fails to cure the disease but also carries significant safety risks. Allogeneic hematopoietic stem cell transplantation is currently the only treatment that can radically cure thalassemia and sickle cell disease; however, its widespread clinical application is limited by factors such as low bone marrow matching success rates and the risk of immune rejection. Therefore, there is an urgent need to develop new, safe, and effective treatment methods.

[0004] During human development, hemoglobin is not always composed of two α-globin and two β-globin molecules. During embryonic development and shortly after birth, hemoglobin exists as a tetramer (α2γ2) composed of two α-globin chains and two γ-globin chains, called fetal hemoglobin (HbF), which has a stronger oxygen affinity than HbA. As the fetus develops, the γ-globin gene gradually becomes silent and no longer expressed, while the β-globin gene near the same genomic locus gradually increases in expression. About six months after birth, the composition and ratio of hemoglobin in the blood gradually stabilize, and HbF is replaced by adult hemoglobin (HbA), leaving only very low levels of HbF (less than 1% of total hemoglobin). Clinical studies have found that in a small number of patients with β-thalassemia or sickle cell anemia, the presence of the HPFH mutation in their genome allows HbF expression to compensate for the deficiency of HbA, thus alleviating or reducing anemia symptoms to some extent or decreasing the need for blood transfusions. Inspired by this discovery, scientists have been exploring various methods to induce HbF expression in order to treat β-hemoglobinopathies. For example, hydroxyurea and other drugs are currently used clinically to induce HbF expression in the treatment of β-hemoglobinopathies.

[0005] Gene editing technology has brought new hope and methods to the treatment of genetic diseases such as hemoglobinopathies. In recent years, gene editing technology has achieved breakthrough developments, making it possible and increasingly easy to artificially alter the base sequence at specific sites in the genome. Currently, relatively mature gene editing technologies include ZFN (zinc finger nucleases), TALEN (transcription activator-like effector nucleases), and the CRISPR (regularly clustered short palindromic repeats) / Cas system (CRISPR-Cas system). By designing specific gene editing systems, double-strand breaks (DSBs) are created by cutting target genomic DNA sites in living cells. Cells can then repair these DNA gaps using non-homologous end joining (NHEJ) repair mechanisms, randomly generating mutations such as insertions, deletions, and base substitutions. If a designed DNA donor template is provided during gene editing, cells can utilize homology-directed repair (HDR) mechanisms to complete the repair, thereby introducing the desired form of base mutation at the target site.

[0006] CN111876416B uses single-stranded oligonucleotides (ssODNs) containing GATA or its antisense complementary sequence TATC as guiding information to perform gene editing in the γ-globin gene regulatory region to form GATA-containing enhancer elements, which can promote the expression of the γ-globin gene in mature erythrocytes. This invention further provides an RNP complex with high gene editing efficiency, an electroporation composition, and a pharmaceutical composition thereof by optimizing the amounts of sgRNA, Cas9, and ss ODN used during electroporation, as well as a method for gene editing in CD34+ cells using the aforementioned composition and a method for obtaining targeted mutations in the HBG gene in the CD34+ cell genome. Summary of the Invention

[0007] This invention provides an RNP complex, an electroporation composition and a pharmaceutical composition thereof, as well as a method for gene editing of CD34+ cells using the composition and a method for obtaining a target mutation in the HBG gene of the CD34+ cell genome.

[0008] In one aspect, the present invention provides an RNP complex comprising Cas9 nuclease and sgRNA, characterized in that the molar ratio of sgRNA to Cas9 is 2.2-5.0.

[0009] In some implementations, the molar ratio of sgRNA to Cas9 is 2.6–2.8, 2.8–3.0, or 3.5–5.0.

[0010] In some implementations, the molar ratio of sgRNA to Cas9 is 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3, 3.1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9, 4.0, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8, 4.9, or 5.0.

[0011] In some embodiments, the sgRNA comprises a nucleic acid sequence as shown in SEQ ID NO: 1 or SEQ ID NO: 4.

[0012] In some embodiments, the sgRNA comprises a nucleic acid sequence as shown in SEQ ID NO: 5 or SEQ ID NO: 6.

[0013] In some embodiments, the sgRNA comprises a nucleic acid sequence as shown in SEQ ID NO: 8 or SEQ ID NO: 9.

[0014] In some embodiments, the sgRNA comprises a nucleic acid sequence as shown in SEQ ID NO: 10 or SEQ ID NO: 11.

[0015] In some implementations, the Cas9 nuclease is derived from spCas9.

[0016] In another aspect, the present invention provides an electrospinning composition, characterized in that the electrospinning composition comprises an RNP complex and ssODN as described herein.

[0017] In some implementations, the sequence of the ssODN is as shown in SEQ ID NO: 2.

[0018] In some implementations, the sequence of the ssODN is as shown in SEQ ID NO: 7.

[0019] In some embodiments, the molar ratio of ssODN to RNP complex is 1-1.5.

[0020] In some embodiments, the molar ratio of the RNP complex to ssODN is 1.0, 1.1, 1.2, 1.3, 1.4, or 1.5.

[0021] In some embodiments, the sgRNA sequence contained in the electroporation composition comprises a nucleic acid sequence as shown in SEQ ID NO: 1 or SEQ ID NO: 4; and the ssODN contained therein comprises a nucleic acid sequence as shown in SEQ ID NO: 2.

[0022] In some embodiments, the sgRNA sequence contained in the electroporation composition comprises a nucleic acid sequence as shown in SEQ ID NO: 5 or SEQ ID NO: 6; and the ssODN contained therein comprises a nucleic acid sequence as shown in SEQ ID NO: 7.

[0023] In some implementations, the Cas9 nuclease is derived from spCas9.

[0024] In another aspect, the present invention provides a pharmaceutical composition comprising (a) an electroporation composition as described herein, (b) CD34+ cells, and (c) a pharmaceutically acceptable carrier.

