Complementary deoxyribonucleic acid (cDNA) clone plasmid of avian infectious bronchitis virus for expressing secretory luciferase and virus strain and vaccine obtained by rescue

By constructing an IBV cDNA clone plasmid expressing secretory luciferase, and rapidly constructing and replacing non-essential genes using yeast homologous recombination, the problem of insufficient IBV vaccine prevention and control capabilities was solved. This enabled efficient virus titer determination and infection type differentiation, and provided a stable strain resource.

CN121472276APending Publication Date: 2026-02-06ZHEJIANG UNIV
View PDF 6 Cites 0 Cited by

Patent Information

Application Number
CN202511797841.4
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-12-01
Publication Date
2026-02-06

AI Technical Summary

Technical Problem

Existing IBV vaccines are insufficient in preventing and controlling strain mutations, and it is difficult to quickly distinguish between vaccine strains and wild-type strains, lacking effective identification methods.

Method used

IBV cDNA clone plasmids expressing secretory luciferase were constructed rapidly using yeast homologous recombination. Non-essential genes were replaced with luciferase reporter genes. The recombinant virus was used to express luciferase in chicken embryos and chicks, and fluorescence assays were used to distinguish between vaccine strains and wild-type strains.

Benefits of technology

It enables rapid, simple, and efficient determination of viral titers and differentiation of infection types, provides stable strain resources, and offers a highly sensitive and reliable analytical tool for IBV research and vaccine development.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121472276A_ABST
    Figure CN121472276A_ABST
Patent Text Reader

Abstract

The invention provides a cDNA (complementary deoxyribonucleic acid) clone plasmid of an avian infectious bronchitis virus (IBV) for expressing secretory luciferase as well as a virus strain and a vaccine obtained by rescuing, and belongs to the technical field of biological medicines. The invention provides a construction method of cDNA (complementary deoxyribonucleic acid) clone plasmids of IBV (infectious bursal virus), which is completed by a one-step method based on yeast homologous recombination in a segmented amplification mode. The IBV infectious cDNA clone constructed by the method has good stability, an IBV genome can be transformed on a gene level by directly utilizing in-vitro homologous recombination, and the efficiency of constructing a recombinant virus is improved. According to the invention, a non-essential gene of the infectious cDNA clone is replaced by a Gluc reporter gene, and the obtained infectious cDNA clone directly transfects mammalian cells to rescue recombinant viruses. The recombinant virus is constructed through a virus rescue method, the growth characteristic of the recombinant virus is basically consistent with that of a parent virus, and genetic stability is kept.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application belongs to the technical field of biological medicine, and particularly relates to a cDNA clone plasmid of avian infectious bronchitis virus expressing secreted luciferase, and a rescued virus strain and vaccine. BACKGROUND

[0002] Avian coronavirus, infectious bronchitis virus (IBV), causes infectious bronchitis (IB) in chickens, which is an acute and highly contagious disease and is widely prevalent in the world. IBV is prone to variation, which makes vaccines ineffective in prevention and control, making the disease the most intractable infectious disease in the poultry industry. Respiratory IB was first reported in North Dakota, USA, in 1931, and the IBV strain (Beaudette strain) was first isolated in 1937. Since then, various clinical types of IB, such as kidney type, reproductive type, and adenoid type, have been found. With the continuous variation of the strain, the genotype of IBV has become more and more complex. In 2016, Valastro et al. proposed a typing method based on genetic evolution analysis of the S1 gene, which divided the currently prevalent IBV into 6 genotypes and 32 lineages (GI-1~27, GII, GIII, GIV, GV and GVI). Based on this new genetic typing method, there are at least 16 lineages of IBV prevalent in China. The GI-19 (QX type) strain is the main dominant genotype of IBV prevalent in China, and the prevalence of GVI type strains is also expanding. The prevalence of IBV is becoming more and more complex, with large differences between genotypes and low cross-protection, and chickens are still frequently infected with IBV after vaccination. Therefore, it is an urgent theoretical and technical problem to develop vaccines using prevalent wild strains to improve the prevention and control ability of vaccines. At the same time, the early symptoms of vaccine strains and wild strains are similar after infecting chickens, and there is a lack of a simple method to quickly identify whether the infected chickens are infected with vaccine strains or wild strains. SUMMARY

[0003] The present application provides a cDNA clone plasmid of IBV expressing secreted luciferase, and a rescued virus strain and vaccine, which has high construction efficiency, and the virus rescued from the infectious cDNA clone produces secreted Gaussia luciferase into the allantoic fluid and serum when infecting chicken embryos and chicks, which is convenient for reflecting the virus titer and distinguishing between vaccine strains and wild strains infection through fluorescence determination, and is genetically stable and has high practical value.

