Method for biosynthesizing luteolin or piceatannol by using CO2 and application of method
By introducing exogenous genes and a phosphite dehydrogenase system into the photosynthetic microorganism Synechococcus, the problems of insufficient reducing power and precursor supply in the synthesis of luteolin and paclitaxel were solved, realizing efficient and low-cost CO2 biosynthesis and providing a sustainable industrial production pathway.
Patent Information
- Application Number
- CN202511735690.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-11-24
- Publication Date
- 2026-02-06
AI Technical Summary
In the existing technology, the commercial acquisition of luteolin and paclitaxel relies on plant extraction and chemical synthesis, which has problems such as low raw material content, complex separation and purification, high cost and environmental pollution. In addition, there is a reducing power competition between the biosynthetic pathway of luteolin or paclitaxel in photosynthetic microorganisms and the metabolism in the cellular center, resulting in low synthesis efficiency.
By introducing exogenous genes into the photosynthetic microorganism Synechococcus, a genetically engineered strain was constructed to express a tandem synthase system and phosphite dehydrogenase. Utilizing the reducing power provided by light and phosphite, the efficient synthesis of luteolin or paclitaxel was achieved, solving the problems of insufficient reducing power and precursor supply.
This method enables the efficient and low-cost direct synthesis of luteolin or paclitaxel from CO2, avoiding the complex steps and environmental pollution of traditional methods. It provides a sustainable production route for high-value compounds and has broad prospects for industrial applications.
Smart Images

Figure CN121472281A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the field of bioengineering, and particularly relates to a method for biosynthesis of luteolin or piceatannol using CO2 and application thereof. BACKGROUND
[0002] Luteolin is a natural flavonoid compound widely present in various vegetables, fruits and herbs, while piceatannol is a natural stilbene compound found in plants such as grapes and passion fruit, which is an important analogue of resveratrol. Both of these two polyphenolic compounds show strong biological activities, including but not limited to significant antioxidant, anti-inflammatory, anti-tumor, neuroprotective and cardiovascular protective physiological functions, making them have extremely high application value and broad market prospects in the fields of functional food, health products, cosmetics and pharmaceutical development. However, the current commercial access to luteolin and piceatannol mainly relies on plant extraction and chemical synthesis. The plant extraction method is limited by low content of target components in raw materials, complex separation and purification process, low yield and easy influence by season and geographical environment; the chemical synthesis method often involves multi-step reactions, harsh reaction conditions, possible use of toxic reagents and generation of environmental pollutants, resulting in high production cost. Therefore, it is urgent to develop an efficient, clean, low-cost and sustainable biological manufacturing method to replace the traditional production method to meet the growing market demand.
[0003] In recent years, the use of photosynthetic microorganisms to directly convert carbon dioxide (CO2) to produce chemicals is considered as a very promising sustainable biological manufacturing approach. Algae such as cyanobacteria and green algae are a type of microorganism that can perform oxygen-producing photosynthesis, which can directly utilize solar energy and atmospheric CO2 as carbon source for autotrophic growth, without the need for organic carbon source, avoiding the dependence on food crops. In addition, algae have the advantages of relatively fast growth, simple cultivation conditions, easy genetic modification, etc., making them one of the ideal chassis organisms for constructing "light-driven cell factories". Through genetic engineering to modify the metabolic network of algae, the fixed carbon of photosynthesis is guided to the synthesis pathway of target products, which has become a research hotspot in the fields of synthetic biology and metabolic engineering, aiming to achieve low-cost and environmentally friendly production of chemicals.