[0025] In some implementations, the density of the CD34+ cells is 5~60×106 cells / ml.

[0026] In some implementations, the Cas9 nuclease is derived from spCas9.

[0027] In another aspect, the present invention provides a method for CD34+ cell gene editing, characterized in that the method comprises: (a) Cas9, sgRNA and ssODN were mixed in proportion and incubated to obtain the electroporation composition as described herein; (b) The composition and CD34+ cells were mixed in vitro and subjected to electroporation; (c) Culture the cells after electroporation.

[0028] In some implementations, the density of the CD34+ cells is 5~60×106 cells / ml.

[0029] In some implementations, the Cas9 nuclease is derived from spCas9.

[0030] In another aspect, the present invention provides a method for obtaining a target mutation of the HBG gene in the genome of CD34+ cells, characterized in that the method comprises: contacting a starting population of CD34+ cells in vitro with an electroporation composition as described herein, thereby generating an in vitro target cell population containing at least one target HBG gene mutation.

[0031] In some implementations, the density of the CD34+ cells is 5~60×106 cells / ml.

[0032] In some implementations, the Cas9 nuclease is derived from spCas9. Attached Figure Description

[0033] Figure 1 The results of the editing efficiency test for each experimental group are shown.

[0034] Figure 2 The mutation rate detection results of the target mutations in each experimental group are shown.

[0035] definition Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. Furthermore, any methods or materials similar to or equivalent to those described or used herein may be used in the implementation of this invention. For the purposes of this invention, the following terms are defined.

[0036] In this application, “a,” “an,” and “the” are used to refer to one or more (i.e., at least one) grammatical object of the article.

[0037] In this application, when a specific value, range, or parameter is defined, it refers to the variation of that value, range, or parameter within a reasonable error range as understood by a person skilled in the art. This reasonable error range may originate from factors such as measurement methods, measurement conditions, instrument accuracy, experimental errors, or sample differences.

[0038] The terms “nucleic acid,” “nucleotide,” or “polynucleotide” refer to deoxyribonucleic acid (DNA), ribonucleic acid (RNA), and polymers thereof in single-stranded, double-stranded, or multi-stranded forms. This term includes, but is not limited to, single-stranded, double-stranded, or multi-stranded DNA or RNA, genomic DNA, cDNA, DNA-RNA hybrids, or polymers containing purine and / or pyrimidine bases or other natural, chemically modified, biochemically modified, non-natural, synthetic, or derivatized nucleotide bases. In some embodiments, nucleic acids may comprise mixtures of DNA, RNA, and their analogues. Unless specifically defined, the term covers nucleic acids that contain known analogues of natural nucleotides, have similar binding properties to a reference nucleic acid, and are metabolized in a manner similar to naturally occurring nucleotides. Unless otherwise indicated, specific nucleic acid sequences also implicitly encompass conserved variants of their modifications (e.g., degenerate codon substitutions), alleles, orthologs, single nucleotide polymorphisms (SNPs), and complementary sequences, as well as explicitly stated sequences. Specifically, degenerate codon substitution can be achieved by producing sequences in which the third position of one or more selected (or all) codons is replaced by a mixture of bases and / or deoxyinosine residues (Batzer et al., Nucleic Acid Res. 19:5081 (1991); Ohtsuka et al., J. Biol. Chem. 260:2605-2608 (1985); and Rossolini et al., Mol. Cell. Probes 8:91-98 (1994)). The term "nucleic acid" is used interchangeably with genes, cDNA, and mRNA encoded by genes.

[0039] The term "gene" or "nucleotide sequence encoding a polypeptide" refers to a segment of DNA involved in the production of a polypeptide chain. DNA segments may include regions located before and after the coding regions that are involved in the transcription / translation of the gene product and the regulation of transcription / translation (leader and tail regions), as well as intercalation sequences (introns) between the individual coding regions (exons).

[0040] The term "hybridization" refers to a reaction in which one or more polynucleotides react to form a complex stabilized by hydrogen bonds between the bases of nucleotide residues. Hydrogen bonding can occur through Watson-Crick base pairing, Hoogstein binding, or any other sequence-specific mechanism. The complex can comprise two strands forming a double helix, three or more strands forming a multi-stranded complex, a self-hybridizing single strand, or any combination thereof. Standard Watson-Crick base pairings include: adenine (A) paired with thymine (T), adenine (A) paired with uracil (U), and guanine (G) paired with cytosine (C) [DNA, RNA]. Furthermore, for hybridization between two RNA molecules (e.g., dsRNA), and for hybridization between DNA and RNA molecules (e.g., when the sgRNA target nucleic acid pairs with a PAM-containing DNA oligonucleotide (also referred to herein as "PAMmer"), when the DNA target nucleic acid pairs with a guide RNA base, etc.): guanine (G) can also pair with uracil (U) bases. For example, in the context of tRNA anticodon pairing with codon bases in mRNA, G / U base pairing is partly responsible for the degeneracy (i.e., redundancy) of the genetic code. Therefore, in the context of this disclosure, guanine (G) (e.g., guanine (G) of the protein-binding fragment (dsRNA duplex) of the guide RNA molecule; guanine (G) of the target nucleic acid base pairing with guide RNA and / or a PAM-containing oligonucleotide, etc.) is considered complementary to uracil (U) and adenine (A). For example, when a G / U base pair can be formed at a given nucleotide position in a protein-binding fragment that guides an RNA molecule (e.g., a dsRNA duplex), that position is not considered non-complementary, but rather complementary.