[0004] The application provides a construction method of a cDNA clone plasmid of IBV, comprising the following steps: using a reverse transcription product of genomic RNA of IBV as a template, segmentally amplifying fragments covering the whole length of the genome of IBV; mixing the obtained several fragments with a linearized carrier pYES1L, and then transforming yeast cells, using a yeast lysate of a positive clone to transform E. coli, screening, and then extracting a plasmid, so as to obtain the cDNA clone plasmid of IBV.

[0005] In a preferred mode of the application, the segmental amplification comprises homologous arms between adjacent fragments.

[0006] In a preferred mode of the application, the method comprises amplifying fragments covering the whole length of the genome of IBV in 7 segments, and the primer group sequence used is shown in SEQ ID No. 1-14.

[0007] In a preferred mode of the application, the linearized carrier comprises using the sequence shown in SEQ ID No. 15-16 to amplify the linearized carrier pYES1L by taking pYES1L-vector as a template.

[0008] The application further provides a cDNA clone plasmid of IBV constructed by using the construction method.

[0009] The application further provides a cDNA clone plasmid of IBV expressing secreted luciferase, comprising replacing a non-essential gene in the cDNA clone plasmid of IBV which does not affect virus replication and proliferation with a luciferase reporter gene.

[0010] In a preferred mode of the application, the method comprises replacing the 3a, 3b or 5a gene with a Gluc reporter gene.

[0011] The application further provides a labeled virus strain expressing luciferase, which is obtained by rescuing the cDNA clone plasmid of IBV expressing secreted luciferase.

[0012] The application further provides a vaccine for preventing IBV, wherein the labeled virus strain is used as a vaccine strain.

[0013] In a preferred mode of the application, the basic virus strain of the vaccine strain comprises IBV ZJ971 strain.

[0014] Beneficial effects: the application provides a construction method of IBV cDNA clone plasmid, comprising the following steps: taking the reverse transcription product of IBV genomic RNA as a template, segmentally amplifying fragments covering the full length of IBV genome; mixing the obtained several fragments with linearized carrier pYES1L, and then transforming yeast cells, transforming E. coli with the yeast lysate of positive clones, screening, and extracting plasmid to obtain the IBV cDNA clone plasmid. The construction method is rapid, efficient and stable. The application solves the problem of low efficiency of traditional enzyme cutting and connection by means of segmental amplification and one-step method based on yeast homologous recombination to complete cloning construction, and greatly improves the efficiency.

[0015] The IBV infectious cDNA clone constructed by the method has good stability, and the infectious cDNA clone can directly use in vitro homologous recombination to modify IBV genome at the gene level, improve the efficiency of constructing recombinant virus, and establish a fast and effective technical platform for IBV genome. The application also improves the infectious cDNA clone, replaces the non-essential gene of virus replication and proliferation with Gluc reporter gene, and obtains the infectious cDNA clone directly transfected into mammalian cells to rescue the recombinant virus. The CMV promoter contained in the infectious cDNA clone in the application can start the synthesis of viral genomic RNA in DNA transfected cells, avoid the in vitro RNA transcription synthesis process, simplify the virus rescue operation process, and solve the problem of transcript heterogeneity caused by in vitro transcription.

[0016] The application also constructs the recombinant virus rIBV-Gluc by the method of virus rescue, expresses Gluc and secretes into chicken embryo allantoic fluid and animal serum after the recombinant virus rIBV-Gluc infects the chicken embryo, and measures the virus titer and distinguishes the vaccine strain and wild strain infection by detecting the Gluc luciferase activity in the allantoic fluid and serum. The growth characteristics are basically consistent with the parent virus, and the genetic stability is maintained. The method is rapid, simple, sensitive, reliable, can be used for high-throughput sample analysis, provides strain resources for in-depth analysis of the pathogenic mechanism of IBV, vaccine research and development and specific antiviral drug screening, and has good application prospect. BRIEF DESCRIPTION OF DRAWINGS

