The invention relates to a paper mulberry sulfate transporter gene BpSULTR3. 1 and application thereof

Abstract

The invention belongs to the technical field of genetic engineering and plant genetic improvement, and particularly relates to a paper mulberry sulfate transporter gene BpSULTR3. 1 and application thereof. The invention provides a preparation method of broussonetia papyrifera BpSULTR3. The invention also provides application of the gene sequence in enhancing the selenium accumulation capacity of plants and promoting the synthesis of organic selenium of the plants. The gene is proved to be a key gene for regulating selenium absorption and metabolism of the broussonetia papyrifera, so that the blank of research on a selenium enrichment molecular mechanism of the broussonetia papyrifera is filled; the BpSULTR3 is subjected to overexpression; the total selenium content of plants can be increased by more than two times, and the proportion of organic selenium is remarkably increased; through selenium form and content determination and quantitative analysis of related enzyme genes in a selenium metabolic pathway, BpSULTR3 is disclosed; 1 participates in a molecular mechanism of selenate absorption, organic selenium synthesis, especially selenomethionine synthesis. The method is suitable for selenium-enriched feed, selenium-enriched agricultural product development and selenium-polluted soil treatment, and both economic value and ecological value are considered.

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering and plant genetic improvement technology, specifically relating to a mulberry sulfate transporter gene. BpSULTR3;1 Its application in enhancing the selenium accumulation capacity of plants and promoting the synthesis of organic selenium in plants is particularly suitable for the cultivation of selenium-rich paper mulberry varieties and the development of selenium-rich feed ingredients. Background Technology

[0002] Selenium (Se) is an essential micronutrient for humans and animals, primarily participating in key physiological processes such as antioxidant defense, immune regulation, and cancer prevention in the form of selenoproteins. Selenium deficiency can lead to diseases such as Keshan disease and Kashin-Beck disease. Approximately 72% of my country's land is selenium-deficient, and selenium intake is generally insufficient in the population. Plant selenium biofortification (converting inorganic selenium into easily absorbed, low-toxicity organic selenium) is an economical, safe, and effective way to address selenium deficiency.

[0003] Paper mulberry ( Broussonetia papyrifera Paper mulberry (Broussonetia papyrifera) is a deciduous tree belonging to the genus Broussonetia in the family Moraceae. It is characterized by strong adaptability, drought and moisture tolerance, and outstanding stress resistance, making it a pioneer species for ecological restoration and an important species for feed development. Its leaves are rich in crude protein, amino acids, and minerals, making them a high-quality livestock feed. Furthermore, paper mulberry possesses a certain capacity for selenium accumulation; after exogenous selenium treatment, the organic selenium in its leaves significantly increases, allowing for indirect selenium supplementation in humans through the food chain of "paper mulberry → feed → livestock products." However, its natural selenium accumulation is insufficient to meet the needs of selenium-enriched feeds or functional agricultural products, necessitating the use of genetic engineering to identify key regulatory genes and selectively improve its selenium accumulation characteristics.

[0004] Plants primarily rely on sulfate transporters (SULTRs) for selenium absorption: Selenium and sulfur belong to Group VIA of the periodic table and have similar chemical properties. Plants absorb selenate (SeO42-) from the soil through active transport mediated by SULTRs. 2- This process is a key rate-limiting step in selenium accumulation in plants. Existing research has confirmed that members of the SULTRs family play a central role in selenium absorption, transport, and metabolism in plants, such as Arabidopsis thaliana. AtSULTR1;2 High-accumulation plants Stanleya pinnata of SpSULTR2;1 All of them can efficiently mediate selenate absorption. However, the identification, functional analysis, and application of key SULTR genes that regulate selenium absorption in Broussonetia papyrifera have not been reported, which limits the molecular breeding process for selenium biofortification in Broussonetia papyrifera. Summary of the Invention

[0005] The purpose of this invention is to address the existing problems by providing a mulberry sulfate transporter gene. BpSULTR3;1 Its applications. Paper Mulberry BpSULTR3;1 Genes can enhance the plant's ability to accumulate selenium and promote the synthesis of organic selenium in plants.

[0006] This invention is achieved through the following technical solution: A gene for a mulberry sulfate transporter BpSULTR3;1 Its nucleotide sequence is shown in SEQ ID NO.1, and its length is 1986 bp.