[0041] Hybridization requires two nucleic acids to contain complementary sequences, although mismatches between bases are possible. Suitable conditions for hybridization of two nucleic acids depend on the length and complementarity of the nucleic acids, variables well known in the art. The higher the complementarity between the two nucleotide sequences, the higher the melting temperature (Tm) of the hybrid containing that sequence. For hybridization of nucleic acids with short complementary sequences (e.g., complementary sequence lengths not exceeding 35, 30, 25, 22, 20, or 18 nucleotides), the location of mismatches may become important (see Sambrook et al., ibid., 11.7–11.8). Typically, hybridizable nucleic acids are 8 nucleotides or longer (e.g., 10 or more, 12 or more, 15 or more, 20 or more, 22 or more, 25 or more, or 30 or more). The temperature and the salt concentration of the washing solution can be adjusted appropriately according to the length and complementarity of the complementary regions.

[0042] It should be understood that polynucleotide sequences do not need to be 100% complementary to their target nucleic acid sequences to perform specific hybridization or be capable of hybridization. Furthermore, polynucleotides can hybridize to one or more segments such that inserted or adjacent segments do not participate in the hybridization event (e.g., circular or hairpin structures). Polynucleotides can have sequence complementarity of 60% or higher, 65% or higher, 70% or higher, 75% or higher, 80% or higher, 85% or higher, 90% or higher, 95% or higher, 98% or higher, 99% or higher, 99.5% or higher, or 100% with the target region in the target nucleic acid sequence they will hybridize to. For example, if 18 out of 20 nucleotides in an antisense compound are complementary to the target region and therefore can perform specific hybridization, the complementarity of the antisense nucleic acid is 90%. In this example, the remaining non-complementary nucleotides can cluster or be scattered with the complementary nucleotides and do not necessarily need to be adjacent to each other or adjacent to the complementary nucleotides. Any convenient method can be used to determine the percentage of complementarity between specific nucleic acid sequence segments within a nucleic acid. Exemplary methods include the BLAST program (Basic Local Alignment Search Tool) and the PowerBLAST program (Altschul et al., J. Mol. Biol., 1990, 215, 403-410; Zhang and Madden, Genome Res., 1997, 7, 649-656), or the Gap program (Wisconsin Sequence Analysis Package, Unix version 8, Genetics Computer Group, University Research Park, Madison, Wisconsin) using the default settings, which uses the algorithm of Smith and Waterman (Adv. Appl. Math., 1981, 2, 482-489). Invention Details This paper presents a ribonucleoprotein (RNP) complex, guide RNA (gRNA), Cas nuclease protein, a genome editing electroporation composition, and a CRISPR gene editing method for altering the expression of one or more gamma-globin genes (HBG). The nuclease protein is mixed with gRNA and incubated; the nuclease recognizes the secondary structure of the gRNA and binds to it, forming an RNP complex. The inventors have discovered that electroporation of an RNP complex containing a specific molar ratio of nuclease to gRNA (e.g., sgRNA) can lead to increased gene editing efficiency of target nucleic acids in target cells.

[0044] In one aspect, the present invention provides an RNP complex comprising a Cas nuclease and gRNA. It should be understood that the complex comprising guide RNA (gRNA) and Cas nuclease described herein does not exist in nature. However, this complex provides the necessary conformation and stoichiometry to the essential elements for efficient and effective modification of a cell's target gene (e.g., the HBG gene). The gRNA molecule binds to the Cas nuclease and targets the nuclease to a specific location within the target DNA. The gRNA comprises: a first nucleotide sequence that hybridizes to the target DNA in the cell's genome, wherein the target DNA contains a mutation; and a second nucleotide sequence that interacts with the Cas nuclease. The complex described herein may comprise one or two separate gRNAs. Therefore, the term guide RNA includes both single guide RNA (sgRNA) and dual guide RNA (dsRNA). An example comprising a guide sequence for Cas9 binding stem-loop is provided herein as GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU (SEQ ID NO: 3). In some embodiments, the sgRNA targeting the HBG gene described herein comprises the nucleic acid sequence shown in SEQ ID NO: 1 (CUUGUCAAGGCUAUUGGUCA). In some embodiments, the sgRNA targeting the HBG gene described herein comprises the nucleic acid sequence shown in SEQ ID NO: 5 (GUUUGCCUUGUCAAGGCUAU). In some embodiments, the sgRNA targeting the HBG gene described herein comprises or is the nucleic acid sequence shown in SEQ ID NO: 4 or SEQ ID NO: 6.

[0045] Exemplary sgRNA: CUUGUCAAGGCUAUUGGUCAGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCCGGUGCUUUU (SEQ ID NO: 4) GUUUGCCUUGUCAAGGCUAUGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCCGGUGCUUUU (SEQ ID NO: 6) In the complex described herein, the Cas nuclease may be an RNA-directed Cas nuclease, such as a Cas protein or a functional fragment thereof from any bacterial species.

[0046] In some implementations, the Cas nuclease is a CRISPR-related protein selected from the group consisting of: Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9 (also known as Csn1 and Csx12), Cas10, Cpf1 (also known as Cas12a), Csy1, Csy2, Csy3, Cse1, Cse2, Csc1, Csc2, C sa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csx1, Csx15, Csf1, Csf2, Csf3, Csf4, CasX, CasY, CasZ, or their functional fragments.

[0047] In some implementations, the Cas nuclease is the Cas9 nuclease (also known as the Cas9 protein or a functional fragment thereof). "Cas9" refers to an RNA-guided, double-stranded DNA-binding nuclease or cleavage enzyme. Wild-type Cas9 nucleases possess two functional domains that cleave different DNA strands, such as RuvC and HNH. When both domains are active, Cas9 can induce double-strand breaks in genomic DNA (target DNA). The Cas9 enzyme may comprise one or more catalytic domains from Cas9 proteins belonging to the following bacteria: *Corynebacterium*, *Sutterella*, *Legionella*, *Treponema*, *Filifactor*, *Eubacterium*, *Streptococcus*, *Lactobacillus*, *Mycoplasma*, and *Bacteroides*. The genera include *Flavivola*, *Flavobacterium*, *Sphaerochaeta*, *Azospirillum*, *Gluconacetobacter*, *Neisseria*, *Roseburia*, *Parvibaculum*, *Staphylococcus*, *Nitratifractor*, and *Campylobacter*. In some embodiments, the two catalytic domains are derived from different bacterial species. In some embodiments, the Cas9 nuclease is derived from *Streptococcus pyogenes* (spCas9).