[0017] Figure 1 It is a schematic diagram for construction of IBV infectious cDNA clone; Figure 2 It is a gel electrophoresis diagram of RT-PCR amplification of IBV ZJ971 strain genome fragments; Figure 3 It is a gel electrophoresis diagram of linear amplification of pYES1L carrier; Figure 4Schematic diagram for construction of pYES1L-IBV-Gluc plasmid for expressing IBV infectious cDNA clone of Gluc reporter gene; Figure 5 Schematic diagram for rescue of Gluc recombinant virus; Figure 6 Schematic diagram for pathogenicity identification of Gluc recombinant virus in chicken embryo; Figure 7 Schematic diagram for indirect immunofluorescence identification of Gluc recombinant virus; Figure 8 Schematic diagram for genetic marker identification of Gluc recombinant virus; Figure 9 EID determination of recombinant virus 50 Figure 10 Growth curve determination of recombinant virus and parent virus; Figure 11 Detection of Gaussia luciferase in allantoic fluid after Gluc recombinant virus infection of chicken embryo; Figure 12 Detection of virus shedding in pharyngeal and anal swabs after recombinant virus infection of chicks; Figure 13 Detection of Gaussia luciferase activity in serum after recombinant virus infection of chicks. DETAILED DESCRIPTION

[0018] The present application provides a method for constructing a cDNA clone plasmid of IBV, comprising the following steps: using the reverse transcription product of the genomic RNA of IBV as a template, amplifying fragments covering the full length of the IBV genome in sections; mixing the amplified fragments with linearized vector pYES1L, and then co-transforming yeast cells, using the yeast lysate of positive clones to transform E. coli, screening, and then extracting plasmids to obtain the cDNA clone plasmid of IBV.

[0019] ​The IBV of the present application is an RNA virus, and the genomic RNA reverse transcription product of the IBV is used as a template when performing whole genome amplification. In an embodiment of the present application, IBV vaccine strain ZJ971 is used as an example for illustration, and the vaccine strain has been disclosed in an article (Zhou, J. Y., L. Q. Cheng, X. Y. Shen, H. M. Ding, and J. X. Wu, 2002: Cloning and sequencing of S gene of novel variant of infectious bronchitis virus ZJ971 isolates in China. Agric. Sci. China 1, 101-107), and the genome thereof is GenBank: EU714028.1.

[0020] In the present application, segmented amplification is used when performing amplification, and multiple fragments can be amplified, and adjacent fragments contain homologous arms, which can be connected by homologous recombination. In an embodiment of the present application, 7 fragments are amplified, and the primer sequences for amplifying the 7 fragments are shown in SEQ ID No. 1-14.

[0021] Table 1: Primer information required in the present application

[0022] In an embodiment of the present application, pYES1L-vector is used as a template, and the pYES1L-vector contains yeast artificial chromosome and bacterial artificial chromosome elements, and has good stability in yeast and bacteria, which solves the problem that part of the coronavirus replicase gene cannot be stably stored in Escherichia coli; at the same time, there is a cytomegalovirus (CMV) eukaryotic promoter sequence upstream of the vector, and a hepatitis D virus ribozyme (HDV Ribozyme) sequence and a bovine growth hormone polyadenylation signal (BGH) transcription termination sequence downstream of the vector, which greatly improves the rescue efficiency of the virus. In an embodiment of the present application, the amplification primer sequences of the pYES1L-vector are shown in SEQ ID No. 15-16.

[0023] In an embodiment of the present application, pYES1L-vector (Thermo Fisher: item number A13287) is used as a template, and the primer pair shown in SEQ ID No. 15-16 is used for amplification, and a linearized vector pYES1L is obtained by amplification.

[0024] The present application mixes the above-mentioned seven gene fragments and linearized carrier pYES1L, and in one embodiment, the pYES1L carrier is 100 ng, the seven DNA fragments are each 200 ng, and the total volume is < 10 μL. The present application adds the mixed eight fragments to Mav203 yeast competent cells, and transforms them into yeast cells by using a lithium acetate transformation method, inoculates them on a tryptophan (CSM-Trp) deficiency plate, and screens positive clones by using colony PCR. The yeast lysate of the positive clone is transformed into TOP10 competent cells by using an electroporation method, and a recombinant plasmid is obtained, that is, the infectious IBV cDNA clone, also referred to as the pYES1L-IBV plasmid.