[0007] SEQ ID NO.1: Furthermore, the amino acid sequence of the protein it encodes is shown in SEQ ID NO.2, containing 661 amino acids.

[0008] SEQ ID NO.2: * A gene of the sulfate transporter of the paper mulberry tree. BpSULTR3;1 Or the application of the protein in enhancing the selenium accumulation capacity of plants, wherein the plants include paper mulberry and Arabidopsis thaliana.

[0009] A gene of the sulfate transporter of the paper mulberry tree. BpSULTR3;1 Or the application of the protein in enhancing the ability of plants to synthesize organic selenium, characterized in that the plants include paper mulberry and Arabidopsis thaliana.

[0010] Furthermore, the organic selenium includes SeCys2, MeSeCys, and SeMet.

[0011] A gene of the sulfate transporter of the paper mulberry tree. BpSULTR3;1 Or the application of the protein in the cultivation of selenium-enriched plants, characterized in that the plants include paper mulberry and Arabidopsis thaliana.

[0012] The present invention has the following advantages over the prior art: This invention provides a mulberry sulfate transporter gene. BpSULTR3;1 Its applications; the first cloning and verification of the mulberry sulfate transporter gene. BpSULTR3;1 The function of [the gene] was confirmed, and it was identified as a key gene regulating selenium absorption and metabolism in Broussonetia papyrifera, filling a gap in the study of the molecular mechanism of selenium enrichment in Broussonetia papyrifera; overexpression BpSULTR3;1 It can increase the total selenium content of plants by more than 2 times and significantly increase the proportion of organic selenium; through the determination of selenium speciation and content and the quantitative analysis of related enzyme genes in the selenium metabolic pathway, it was revealed that... BpSULTR3;1 It participates in the molecular mechanisms of selenate absorption, organoselenium synthesis, and especially selenomethionine synthesis. It is applicable to the development of selenium-enriched feed and agricultural products, as well as the remediation of selenium-contaminated soil, balancing economic and ecological value. Attached Figure Description

[0013] Figure 1 Provided by the present invention BpSULTR3;1 Image of positive clone PCR detection results, M: DL5000 Marker; Figure 2 Provided by the present invention BpSULTR3;1 Gene coding region sequence and translated amino acid sequence diagram; Figure 3 Provided by the present invention BpSULTR3;1 Schematic diagram of gene overexpression vector construction; Figure 4 Provided by the present invention BpSULTR3;1 The screening process for homozygous transgenic Arabidopsis thaliana; Figure 5 The T3 generation provided by this invention BpSULTR3;1 PCR positive identification results of transgenic Arabidopsis thaliana; Figure 6 Provided by the present invention BpSULTR3;1 Gene expression levels in different transgenic Arabidopsis lines compared to the empty vector (pCY); Figure 7 The sodium selenate treatment before and after the present invention provides BpSULTR3;1 Changes in expression levels; Figure 8 This is a diagram showing the total selenium content of transgenic Arabidopsis thaliana after sodium selenate treatment, as provided by the present invention. Figure 9The sodium selenate-treated transgenic Arabidopsis thaliana SeO4 provided by this invention 2- Content chart; Figure 10 The sodium selenate-treated transgenic Arabidopsis thaliana SeO3 provided by this invention 2- Figures showing the contents of MeSeCys, SeMet, and SeCys2; Figure 11 Provided by the present invention BpSULTR3;1 AtAPR expression level in transgenic Arabidopsis thaliana; Figure 12 Provided by the present invention BpSULTR3;1 AtHMT expression level in transgenic Arabidopsis thaliana; Figure 13 Provided by the present invention BpSULTR3;1 AtSMT expression level in transgenic Arabidopsis thaliana; Figure 14 Provided by the present invention BpSULTR3;1 AtSAM expression level in transgenic Arabidopsis thaliana; Figure 15 Provided by the present invention BpSULTR3;1 AtMMT expression level in transgenic Arabidopsis thaliana. Detailed Implementation

[0014] To further explain the present invention, the following specific embodiments are described.

[0015] This invention also provides a paper tree. BpSULTR3;1 Application of genes in increasing total selenium content in plants. BpSULTR3;1 The total selenium content of the Arabidopsis thaliana in the gene group was higher than that in the control group.

[0016] The present invention also provides BpSULTR3;1 Applications to increase the organic selenium content of plants. BpSULTR3;1 Arabidopsis thaliana SeO4 gene 2- and SeO3 2- The content of both inorganic selenium types was higher than that of the control group.