[0048] Functional fragments (or useful variants) of Cas9 nucleases may include a single inactive catalytic domain, such as RuvC. - or HNH -The Cas9 nickase is an enzyme or nicking enzyme. It possesses only one active functional domain and is capable of cleaving only one strand of the target DNA, thereby creating a single-strand break or nick. In some embodiments, a mutant Cas9 nuclease with at least the D10A mutation is the Cas9 nickase. In other embodiments, a mutant Cas9 nuclease with at least the H840A mutation is the Cas9 nickase. Other examples of mutations present in Cas9 nickases include, but are not limited to, N854A and N863A. Double-strand breaks can be introduced using Cas9 nickases if at least two RNAs targeting opposite DNA strands are used. Double-nicked induced double-strand breaks can be repaired via NHEJ or HDR (Ran et al., 2013, Cell, 154:1380-1389). This gene-editing strategy favors HDR and reduces the frequency of indel mutations at off-target DNA sites. Non-limiting examples of Cas9 nucleases or nickases are described, for example, in U.S. Patents 8,895,308, 8,889,418, and 8,865,406, and U.S. Application Publications 2014 / 0356959, 2014 / 0273226, and 2014 / 0186919. Cas9 nucleases or nickases can be codon-optimized for target cells or target organisms.

[0049] In some embodiments, the Cas nuclease may be a Cas9 polypeptide containing two silent mutations (D10A and H840A) in the RuvC1 and HNH nuclease domains, referred to as dCas9 (Jinek et al, Science, 2012, 337:816-821; Qi et al, Cell, 152(5):1173-1183). In one embodiment, the dCas9 polypeptide from Streptococcus pyogenes contains at least one mutation at positions D10, G12, G17, E762, H840, N854, N863, H982, H983, A984, D986, A987, or any combination of the above positions. Such dCas9 polypeptides and variants thereof are described, for example, in International Patent Publication No. WO 2013 / 176772. The dCas9 enzyme may contain mutations at D10, E762, H983, or D986, and mutations at H840 or N863. In some cases, the dCas9 enzyme contains the D10A or D10N mutation. Furthermore, the dCas9 enzyme may include H840A, H840Y, or H840N. In some embodiments, the dCas9 enzyme of the present invention comprises the following substitutions: D10A and H840A; D10A and H840Y; D10A and H840N; D10N and H840A; D10N and H840Y; or D10N and H840N. The substitutions may be conserved or non-conserved substitutions that render the Cas9 polypeptide inactive and capable of binding to the target DNA.

[0050] In some embodiments, the complex provided herein comprises gRNA and Cas protein. In some embodiments, the complex provided herein comprises sgRNA and Cas9 protein. In some embodiments, the complex provided herein comprises sgRNA and Cas9 protein, wherein the molar ratio of sgRNA:Cas9 is 2.2-5.0. In some embodiments, the molar ratio of sgRNA:Cas9 is 2.4-5.0. In some embodiments, the molar ratio of sgRNA:Cas9 is 2.6-5.0. In some embodiments, the molar ratio of sgRNA:Cas9 is 2.6-4.0. In some embodiments, the molar ratio of sgRNA:Cas9 is 2.6-3.0. In some embodiments, the molar ratio of sgRNA:Cas9 is 2.6-2.9. In some embodiments, the molar ratio of sgRNA:Cas9 is 2.6-2.8. In some embodiments, the molar ratio of sgRNA:Cas9 is 2.6-2.7. In some embodiments, the molar ratio of sgRNA to Cas9 is 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3, 3.1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9, 4.0, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8, 4.9, or 5.0. In some embodiments, the molar ratio of sgRNA to Cas9 is 2.2. In some embodiments, the molar ratio of sgRNA to Cas9 is 2.4. In some embodiments, the molar ratio of sgRNA to Cas9 is 2.6. In some embodiments, the molar ratio of sgRNA to Cas9 is 2.7. In some embodiments, the molar ratio of sgRNA to Cas9 is 2.8. In some embodiments, the molar ratio of sgRNA to Cas9 is 3.0. In some embodiments, the sgRNA:Cas9 molar ratio is 3.5. In some embodiments, the sgRNA:Cas9 molar ratio is 4.0. In some embodiments, the sgRNA:Cas9 molar ratio is 4.5. In some embodiments, the sgRNA:Cas9 molar ratio is 5.0. In some embodiments, the sgRNA:Cas9 molar ratio is 3.5-5.0. In some embodiments, the gRNA comprises the nucleic acid sequence as described in SEQ ID NO: 1. In some embodiments, the gRNA comprises or is the nucleic acid sequence as described in SEQ ID NO: 4. In some embodiments, the sgRNA is a modified sgRNA. In some cases, the modified sgRNA is complexed with a Cas nuclease (e.g., a Cas9 peptide) or a variant or fragment thereof to form a ribonucleoprotein (RNP)-based complex for delivery into cells (e.g., in vitro cells such as primary cells for in vitro therapy or in vivo cells such as those of a patient).In other cases, the modified sgRNA is introduced into cells (e.g., in vitro cells, such as primary cells for ex vivo therapy, or in vivo cells, such as in a patient) along with mRNA encoding a Cas nuclease (e.g., mRNA encoding one or more nucleases) (Cas9 peptide or a variant or fragment thereof). In other cases, the modified sgRNA is introduced into cells (e.g., in vitro cells, such as primary cells for ex vivo therapy, or in vivo cells, such as in a patient) encoding a Cas nuclease (e.g., Cas9 peptide or a variant or fragment thereof) using a recombinant expression vector containing a nucleotide sequence. The modifying nucleotides of the sgRNA may include modifications in the ribose (e.g., sugar) group, phosphate group, nucleobase, or any combination thereof. In some embodiments, modifications in the ribose group include modifications at the 2' position of the ribose. In some embodiments, the modified nucleotides include 2'-fluoroarabinose, tricyclic DNA (tc-DNA), peptide nucleic acid, cyclohexene nucleic acid (CeNA), locked nucleic acid (LNA), ethylene-bridged nucleic acid (ENA), phosphodiamidatemorpholino, or combinations thereof. Modified nucleotides or nucleotide analogs may include sugar-modified and / or backbone-modified ribonucleotides (i.e., including modifications to the phosphate-sugar backbone). For example, the phosphodiester bonds of native or natural RNA may be modified to include at least one nitrogen or sulfur heteroatom. In some backbone-modified ribonucleotides, the phosphate ester group attached to an adjacent ribonucleotide may be replaced with a modified group, such as a thiophosphate group. In preferred sugar-modified ribonucleotides, the 2' portion is a group selected from H, OR, R, halogen, SH, SR, NH2, NHR, NR2, or ON, wherein R is a C1-C6 alkyl, alkenyl, or alkynyl, F, Cl, Br, or I. In some embodiments, the modified nucleotide contains sugar modifications. Non-limiting examples of sugar modifications include 2'-deoxy-2'-fluoro-oligonucleotides (2'-fluoro-2'-deoxycytidine-5'-triphosphate, 2'-fluoro-2'-deoxyuridine-5'-triphosphate), 2'-deoxy-2'-deamino-oligonucleotides (2'-amino-2'-deoxycytidine-5'-triphosphate, 2'-amino-2'-deoxyuridine-5'-triphosphate), 2'-O-alkyl-oligonucleotides, 2'-deoxy -2'-C-alkyl oligonucleotides (2'-O-methylcytidine-5'-triphosphate, 2'-methyluridine-5'-triphosphate), 2'-C-alkyl oligonucleotides, and their isomers (2'-cytarabine-5'-triphosphate, 2'-cytarabine-5'-triphosphate), azidotriphosphates (2'-azido-2'-deoxycytidine-5'-triphosphate, 2'-azido-2'-deoxyuridine-5'-triphosphate) and combinations thereof.In some embodiments, the modified sgRNA contains one or more 2'-fluorine, 2'-amino, and / or 2'-sulfur modifications. In some cases, the modifications are 2'-fluoro-cytidine, 2'-fluoro-uridine, 2'-fluoro-adenosine, 2'-fluoro-guanosine, 2'-amino-cytidine, 2'-amino-uridine, 2'-amino-adenosine, 2'-amino-guanosine, 2,6-diaminopurine, 4-thio-uridine, 5-amino-allyl-uridine, 5-bromo-uridine, 5-iodo-uridine, 5-methyl-cytidine, ribo-thymidine, 2-aminopurine, 2'-amino-butyryl-pyrene-uridine, 5-fluoro-cytidine, and / or 5-fluoro-uridine.