[0025] The present application also provides an IBV cDNA clone plasmid constructed by using the above-mentioned construction method.

[0026] The infectious IBV cDNA clone construction method of the present application has the characteristics of high efficiency, rapidness, and stability. The IBV ZJ971 strain genome is divided into seven fragments, and the cloning construction is completed by using a one-step method based on yeast homologous recombination, thereby solving the problem of low efficiency of traditional enzyme digestion and ligation, and greatly improving the efficiency. The pYES1L carrier contains yeast artificial chromosome and bacterial artificial chromosome elements, and has good stability in yeast and bacteria, thereby solving the problem that part of the coronavirus replicase gene cannot be stably preserved in Escherichia coli. Meanwhile, the carrier has a CMV eukaryotic promoter sequence in the upstream and an HDV Ribozyme sequence and a BGH transcription termination sequence in the downstream, thereby greatly improving the rescue efficiency and stability of the virus.

[0027] The present application also provides an IBV cDNA clone plasmid for expressing a secreted luciferase, which comprises replacing a non-essential gene in the IBV cDNA clone plasmid that does not affect virus replication and proliferation with a luciferase reporter gene.

[0028] The non-essential gene can be the 3a, 3b, or 5a gene of IBV. For example, in one embodiment, the 5a gene is replaced with a Gluc reporter gene. The Gluc gene can be obtained by amplification. In one embodiment, the pCMV-Gluc plasmid (Mingling plasmid platform: item number P1365) is used as a template, and primers IBV-Gluc-F and IBV-Gluc-R are used for PCR amplification to obtain a Gluc gene fragment.

[0029] The present application deletes the 5a gene in the pYES1L-IBV plasmid by using a double enzyme digestion method. The enzymes used for double enzyme digestion are BstBI and I-CeuI, and an IBV infectious cDNA clone skeleton pYES1L-IBV-Δ5a with the 5a gene deleted is obtained.

[0030] The Gluc gene fragment and the IBV infectious cDNA clone backbone with deletion of 5a are mixed, and then in vitro homologous recombination is carried out, the recombination plasmid pYES1L-IBV-Gluc is obtained by transforming into TOP10 competent cells. The total volume of the mixture is 10 μL: 100 ng of pYES1L-IBV-Δ5a carrier, 5 ng of Gluc fragment, 5 μL of NEBuilder® HiFi DNA Assembly Master Mix and the rest of ddH2O.

[0031] The application further provides a labeled virus strain expressing luciferase, which is obtained by rescuing the cDNA clone plasmid of the IBV expressing secreted luciferase.

[0032] The rescuing method of the virus is not particularly limited, for example, in an embodiment, BHK-21 cells are used as the host, the P0 virus is obtained after transfection and rescue, and the rescued P0 virus is continuously passaged in 10-day-old chicken embryos.

[0033] The application further provides a vaccine for preventing IBV, and the above labeled virus strain is used as the vaccine strain.

[0034] The EID of the virus strain rescued by the method of the application 50 The EID of the wild virus 50 Very close, indicating that the rescued virus and the wild virus have similar growth characteristics; at the same time, it is found by determination that the rescued virus and the wild virus have similar biological characteristics; and the recombinant virus rZJ971-Δ5a-Gluc and the recombinant virus rIBV-ZJ971 are used to infect chicks, and at 24 h after infection, the luciferase activity can be detected in the serum of the chicks infected with rZJ971-Δ5a-Gluc, that is, the virus replication is detected, and the luciferase activity increases with time.

[0035] The recombinant virus rZJ971-Δ5a-Gluc can be used to prepare a vaccine for preventing IB, and the recombinant virus rZJ971-Δ5a-Gluc is used as the vaccine strain.

[0036] In order to further illustrate the application, the cDNA clone plasmid of the IBV expressing secreted luciferase, the virus strain rescued by the cDNA clone plasmid and the vaccine provided by the application are described in detail in combination with the embodiments below, but they should not be understood as limiting the protection scope of the application.

[0037] Example 1 Construction of infectious cDNA clone plasmid of avian infectious bronchitis virus ZJ971 strain According to Figure 1According to the full-length genome sequence of IBV ZJ971 strain (GenBank: EU714028.1), seven pairs of specific primers shown in Table 1 were designed by Snapgene software to amplify F1, F2, F3, F4, F5, F6 and F7 fragments, respectively.