[0017] The present invention also provides BpSULTR3;1 Applications to increase the organic selenium content of plants. BpSULTR3;1 The Arabidopsis thaliana gene contained higher levels of three organic selenium compounds: SeMet (selenomethionine), MeSeCys (methylselenocysteine), and SeCys2 (selenocysteine) than the control group.

[0018] The plants mentioned include Arabidopsis thaliana.

[0019] This invention also provides a paper tree. BpSULTR3;1 Application of genes in the cultivation of selenium-enriched plants.

[0020] This invention also provides a paper tree. BpSULTR3;1 The gene is involved in the metabolic pathway of selenomethionine synthesis. This pathway further reveals... BpSULTR3;1 Molecular mechanisms involved in the synthesis of selenomethionine.

[0021] The following describes the papermaking method of the present invention in conjunction with specific embodiments. BpSULTR3;1 The application of genes will be introduced in further detail.

[0022] Example 1: Paper Mulberry BpSULTR3;1 Gene cloning and sequencing 1.1 Materials: The tested paper mulberry variety was “Kegou 101” ( Broussonetia papyrifera The cells, 'Kegou101', were grown at the applicant's workplace (30°37' N, 112°07' E) and were managed with standard water and fertilizer. Escherichia coli DH5α and Agrobacterium GV3101 competent cells were purchased from Takara Bio Engineering (Dalian) Co., Ltd. The RNA extraction kit (TaKaRaMiniBEST Plant RNA Extraction Kit), the reverse transcription kit (HiScript III 1st Strand cDNASynthesis Kit), and the PCR premix enzyme (2×Rapid Taq Master Mix) were purchased from Novizan Biotechnology (Nanjing) Co., Ltd.

[0023] 1.2 Primer Design Based on Broussonetia papyrifera genome data ( BpSULTR3;1 Gene ID: Bp03G0171.1), cloning primers BpHMT2-F (SEQ ID NO.3) and BpHMT2-R (SEQ ID NO.4) were designed based on the CDS sequence. The primer sequences are shown in Table 1.

[0024] 1.3 Total RNA extraction and cDNA synthesis 0.1 g of mulberry leaf fragments treated with sodium selenate were used to extract total RNA according to the RNA extraction kit instructions. The RNA purity (OD) was determined using a Nanodrop spectrophotometer. 260 / OD 280 = 1.8 - 2.1) and concentration (≥ 100 ng / μL); using qualified RNA as a template, synthesize first-strand cDNA using a reverse transcription kit and store at -20℃.

[0025] 1.4 PCR amplification and cloning sequencing Using cDNA as a template, PCR amplification was performed using BpSULTR3;1-F / R primers: The reaction system (25 μL) included 12.5 μL of 2×Rapid Taq Master Mix, 1 μL each of forward and reverse primers (10 μmol / L), 1 μL of cDNA template, and 9.5 μL of ddH2O; The reaction program was as follows: 95℃ pre-denaturation for 3 min, 95℃ denaturation for 30 s, 55℃ annealing for 30 s, 72℃ extension for 30 s, and 35 cycles followed by a final extension at 95℃ for 5 min.

[0026] PCR products were detected by 1% agarose gel electrophoresis (target band approximately 1986 bp). The products were recovered using a gel extraction kit, ligated into the pMD19-T vector, and transformed into DH5α competent cells. The cells were then plated on LB agar plates containing ampicillin (Amp, 100 mg / L) and incubated at 37°C for 12–16 h. Single colonies were picked and validated by PCR using the M13 universal primers (SEQ ID NO.5: AGGGTTTTCCCAGTCACG; SEQ ID NO.6: GAGCGGATAACAATTTCACAC). Figure 1 (The positive clone bands were clear). The positive clones were sent to Shanghai Sangon Biotech Co., Ltd. for sequencing. The nucleic acid sequences obtained from the sequencing results are as follows: Figure 2 As shown, the length is 1986bp.