[0051] On the other hand, this document provides an electroporation composition comprising the RNP complex described herein and a single-stranded donor oligonucleotide (ssODN). The term "ssODN" refers to a single-stranded oligodeoxynucleotide, which can serve as a repair template in CRISPR / Cas-mediated gene editing processes to guide homology-directed repair (HDR). In some embodiments, the ssODN comprises nucleotide sequences homologous to upstream and downstream regions of the target gene cleavage site (i.e., flanking sequences) and may include, as needed, intended mutations, modifications, or correction sequences. In some embodiments, each flanking sequence may be at least about 10 base pairs (bp), for example, at least about 10 bp, 15 bp, 20 bp, 25 bp, 30 bp, 35 bp, 40 bp, 45 bp, 50 bp, 55 bp, 60 bp, 65 bp, 70 bp, 75 bp, 80 bp, 85 bp, 90 bp, 95 bp, 100 bp, or longer. In some embodiments, the ssODN template comprises at least one, for example, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500 or more of the modified nucleotides described herein. In some cases, at least 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 99% of the sequence of the ssODN comprises the modified nucleotides. In some embodiments, the modified nucleotides are located at one or both ends of the ssODN. The modified nucleotides can be the first, second, third, fourth, fifth, sixth, seventh, eighth, ninth or tenth nucleotide from the end, or any combination thereof. For example, the modified nucleotides can be located at the three terminal nucleotides at both ends of the ssODN template. Alternatively, the modified nucleotides can be located inside the ends. In some implementations, the ssODN comprises a nucleic acid sequence as described in SEQ ID NO: 2 or SEQ ID NO: 7.

[0052] Example ssODN: CTCTAAGACTATTGGTCAAGTTTGCCTTGTCAAGGCTATTATCAAGGCAAGGCTGGCCAACCCATGGGTGGAGTTTAGCCA (SEQ ID NO: 2) CCTCACTGGATACTCTAAGACTATTGGTCAAGTTTGCCTTATCAAGGCAAGGCTGGCCAACCCATGGGTGGAGTTTAGCCA (SEQ ID NO: 7) In some embodiments, the electroporation compositions provided herein comprise an ssODN:RNP complex (i.e., based on the molar number of Cas9 protein in the RNP complex) with a molar ratio of 1-2. In some embodiments, the ssODN:RNP complex has a molar ratio of 1-1.5. In some embodiments, the ssODN:RNP complex has a molar ratio of 1-1.2. In some embodiments, the ssODN:RNP complex has a molar ratio of 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, or 2.0. In some embodiments, the ssODN:RNP complex has a molar ratio of 1.0. In some embodiments, the ssODN:RNP complex has a molar ratio of 1.1. In some embodiments, the ssODN:RNP complex has a molar ratio of 1.2. In some embodiments, the ssODN:RNP complex has a molar ratio of 1.5.