[0038] The viral genomic RNA of IBV ZJ971 strain was extracted according to the instructions of the viral RNA extraction kit (Tiangen Biotech Co., Ltd.: Cat. No. DP315-R).

[0039] The cDNA of IBV ZJ971 strain was prepared according to the instructions of the SuperScript IV First-Strand Synthesis System (Thermo Fisher Scientific: Cat. No. 18091050) using the viral genomic RNA as the template. The reverse transcription system was as follows: 2 μM gene-specific reverse primer (IBV-R7) 1 μL, 10 mM dNTP Mix 1 μL and template RNA 11 μL. The reaction program was as follows: 65 °C for 5 min, placed on ice for 1 min.

[0040] Then the reaction system was as follows: 5 × SSIV Buffer 4 μL, 100 mM DTT 1 μL, Ribonuclease Inhibitor 1 μL and Reverse Transcriptase (200 U / μL) 1 μL. The reaction program was as follows: 50 °C for 10 min, 80 °C for 10 min, and then reduced to room temperature. 1 μL of RNase H was added, and 37 °C for 20 min was used to remove the RNA.

[0041] The F1 and F2 fragments were amplified by using IBV ZJ971 cDNA as a template and two pairs of primers IBV-F1 / IBV-R1 and IBV-F2 / IBV-R2, respectively; the F3 and F4 fragments were amplified by using IBV ZJ971 cDNA as a template and two pairs of primers IBV-F3 / IBV-R3 and IBV-F4 / IBV-R4, respectively; the F5, F6 and F7 fragments were amplified by using IBV ZJ971 cDNA as a template and three pairs of primers IBV-F5 / IBV-R5, IBV-F6 / IBV-R6 and IBV-F7 / IBV-R7, respectively; the reaction system was as follows: cDNA 1 μL, 0.625 μL of each of upstream primer (40 μM) and downstream primer (40 μM), 10 mM dNTPs 1 μL, 5×Q5 Reaction Buffer 10 μL, Q5 High-Fidelity DNA Polymerase 0.5 μL and ddH2O up to 50 μL. The amplification procedure was as follows: 98 ℃ for 30 s; 98 ℃ for 10 s, 58 ℃-63 ℃ for 20 s, 72 ℃ for 2 min, for 30 cycles; 72 ℃ for 2 min. After the above amplification, the results were as shown in Figure 2 FIG. 1, and the sizes of the target bands were 3999 bp, 4052 bp, 4126 bp, 4099 bp, 4012 bp, 4113 bp and 3479 bp, respectively.

[0042] The linearized pYES1L vector was obtained by using pYES1L-Vector as a template and primers pYES1L-F and pYES1L-R for PCR amplification, as shown in Figure 3 FIG. 2. The reaction system was as follows: pYES1L-vector 10 ng, 0.625 μL of each of upstream primer (40 μM) and downstream primer (40 μM), 10 mM dNTPs 1 μL, 5×Q5 Rection Buffer 10 μL, Q5 High-Fidelity DNA Polymerase 0.5 μL, and ddH2O up to 50 μL; the amplification procedure was as follows: 98 ℃ for 30 s; 98 ℃ for 10 s, 64 ℃ for 20 s, 72 ℃ for 5 min, for 30 cycles; 72 ℃ for 2 min. The size of the target band was 10257 bp.

[0043] Linearized pYES1L vector and F1-F7 fragments were mixed and transformed into yeast cells by lithium acetate transformation. Specifically, 100 ng of linearized vector pYES1L and 200 ng of each of the above fragments F1, F2, F3, F4, F5, F6 and F7 were mixed uniformly; then MaV203 yeast competent cells were taken out from -80°C and thawed at 30°C for no more than 90 s, and the mixture was added to the MaV203 yeast competent cells, which were mixed uniformly by tapping the tube wall, and then 600 μL of PEG / LiAc was added to the mixture of DNA and yeast competent cells, which were mixed uniformly by gently inverting, and then incubated at 30°C for 30 min, and the mixture was resuspended by gently inverting every 10 min. After incubation, 35.5 μL of DMSO was added, and the mixture was mixed uniformly by gently inverting, and then heat shocked at 42°C for 20 min, and the mixture was resuspended by gently inverting every 5 min. After heat shock, the mixture was centrifuged at 1800 rpm for 5 min, and the supernatant was carefully discarded, and the yeast cells were resuspended with 1 ml of 0.9% NaCl solution. 100 μL was taken and plated on a tryptophan-deficient yeast culture dish, and incubated at 30°C for 2-3 days.