[0027] Table 1 Primer sequences used in this invention

[0028] Example 2: Construction of plant overexpression vector and Agrobacterium-mediated transformation 2.1 Carrier Construction The plant overexpression vector pCY-H05252 (containing the hygromycin resistance gene HygR) was selected. The pCY-H05252 plasmid was digested with restriction endonucleases XbaI and SacI, as shown in Table 2. Using a correctly sequenced BpSULTR3;1 positive clone as a template, the target gene was amplified using primers containing the vector homologous arms (BpSULTR3;1-F / R: SEQ ID NO.7 and SEQ ID NO.8). The gene was ligated to the linearized vector using a one-step cloning kit (Clone Expression Ultra One Step Cloning Kit), transformed into DH5α competent cells, plated on LB agar plates containing kanamycin (Kan, 50 mg / L), and incubated at 37°C for 12 h. Single colonies were picked, and positive clones were verified using M13 primers. The recombinant plasmid was extracted, and the correct vector construction was confirmed by restriction enzyme digestion and sequencing. Figure 3 A schematic diagram of the construction of plant overexpression vectors.

[0029] Table 2 Enzyme digestion system for overexpression vectors

[0030] 2.2 Agrobacterium-mediated transformation Take 2.5 μL of recombinant plasmid and add it to 50 μL of Agrobacterium GV3101 competent cells. After incubating on ice for 30 min, transform by electroporation at 2500 V (the electroporation cuvette was pre-cooled to -20℃). Add 800 μL of YEP liquid medium and incubate at 28℃ and 200 rpm for 2 h. Spread 30 μL of the bacterial culture onto YEP plates containing Kan (50 mg / L) and rifampin (Rif, 20 mg / L). Incubate upside down at 28℃ for 2-3 days. Pick single colonies and verify with universal primer M13 to obtain the Agrobacterium engineered bacteria containing the recombinant plasmid.

[0031] Example 3: Turn BpSULTR3;1 Breeding and Identification of Genetically Modified Plants 3.1 Agrobacterium-mediated transformation in Arabidopsis thaliana (inflorescence infection method) Arabidopsis pretreatment: Colombian wild-type (Col-0) Arabidopsis seeds were disinfected with 75% alcohol for 30 seconds, then with 3% sodium hypochlorite for 6 minutes, rinsed 5 times with sterile water, and sown on MS solid medium. After vernalization at 4℃ for 2 days, the seeds were transferred to a light incubator (22-25℃, 16 h light / 8 h dark). Two weeks later, the seeds were transplanted to a substrate (peat: peat moss: perlite = 7:2:1), covered with plastic wrap to retain moisture for one week, and the main stem was cut off when the plants reached 5-6 cm in length to encourage lateral stem growth.

[0032] Preparation of infection solution: Agrobacterium-mediated transformation of bacteria containing recombinant plasmids was inoculated into YEP liquid medium containing Kan (50 mg / L) and Rif (20 mg / L), and cultured at 28°C and 200 rpm until OD500. 600 = 0.6-0.8; Centrifuge at 5000 rpm for 15 min, discard the supernatant, resuspend the bacterial cells in 5% sucrose solution, add 0.02% Silwet L-77, and adjust OD. 600 = 0.8.

[0033] Inflorescence infection: The Arabidopsis inflorescences were completely immersed in the infection solution for 30 seconds. After removal, excess liquid was absorbed with absorbent paper, covered with a black plastic bag and cultured in the dark for 24 hours. Then, they were transferred to a light culture room for normal growth. The infection was repeated once after 7 days until the seeds matured and were harvested (T1 generation seeds).

[0034] 3.2 Screening of transgenic Arabidopsis homozygotes Resistance screening: After disinfection, T1 generation seeds were sown on MS plates containing hygromycin (Hyg, 30 mg / L), vernalized at 4℃ for 2 days, and then cultured for 12 days. Positive seedlings with normal roots and intact true leaves were selected. Figure 4 Transplanted into a substrate for cultivation, and T2 generation seeds were harvested.

[0035] Homozygous identification: T2 generation seeds were sown on Hyg-MS plates as described above, and lines with all positive seedlings (T3 generation) were selected. DNA was extracted from leaves and identified by PCR using BpSULTR3;1-F / R primers. Figure 5 The target band was approximately 1986 bp, and no band was observed in the empty pCY vector. Homozygous lines (OE01, OE02, OE03) were confirmed.

[0036] Example 4: BpSULTR3;1 Gene function verification 4.1 BpSULTR3;1 Gene expression level measurement Gene expression level analysis of identified T3 generation Arabidopsis thaliana plants revealed that ( Figure 6 Overexpression BpSULTR3;1 The expression of the target gene was detected in all three Arabidopsis thaliana lines; however, the expression of the gene was not observed in Arabidopsis thaliana plants transformed with an empty vector.