[0053] On the other hand, this article provides a pharmaceutical composition comprising (a) an RNP complex as described herein or an electroporation composition as described herein, wherein the RNP complex or electroporation composition contains sgRNA comprising a nucleotide sequence for obtaining mutations in the HBG gene, (b) CD34+ cells, and (c) a pharmaceutically acceptable vector.

[0054] Fetal hemoglobin (HbF) is a tetramer of two adult α-globin polypeptides and two fetal β-like γ-globin polypeptides. γ-globin genes (HBG genes: HBG1, Gene ID: 3047; and HBG2, Gene ID: 3048) are normally expressed in the fetal liver, spleen, and bone marrow. The tetramer of two γ chains and two α chains constitutes HbF. During pregnancy, the replicated γ-globin genes constitute the major gene transcribed from the β-globin locus. After birth, γ-globin is gradually replaced by adult β-globin, a process known as "fetal transition." This developmental shift from primarily producing HbF (α2γ2) to producing adult hemoglobin or HbA (α2β2) begins around 28 to 34 weeks of gestation and continues shortly after birth, when HbA becomes dominant. This transition is primarily due to decreased transcription of the γ-globin gene and increased transcription of the β-globin gene. On average, normal adults have only about 2% of total hemoglobin in the form of HbF in their blood, but the residual HbF level varies by more than 20-fold in healthy adults (Atweh, ​​Semin. Hematol. 38(4):367-73(2001)). The two types of γ-chains differ at residue 136, with glycine present in the GY-product (HBG2) and alanine present in the α-γ-product (HBG1).

[0055] As used herein, the term "hemoglobinopathy" refers to any defect in the structure, function, or expression of any hemoglobin in an individual, including defects in the primary, secondary, tertiary, or quaternary structure of hemoglobin caused by any mutation (e.g., deletion mutation). Mutations or substitutions in the coding region of β-globin genes, or mutations or deletions in the promoters or enhancers of such genes, result in a reduced amount of hemoglobin produced compared to normal or standard conditions. The term also includes any reduction in the amount or effectiveness of hemoglobin caused by external factors such as disease, chemotherapy, toxins, poisons, etc., whether normal or abnormal. β-hemoglobinopathy considered herein includes, but is not limited to, sickle cell disease (SCD, also known as sickle cell anemia or SCA), sickle cell trait, hemoglobin C disease, hemoglobin C trait, hemoglobin S / C disease, hemoglobin D disease, hemoglobin E disease, thalassemia, hemoglobin with increased oxygen affinity, hemoglobin with decreased oxygen affinity, unstable hemoglobinopathy, and methemoglobinemia.

[0056] Observations of mild phenotypes in individuals with both homozygous β-thalassemia and hereditary thalassemia support the potential to address β-hemoglobinopathies by increasing fetal hemoglobin (a2Y2; HbF) levels. This is supported by persistent fetal hemoglobin (HPFH) and homozygous β-thalassemia patients who do not synthesize adult hemoglobin but have reduced hemoglobin levels. Transfusion needs have been observed in cases of increased HbF concentrations. Additional support comes from observations of elevated HbF levels in certain adult patient populations with β-chain abnormalities, and their observed milder clinical course compared to patients with normal adult HbF levels. For example, a group of Saudi Arabian sickle cell anemia patients expressing 20–30% HbF (as a percentage of total hemoglobin) have only mild clinical manifestations of the disease (Pembrey et al., Br.J.Haematol, 40:415–429 (1978)). It is now widely believed that β-hemoglobinopathies, such as sickle cell anemia and β-thalassemia, can be improved by increasing HbF production.

[0057] As used herein, "ZBTB7A" refers to zinc finger and BTB domain-containing protein 7A, a transcriptional regulator that plays a crucial regulatory role in the hematopoietic system, particularly in regulating erythroid cell differentiation and hemoglobin gene expression. In some embodiments, ZBTB7A can act as a transcriptional repressor, directly or indirectly regulating the transcriptional activity of one or more genes in the globin gene cluster, including but not limited to γ-globin genes (e.g., HBG1 and / or HBG2), thereby affecting fetal hemoglobin (HbF) expression levels. Therefore, ZBTB7A is considered a potential therapeutic target associated with hemoglobinopathies such as β-thalassemia and sickle cell disease. In some embodiments, regulation of ZBTB7A includes, but is not limited to, reducing, eliminating, or altering the expression or function of ZBTB7A through gene editing or gene regulation techniques. For example, this can be achieved by using a CRISPR / Cas system to target and edit the ZBTB7A coding sequence or regulatory sequences (such as promoters, enhancers, or cis-regulatory elements), thereby affecting the expression profile of hemoglobin genes, such as increasing the expression level of γ-globin genes (HBG1 and / or HBG2). In some embodiments, the gene editing or gene regulation can be implemented using a CRISPR / Cas system, designing one or more sgRNAs to specifically recognize and bind to the target sequence of the ZBTB7A gene. In some embodiments, the sgRNA sequences targeting the ZBTB7A gene provided herein contain nucleic acid sequences as shown in SEQ ID NO: 8 (CUGCUCCCUGAGCCACGUCA) or SEQ ID NO: 10 (UUUACCACCAGCCAUCGCUG). In some implementations, the sgRNA targeting the ZBTB7A gene described herein contains or is a nucleic acid sequence as shown in SEQ ID NO: 9 or SEQ ID NO: 11.

[0058] Exemplary sgRNA targeting the ZBTB7A gene: CUGCUCCCUGAGCCACGUCAGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCCGGUGCUUUU (SEQ ID NO: 9) UUUACCACCAGCCAUCGCUGGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCCGGUGCUUUU (SEQ ID NO: 11).