[0044] Since the linearized pYES1L vector and fragments F1, fragments F1 and F2, fragments F2 and F3, fragments F3 and F4, fragments F4 and F5, fragments F5 and F6, fragments F6 and F7, and the linearized pYES1L vector and fragment F7 each have a homologous arm at the end, they are assembled into a recombinant plasmid carrying the full-length cDNA of ZJ971 in the host cell yeast through homologous recombination mechanism.

[0045] A single colony was picked and placed in a PCR tube containing 15 μL of Lysis Buffer, and the yeast cells were lysed by gently blowing three times, and 5 μL was transferred to a new PCR tube, which was stored at 4°C, and the remaining 10 μL was subjected to colony PCR detection, and positive clones were selected, and then electroporated into TOP10 competent cells. Positive recombinants were selected by spectinomycin resistance, and after proliferation, the recombinant plasmid carrying the full-length cDNA of IBV was purified by a plasmid midiprep kit (MACHEREY-NAGEL: item number 740410.1), and named pYES1L-IBV.

[0046] Table 2 Colony PCR detection primers

[0047] Example 2 Construction of recombinant plasmid pYES1L-IBV-Gluc based on in vitro homologous recombination technology According to Figure 4The strategy shown was used to construct an IBV infectious cDNA cloning vector backbone that was designed to cut the flanking sequences of 5a in pYESIL-IBV based on in vitro homologous recombination technology, thereby obtaining the IBV infectious cDNA cloning vector backbone that lacks 5a.

[0048] (1) Using pCMV-Gluc plasmid as a template, PCR amplification was performed using primers IBV-Gluc-F and IBV-Gluc-R to obtain the Gluc gene fragment; (2) The pYES1L-IBV plasmid was cut with BstBI and I-CeuI to obtain an IBV infectious cDNA clone backbone with a 5a deletion. (3) The Gluc fragment and the IBV infectious cDNA clone backbone fragment with 5a deletion were mixed and assembled into a recombinant plasmid using the NEB HiFi DNA Assembly Master Mix (catalog number E2621S) via in vitro homologous recombination (refer to the kit instructions). The plasmid was then electroporated into Top10 electrocompetent cells and positive clones were screened by colony PCR.

[0049] Example 3 Construction of helper plasmids Targeting the open reading frame region of the N gene in IBV, specific primers IBV-NF and IBV-NR, as shown in Table 1, were designed using Snapgene software. Using pYES1L-IBV as a template, PCR amplification was performed to obtain the N gene fragment.

[0050] The purified N gene fragment was inserted between the SacI and XhoI sites of the pCAGGS vector using a standard enzyme digestion and ligation assay. The ligation product was then transformed into DH5α competent E. coli cells, and the correct recombinant plasmid pCAGGS-IBV-N was identified by sequencing. The plasmid was extracted according to the instructions of the endotoxin-free plasmid extraction kit, and after concentration determination, it was aliquoted and stored at -20℃.

[0051] Example 4 Rescue and biological characterization of recombinant strain ZJ971 of avian infectious bronchitis virus 1. Rescue and amplification of recombinant viruses The rescue process for recombinant viruses is as follows: Figure 5 As shown, BHK-21 cells were divided into groups of 5 × 10⁻⁶. 5The BHK-21 cells were transfected with the DNA plasmid, and the density of the cells was seeded in a 12-well cell culture plate at 2 x 105 cells / well and cultured in a DMEM medium containing 10% FBS. When the cell density reached 60-70%, the plasmid was transfected according to the Lipofectamine 3000 (Thermo Fisher, L3000075) transfection reagent instructions, and the amount of the plasmid used in each well was 2 μg. At 48 h after the transfection, the virus supernatant was collected and named as P0 generation virus.

[0052] The rescued virus was continuously passaged in 10-day-old chicken embryos, and each generation of culture was stored in a -80°C refrigerator. The specific steps were as follows: the P0 generation rescued virus was inoculated into 10-day-old SPF chicken embryos after being sterile filtered, the allantoic fluid was harvested after 36 h, and the virus was blindly passed for three generations. During the passage in the chicken embryos, it was found that the chicken embryos died in each generation. The third generation of SPF chicken embryos inoculated with the rescued strain showed typical dwarf embryo lesions of IBV infection, such as Figure 6 embryo body development was slow, short, and curled.