[0037] Analysis of gene expression levels in different Arabidopsis thaliana lines before and after sodium selenate (Na2SeO4) treatment showed that... Figure 7 Compared with the untreated state, the expression level of BpSULTR3;1 was significantly increased after selenate treatment.

[0038] 4.2 Determination of total selenium and organic selenium content Sample processing: Arabidopsis thaliana (transformed with empty vector, OE01-OE03) that had grown for 20 days were sprayed with 0.4 mmol / L sodium selenate, once every 7 days for a total of 3 times; 4 days after the last treatment, the leaves were harvested, rinsed twice with deionized water, flash-frozen in liquid nitrogen and stored at -80℃, freeze-dried and ground into powder.

[0039] Total selenium content determination (HG-AFS method): Weigh 0.1 g of sample powder, add 10 mL of nitric acid and 2 mL of hydrogen peroxide, and microwave digest (120℃ 8 min → 150℃ 5 min → 180℃ 20 min); after cooling, add 5 mL of concentrated hydrochloric acid, heat at 180℃ until the solution is clear, transfer to a 10 mL volumetric flask, add 2.5 mL of 100 g / L potassium ferricyanide solution, and dilute to the mark. A standard curve was plotted using selenium standard solutions (0, 5, 10, 20, 30 μg / L), and the total selenium content was determined using a hydride generation-atomic fluorescence spectrometer (HG-AFS, Beijing Haiguang Instrument Co., Ltd.). The results showed ( Figure 8 ):change BpSULTR3;1 The total selenium content of the gene-modified Arabidopsis ranged from 130.53 to 190.86 mg / kg DW, with an average of 185.25 mg / kg DW, which was 2.31 times that of the control group (80.06 mg / kg DW).

[0040] Determination of organic selenium speciation (LC-AFS method): Weigh 0.2 g of sample powder, add 8 mL of 8 mg / mL proteinase XIV solution (prepared with 0.01 mol / L phosphate buffer), incubate at 37℃ with shaking for 16 h, extract by sonication for 30 min, centrifuge at 10000 rpm for 10 min (4℃), and filter the supernatant through a 0.45 μm filter membrane. A Hamilton PRP-X100 column (250 mm × 4.1 mm) was used. The mobile phase was ammonium dihydrogen phosphate (preparation process: accurately weigh 3.965 g of diammonium dihydrogen phosphate and 0.161 g of tetrabutylammonium bromide, add 30 mL of methanol, dilute with water to 1000 mL, add formic acid and adjust the pH to 6.0 with a pH meter. Before use, filter through a 0.45 µm organic microporous membrane and sonicate for 10 min). The column temperature was 25℃, and the injection volume was 100 μL. SeO4 was detected by liquid chromatography-atomic fluorescence spectrometry (LC-AFS, Beijing Haiguang Instrument Co., Ltd.). 2- SeO3 2- Content of SeCys2, MeSeCys, and SeMet.

[0041] The results show that ( Figure 9 and Figure 10 ): In the control group and BpSULTR3;1 In transgenic Arabidopsis, selenomethionine (SeMet) was the most abundant organic selenium form, with concentrations of 9.08 mg / kg (DW), 16.9 mg / kg (DW), and 7.64 mg / kg (DW), respectively. MeSeCys content reached 8.7 mg / kg (DW), and SeCys2 content reached 5.2 mg / kg (DW). Selenate (SeO4) was also abundant. 2-The main inorganic selenium forms were 68.05 mg / kg (DW), 169.77 mg / kg (DW), and 76.53 mg / kg (DW), respectively. Comparative analysis showed that... BpSULTR3;1 The content of selenomethionine (SeMet) in transgenic Arabidopsis thaliana was 1.86 times that of the control group, while its selenate (SeO4) content was higher. 2- The content of [specific substance] was 2.49 times that of the control group. These results indicate that... BpSULTR3;1 Overexpression of the gene can significantly enhance Arabidopsis' ability to transport and absorb selenate.

[0042] Example 5: RT-qPCR detection of selenium metabolism-related genes Real-time quantitative PCR was used to detect selenium metabolism-related genes in selenium-treated Arabidopsis thaliana and to analyze the mulberry tree. BpSULTR3;1 The influence of genes on the selenomethionine synthesis pathway in plants.