[0059] In some embodiments, the pharmaceutical compositions described herein may further comprise one or more of the following: salts, such as NaCl, MgCl2, KCl, MgSO4, etc.; buffers, such as Tris buffer; solubilizers, such as N-(2-hydroxyethyl)piperazine-N'-(2-ethanesulfonic acid) (HEPES), 2-(N-morpholino)ethanesulfonic acid (MES), sodium 2-(N-morpholino)ethanesulfonate (MES), 3-(N-morpholino)propanesulfonic acid (MOPS), N-tris[hydroxymethyl]methyl-3-aminopropanesulfonic acid (TAPS); detergents, such as nonionic detergents like Tween-20; protease inhibitors; glycerol, etc. In some embodiments, the pharmaceutical compositions described herein may further comprise pharmaceutically acceptable carriers, many of which are known in the art and need not be discussed in detail here. Pharmaceutically acceptable carriers have been well described in a variety of publications, including Remington: The Science and Practice of Pharmaceuticals, 19 th Ed. (1995) or the latest version, Mack Publishing Co; A. Gennaro (2000) Remington: The Science and Practice of Pharmaceuticals, 20th edition.

[0060] On the other hand, this document discloses a method for obtaining a targeted mutation of the HBG gene in the genome of a cell (e.g., CD34+ cells). This method typically involves contacting a starting population of said cells in vitro with the composition described herein, thereby generating an in vitro target cell population containing at least one targeted HBG gene mutation.

[0061] On the other hand, this document provides a method for gene editing of cells (e.g., CD34+ cells). The method includes: (a) incubating a mixture of Cas9, sgRNA, and ssODN in a specific ratio to obtain the electroporation composition described herein; (b) electroporating the composition and cells (e.g., CD34+ cells) in vitro; and (c) culturing the electroporated cells. In some embodiments, the CD34+ cell density is 5–60 × 10⁻⁶ cells / cm². 6 cells / ml, preferably, the density of CD34+ cells is 5 × 10⁻⁶. 6 cells / ml, 10×10 6 cells / ml, 15×10 6 cells / ml, 20×10 6 cells / ml, 25×10 6 cells / ml, 30×10 6 cells / ml, 35×10 6cells / ml, 40×10 6 cells / ml, 45×10 6 cells / ml, 50×10 6 cells / ml, 55×10 6 cells / ml, or 60×10 6 cells / ml. In some implementations, the CD34+ cell density is 30 × 10⁶ cells / ml. 6 cells / ml.

[0062] In another aspect, the present invention provides a complex for obtaining a targeted mutation of the HBG gene in a cell genome, comprising (a) a guide RNA (gRNA) comprising: a first nucleotide sequence that hybridizes to a target DNA in the cell genome; and a second nucleotide sequence that interacts with a Cas nuclease; (b) a Cas nuclease, wherein the Cas nuclease comprises an RNA-binding portion that interacts with the second nucleotide sequence of the guide RNA, and wherein the Cas nuclease specifically binds to and cleaves the target DNA to produce a double-strand break; and (c) a single-stranded donor oligonucleotide (ssODN) that hybridizes to a genomic sequence flanking a double-strand break in the target DNA and integrates into the target DNA to obtain a targeted mutation in the target DNA.

[0063] In any of the compositions and methods provided herein, the cells may be eukaryotic cells, such as human cells. The cells may be germ cells, stem cells, or precursor cells. Precursor cells may be, for example, pluripotent stem cells or hematopoietic stem cells. As described herein, pluripotent cells include induced pluripotent stem cells. Methods for preparing induced pluripotent stem cells are known in the art and described in the examples. The cells may also be CD34+ cells. CD34+ cells may be selected from primary CD34+ hematopoietic progenitor cells, CD34+ peripheral blood cells, CD34+ umbilical cord blood cells, and CD34+ bone marrow cells. The cells may also be primary cells, such as primary CD34+ hematopoietic progenitor cells. The cells may be in vitro or ex vivo. Detailed Implementation

[0064] The technical solution of the present invention will be clearly and completely described below with reference to embodiments. Obviously, the described embodiments are only a part of the embodiments of the present invention, and not all of them. All other embodiments obtained by those skilled in the art based on the embodiments of the present invention without creative effort are within the scope of protection of the present invention.

[0065] Example 1: Effect of different ratios of Cas9 enzyme and sgRNA in the RNP complex on editing efficiency The RNP complex was prepared by electroporation using sgRNA and Cas9. Cas9 protein and sgRNA (SEQ ID NO: 4) were mixed and incubated. Cas9 recognized the secondary structure of sgRNA and bound it to form the RNP complex. After the RNP complex was introduced into CD34+ cells, Cas9 protein, guided by sgRNA, utilized its endonuclease activity to cleave DNA. This example aimed to investigate the effect of different Cas9 enzyme to sgRNA ratios on gene editing efficiency (Indel %) in the ribonucleoprotein complex (RNP) system.

[0066] In this embodiment, sgRNA targeting the HBG gene (SEQ ID NO: 4) was selected; referring to patent CN111876416 B (which is incorporated herein by reference in its entirety), a similar method was used to detect electroporation and editing efficiency, namely, the sgRNA and spCas9 protein were pre-assembled at different molar ratios to form an RNP complex. A total of 12 experimental conditions were set up, labeled T0 (negative control), T1 to T11 (three replicates), with each group corresponding to a different sgRNA:Cas9 ratio (Table 1). Subsequently, the RNP complex was introduced into a 1.0 × 10⁻⁶ m³ / h matrix via electroporation. 7 CD34+ cells.

[0067] Table 1. Grouping of experimental designs for different proportions of sgRNA:Cas9 studies Four days after electroporation, the gene editing efficiency of each group of cells was tested, and the results are summarized in Table 2 and [Table data missing]. Figure 1 The results showed that, targeting the HBG gene, in the RNP electroporation system, when the sgRNA:Cas9 ratio was within the range of 2.2-5.0, the gene editing efficiency of the cells reached over 40%, which was significantly improved compared to the editing efficiency when the sgRNA:Cas9 ratio was 2.0; especially when the sgRNA:Cas9 ratio was between 2.6 and 5.0, the gene editing efficiency of the cells was excellent, reaching nearly 60%. Excessive sgRNA usage, such as a ratio reaching 6.0, interfered with the system's editing efficiency on the target gene. In summary, the optimized sgRNA:Cas9 ratio can be selected within the range of 2.2-5.0, especially 2.6 to 5.0.