[0053] 2. Identification of recombinant virus indirect immunofluorescence test The DNA transfected BHK-21 cells were fixed with frozen methanol, and the supernatant was discarded after 15 min. After the cells were completely air-dried, the monoclonal antibody of IBV N protein was added, and the cells were incubated at 37°C for 1 h. The cells were washed with PBS for 5 times, and then the Alexa 488 conjugated Goat Anti-Mouse IgG H&L secondary antibody (purchased from Jackson immune research Inc) was added. The cells were washed with PBS for 5 times, and then DAPI staining was added for 5 min. The cells were washed with PBS for 2 times, and then the experimental results were observed and recorded by a fluorescence microscope.

[0054] The results are shown in Figure 7 No green fluorescence was observed in the NC group, and obvious green fluorescence was observed in the cells transfected with rIBV-ZJ971-△5a-Gluc.

[0055] 3. Identification of genetic markers of recombinant virus In order to exclude the problem of wild-type strain pollution, the RNA of the P0 generation rescued virus and the allantoic fluid (P1-P3) harvested by blindly passing the inoculated chicken embryos was extracted, and the virus cDNA was obtained by reverse transcription reaction using a reverse transcription kit. According to the sequence of IBV ZJ971, the size of the 621 bp fragment between 5211 and 5831 bp of the virus genome was amplified by using a silent mutation primer, and the size of the obtained band was consistent with the size of the target gene and was subjected to sequencing analysis. The results are shown in Figure 8 The amplified product contains the introduced silent mutation, indicating that the correct reverse genetic strain is obtained, and the wild-type strain is not contaminated.

[0056] Silent mutation-F (SEQ ID No. 35): ATGGCTTTATGGGTTCTAAAA; Silent mutation-R (SEQ ID No. 36): ATGAGTCTTCACAACTT.

[0057] 4. Identification of the biological characteristics of rescue poisons After five generations of blind passage of the rescue virus in chicken embryos, EID was measured in the allantoic fluid of infected chicken embryos. 50 Simultaneously, it was compared with wild-type toxins of the same generation in chicken embryos through blind passage. Results are as follows: Figure 9 As shown, the EID that saved the poison was discovered. 50 EID with wild poison 50 Very close.

[0058] 10 2 EID 50 Diluted ZJ971 (WT), recombinant ZJ971 strain rZJ971, and rZJ971-Δ5a-Gluc recombinant virus were inoculated into the allantoic cavity of 10-day-old SPF chicken embryos. 500 μL of allantoic fluid was harvested at 12 h, 24 h, 36 h, 48 h, 60 h, and 72 h, and RNA was extracted and amplified by RT-qPCR using the following primer pairs. All samples were tested in triplicate, and the copy number of each viral RNA was calculated based on a standard curve. Growth curves for each virus were then plotted based on the copy number.

[0059] MF (SEQ ID No. 37): GTCCAACGAGACAAATTG; MR (SEQ ID No. 38):CCAGAAACACCATAACAC.

[0060] The results are as follows Figure 10 As shown, rIBV-ZJ971, rIBV-ZJ971-Gluc, and WT-ZJ971 all reached peak replication at 36 h. There was no significant difference (ns) between rIBV-ZJ971 and WT-ZJ971 at reaching maximum copy number, while there was a highly significant difference (P<0.01) between WT-ZJ971 and rIBV-ZJ971-Gluc at reaching maximum copy number. This indicates that the recombinant viruses rIBV-ZJ971 and WT-ZJ971 rescued through reverse genetics have similar replication capabilities, while the replication capability of the recombinant virus rIBV-ZJ971-Gluc rescued through reverse genetics is weakened, suggesting that the insertion of Gluc may have affected viral replication.

[0061] 5. Detection of Gaussia luciferase activity in allantoic fluid of chicken embryos infected with rIBV-H120-GLuc Ten-day-old chicken embryos were infected with recombinant virus rIBV-GLuc. Allantoic fluid was collected at 12h, 24h, 36h, 48h, 60h, and 72h post-infection, and its luciferase activity was measured. Results are as follows: Figure 11 As shown, enzyme activity was detected in chicken embryos 12 hours after infection with recombinant virus expressing luciferase. Enzyme activity increased rapidly between 12 and 36 hours, maintained at its highest level between 36 and 60 hours, and then gradually decreased.