[0043] 5.1 RNA extraction and reverse transcription from Arabidopsis thaliana RNA was extracted from the leaves of the empty vector and three transgenic Arabidopsis lines treated with sodium selenate in Example 3 using the method in step 1.3 of Example 1, and cDNA was obtained by reverse transcription.

[0044] 5.2 Real-time quantitative PCR detection of selenium metabolism genes in Arabidopsis thaliana Adenosine triphosphate sulfate reductase (ATP sulfate reductase) from the selenium metabolism pathway was selected from the Arabidopsis genome. AtAPR ), S-adenosylmethionine synthase ( SAM ), homocysteine ​​S-methyltransferase ( AtHMT ), selenocysteine ​​methyltransferase ( AtSMT ) Methionine methyltransferase ( AtMMT The corresponding CDS sequences of the genes were extracted using Tbtools, and corresponding quantitative detection primers were designed using Primer Premier 6.0 (Table 1). Using the Arabidopsis cDNA reverse transcribed in step 5.1 as templates, the corresponding quantitative detection primers were... PP2A The internal reference gene was used for real-time quantitative fluorescence detection.

[0045] The results showed that overexpression in Arabidopsis thaliana BpSULTR3;1 Gene, three adenylate reductases ( APR The expression level of the gene was also significantly increased. Figure 11 This increase is attributed to BpSULTR3;1The enhanced capacity for selenate uptake and translocation into plant cells mediated by APR induces a surge in the expression of downstream APR reductases. These enzymes reduce accumulated selenate to selenite, providing the material basis for selenium metabolism in plants. Furthermore, the expression levels of three homocysteine ​​S-methyltransferases downstream of APR showed a decreasing trend. Figure 12 Simultaneously, the expression levels of three selenocysteine ​​methyltransferases (SMTs) were significantly increased. These enzymes efficiently convert selenocysteine ​​(SeCys) to selenomethionine (MeSeCys), leading to an increase in the accumulation of MeSeCys in transgenic plants. Figure 13 At the same time. Furthermore, Figure 14 and Figure 15 The study also showed that the expression levels of three S-adenosylmethionine synthase (SAM) genes and one methionine methyltransferase (MMT) gene were moderately elevated, suggesting that they may contribute to the increase in total selenium content in transgenic Arabidopsis lines.

[0046] In summary, BpSULTR3;1 Overexpression of the gene in Arabidopsis thaliana enhanced its selenium accumulation capacity and promoted the expression of key enzymes in multiple selenium metabolic pathways downstream of the sulfate transporter SULTR, thereby increasing the total selenium content, especially the content of selenomethionine, an organic selenium compound. These results indicate that... BpSULTR3;1 It is likely a key gene involved in the synthesis of selenomethionine and can enhance the plant's ability to accumulate selenium.

[0047] The specific embodiments described above further illustrate the purpose, technical solution, and beneficial effects of the present invention. It should be understood that the above description is only a specific embodiment of the present invention and is not intended to limit the scope of protection of the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.

Claims

1. A Broussonetia papyrifera sulfate transporter gene BpSULTR3;1 characterized in that, The nucleotide sequence is shown as SEQ ID NO.

1.

2. The Broussonetia papyrifera sulfate transporter gene according to claim 1 BpSULTR3;1 characterized in that, The amino acid sequence of the encoded protein is shown as SEQ ID NO.

2.

3. Use of a Broussonetia papyrifera sulfate transporter gene as claimed in claim 1 or a protein as claimed in claim 2 for increasing the ability of a plant to accumulate selenium. BpSULTR3;1 The plants include Broussonetia papyrifera and Arabidopsis thaliana. ​ 4. Use of a Broussonetia papyrifera sulfate transporter gene as claimed in claim 1 or a protein as claimed in claim 2 for increasing the ability of a plant to synthesize organic selenium. BpSULTR3;1 or a protein as claimed in claim 2 for increasing the ability of a plant to synthesize organic selenium. The plants include Broussonetia papyrifera and Arabidopsis thaliana.

5. Use according to claim 4, characterized in that, The organic selenium includes SeCys2, MeSeCys, SeMet.

6. Use of a Broussonetia papyrifera sulfate transporter gene as claimed in claim 1 or a protein as claimed in claim 2 for breeding selenium-enriched plants. BpSULTR3;1 or a protein as claimed in claim 2 for breeding selenium-enriched plants. The plants include Broussonetia papyrifera and Arabidopsis thaliana.

Images