[0068] Table 2. Results of editing efficiency tests for each experimental group Based on this, when sgRNA was replaced with SEQ ID NO: 6, SEQ ID NO: 9 or SEQ ID NO: 11, the gene editing efficiency of the cells was also excellent when the sgRNA:Cas9 ratio was 2.6, with values ​​of 57.8%, 60.6% and 62.5% respectively.

[0069] The results in summary indicate that rationally regulating the ratio of sgRNA to Cas9 in the RNP system can significantly improve the editing efficiency of target genes, thus providing a better foundation for gene editing therapy based on related genes.

[0070] Example 2: Effect of different dosages of ssODN on target mutation efficiency This embodiment aims to investigate the effect of different amounts of single-stranded oligodeoxynucleotides (ssODNs) on the efficiency of obtaining target mutations in an RNP-mediated gene editing system.

[0071] Based on Example 1, an RNP complex was pre-assembled using an sgRNA (SEQ ID NO: 4) : Cas9 ratio of 2.6, and different amounts of ssODN (SEQ ID NO: 2) were introduced as a repair template. Experiments were conducted in groups T0 (T being without ssODN) and T1 to T4 (three replicates), with each group using a different concentration of ssODN (Table 3). Subsequently, the RNP complex and the corresponding ssODN were introduced into a 1.0 × 10⁻⁶ sigRNA matrix via electroporation. 7 See patent CN 111876416 B, which uses a similar method to detect electroporation and editing efficiency.

[0072] Table 3. Results of Efficiency Detection for Electro-converted ssODN Concentration Study Test results as shown in 3 and Figure 2In RNP-mediated gene editing systems, the amount of ssODN used did not significantly affect the editing efficiency of the target HBG gene. When the ssODN:RNP ratio was between 1:1 and 2:1, the mutation rate of the target mutation was above 35%. In contrast, excessive ssODN usage, such as reaching a 2:1 ratio, may slightly affect the mutation rate of the target mutation. Based on the pre-assembly of an RNP complex using sgRNA (SEQ ID NO: 6):Cas9 at a ratio of 2.6, and then using ssODN (SEQ ID NO: 7):RNP at a ratio of 1.2:1, the mutation rate of the target mutation also reached 38.5%. These results indicate that rationally controlling the ratio of ssODN to the RNP complex during electroporation can significantly improve the desired target mutation efficiency, thus providing a better foundation for gene editing therapy based on the target gene.

[0073] The above embodiments are only used to illustrate the technical solutions of the present invention, and are not intended to limit it. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features. Such modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. An RNP complex comprising Cas9 nuclease and sgRNA, characterized in that, The molar ratio of sgRNA to Cas9 is 2.2-5.0; the sgRNA comprises a nucleic acid sequence as shown in any one of SEQ ID NO: 1, SEQ ID NO: 4-6 and SEQ ID NO: 8-10.

2. The complex according to claim 1, characterized in that, The molar ratio of sgRNA to Cas9 is 2.6-2.8, 2.8-3.0, or 3.5-5.

0.

3. The complex according to claim 1, characterized in that, The molar ratio of sgRNA to Cas9 is 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3, 3.1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9, 4.0, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8, 4.9, or 5.

0.

4. The complex according to any one of claims 1-3, characterized in that, The Cas9 nuclease is derived from spCas9.

5. An electro-polarization composition, characterized in that, The electroporation composition comprises the RNP complex according to any one of claims 1-4 and ssODN; the sequence of the ssODN is shown in SEQ ID NO: 2 or SEQ ID NO:

7.

6. The composition according to claim 5, characterized in that, The molar ratio of ssODN to RNP complex is 1-1.

5.

7. The composition according to claim 6, characterized in that, The molar ratio of the RNP complex to ssODN is 1.0, 1.1, 1.2, 1.3, 1.4 or 1.

5.

8. The composition according to any one of claims 5-7, characterized in that, The Cas9 nuclease is derived from spCas9.

9. A pharmaceutical composition, characterized in that, The pharmaceutical composition comprises (a) the electroporation composition according to any one of claims 5-7, (b) CD34+ cells, and (c) a pharmaceutically acceptable carrier.

10. A method for CD34+ cell gene editing, characterized in that, The method includes: (a) Cas9, sgRNA and ssODN are mixed in proportion and incubated to obtain the electroporation composition according to any one of claims 5 to 7; (b) The composition and CD34+ cells were mixed in vitro and subjected to electroporation; (c) Culture the cells after electroporation.

11. A method for obtaining a target mutation of the HBG gene in the genome of CD34+ cells, characterized in that, The method comprises: contacting a starting population of CD34+ cells in vitro with the electroporation composition of any one of claims 5 to 7, thereby generating an in vitro target cell population containing at least one target HBG gene mutation.

12. The method according to claim 10 or 11, characterized in that, The density of the CD34+ cells was 5~60×10⁻⁶. 6 cells / ml.

13. The method according to claim 10 or 11, characterized in that, The Cas9 nuclease is derived from spCas9.

Citation Information

Patent Citations

  • Methods and compositions for activating γ-globin gene expression

    CN111876416B

  • Engineering and optimization of improved systems, methods and enzyme compositions for sequence manipulation

    US20140186919A1

  • Crispr / CAS systems for genomic modification and gene modulation

    US20140273226A1

  • RNA-Guided Transcriptional Regulation

    US20140356959A1

  • Engineering and optimization of improved systems, methods and enzyme compositions for sequence manipulation

    US8895308B1

Cited By

  • Method for reducing cell gene editing large fragment deletion

    CN121718583A