[0062] 6. Compared with the parent virus, the viral shedding and Gaussia luciferase activity in the serum of chicks infected with rZJ971-Δ5a-Gluc were detected. 6.1 Detection of viral shedding in pharyngeal and anal swabs of chicks infected with rIBV-ZJ971 One-day-old chicks were infected with recombinant virus rZJ971-Δ5a-Gluc and parental virus WT-IBV-ZJ971, respectively. Pharyngeal and anal swabs were collected at 12h, 24, 36h, 48h, 60h, 72h, 84h, and 96h post-infection. The viral shedding of recombinant virus rZJ971-Δ5a-Gluc and parental virus WT-IBV-ZJ971 at different time points was compared using qRT-PCR. The results are as follows: Figure 12 As shown, the rescue virus has the same biological characteristics as the parent virus.

[0063] 6.2 Detection of Gaussia luciferase activity in the serum of chicks infected with rZJ971-Δ5a-Gluc Recombinant virus rZJ971-Δ5a-Gluc and recombinant virus rIBV-ZJ971 were used to infect chicks. Blood samples were collected at 12h, 24, 36h, 48h, 60h, 72h, 84h and 96h post-infection. After standing for half an hour, the samples were centrifuged to obtain serum and its luciferase activity was detected.

[0064] like Figure 13 As shown, from 24 hours onwards, significant luciferase activity was detected in the serum of chicks infected with rZJ971-Δ5a-Gluc, indicating viral replication, and this activity increased over time. However, no luciferase activity was detected in the serum of chicks infected with rIBV-ZJ971, which was consistent with the expected results.

[0065] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A method for constructing a cDNA cloning plasmid of avian infectious bronchitis virus, characterized in that, Includes the following steps: Using the reverse transcription product of avian infectious bronchitis virus (AIB) genomic RNA as a template, fragments covering the full length of the AIB genome were amplified in segments. Several amplified fragments were mixed with the linearized vector pYES1L and co-transformed into yeast cells. The yeast lysate of positive clones was used to transform Escherichia coli. After screening, plasmids were extracted to obtain the cDNA clone plasmid of AIB.

2. The construction method according to claim 1, characterized in that, During the segmented amplification, adjacent segments contain homologous arms.

3. The construction method according to claim 1 or 2, characterized in that, The amplification process includes seven segments covering the full length of the avian infectious bronchitis virus genome, using primer sequences shown in SEQ ID No. 1-14.

4. The construction method according to claim 3, characterized in that, The linearized vector is obtained by amplifying the sequence pairs shown in SEQ ID No. 15~16 using pYES1L-vector as a template.

5. A cDNA clone plasmid of avian infectious bronchitis virus constructed using the construction method described in any one of claims 1 to 4.

6. A cDNA cloning plasmid expressing secretory luciferase-producing avian infectious bronchitis virus, characterized in that, This includes replacing non-essential genes in the cDNA clone plasmid of the avian infectious bronchitis virus of claim 5 that do not affect viral replication and proliferation with a luciferase reporter gene.

7. The cDNA cloning plasmid expressing secretory luciferase of avian infectious bronchitis virus according to claim 6, characterized in that, This includes replacing genes 3a, 3b, or 5a with the Gluc reporter gene.

8. A labeled virus strain expressing luciferase obtained by rescuing a cDNA clone plasmid of an avian infectious bronchitis virus expressing secretory luciferase as described in claim 6 or 7.

9. A vaccine for the prevention of avian infectious bronchitis virus, characterized in that, The labeled virus strain as described in claim 8 is used as the vaccine strain.

10. The vaccine according to claim 9, characterized in that, The base strain of the vaccine strain includes the avian infectious bronchitis virus ZJ971 strain.

Citation Information

Patent Citations

  • Avian infectious bronchitis virus natural mutant

    CN105624122A

  • Infectious bronchitis vaccine strain

    CN112891528A

  • GI type Japanese encephalitis virus recombinant virus capable of stably expressing secretory luciferase Gluc as well as construction method and application of GI type Japanese encephalitis virus recombinant virus

    CN115896171A

  • Method for rapidly constructing infectious clone of avian infectious bronchitis virus as well as product and application thereof

    CN115896173A

  • Preparation and application of avian infectious bronchitis virus attenuated strain

    CN118620850A