[0004] It is considered as a promising alternative to traditional fermentation to introduce biosynthetic pathways of luteolin or coniferyl alcohol into photosynthetic microorganisms to produce luteolin or coniferyl alcohol by directly fixing CO2 using photosynthesis. However, the biosynthetic pathways of these aromatic compounds are complex multi-enzyme catalytic long-chain reactions. They not only require sufficient amounts of common precursors, such as l-tyrosine derived from the shikimic acid pathway and malonyl-CoA derived from central carbon metabolism, but also consume a large amount of cellular reducing power (NADPH), especially in key catalytic steps such as P450 hydroxylase. In photosynthetic autotrophs such as cyanobacteria, most of the reducing power produced by photosynthesis is preferentially used for CO2 fixation (Calvin cycle) and cell growth, which leads to strong competition between the heterologous synthesis pathway and the cell central metabolism for key precursors and cofactors (especially NADPH). Therefore, how to effectively regulate carbon flow distribution and provide sufficient additional reducing power to break through the balance limit between photosynthetic carbon fixation efficiency and target product synthesis flux is an important challenge for realizing efficient and stable production of luteolin or coniferyl alcohol by photosynthetic microorganisms.
[0005] Therefore, the skilled person in the art is committed to developing a method for biosynthesizing luteolin or coniferyl alcohol using CO2 and its application. SUMMARY
[0006] In view of the above defects of the prior art, the technical problem to be solved by the present application is to develop a method for biosynthesizing luteolin or coniferyl alcohol using CO2 and its application.
[0007] To achieve the above-mentioned object, the present application provides a method for biosynthesizing luteolin or coniferyl alcohol using CO2 and its application.
[0008] Further, a method for biosynthesizing luteolin or coniferyl alcohol using CO2 comprises the following steps: Step one, introducing an exogenous gene into the genome of a wild-type photosynthetic microorganism to construct a genetically engineered photosynthetic microorganism; the wild-type photosynthetic microorganism is Synechococcus sp. PCC 7002; Synechococcus elongatus The exogenous gene exists in the form of a tandem expression structure in the Synechococcus sp. PCC 7002 engineering strain; the exogenous gene includes a codon-optimized synthetic enzyme coding gene suitable for the photosynthetic microorganism and a phosphite dehydrogenase (ptdh) coding gene; the nucleotide sequence of the phosphite dehydrogenase (ptdh) coding gene is shown as SEQ ID NO: 1; the synthetic enzyme coding gene includes an upstream gene module and a downstream gene module; the upstream gene module is composed of a tyrosine ammonia lyase (tal) coding gene and a 4-coumarate-CoA ligase (4cl) coding gene, and the nucleotide sequences thereof are shown as SEQ ID NO: 2 and 3, respectively; When synthesizing luteolin, the downstream gene module contains chalcone synthase chs-encoding gene, chalcone isomerase chi-encoding gene, flavone synthase fns-encoding gene, and flavonoid 3'-hydroxylase f3'h-encoding gene, the nucleotide sequences of which are shown in SEQ ID NOs: 4-7, respectively; When synthesizing piceatannol, the downstream gene module contains stilbene synthase sts-encoding gene, resveratrol 3'-hydroxylase HpaB-encoding gene, and resveratrol 3'-hydroxylase HpaC-encoding gene, the nucleotide sequences of which are shown in SEQ ID NOs: 8-10, respectively; Step two, the prepared genetically engineered photosynthetic microorganism is activated and subjected to liquid fermentation culture under light, CO2 is provided as the sole carbon source during the culture process, and phosphite is supplemented, so as to synthesize luteolin or piceatannol.
[0009] Further, in the step one, the tandem expression structure contains a promoter operably linked to the first gene in the tandem structure, and the promoter is psbA2.
[0010] Further, in the step one, each gene in the tandem expression structure independently has a promoter operably linked thereto, and the promoter is psbA2; the promoter is realized through a terminator-promoter, namely a TP fragment; the nucleotide sequence of the TP fragment is shown in SEQ ID NO: 11.
[0011] Further, in the step one, the phosphite dehydrogenase pdth-encoding gene is derived from Pseudomonas stutzeri (ATCC 17588) (GenBank No. YP_001 126 1 1 1 ). Pseudomonas stutzeri )。
[0012] Further, in the step one, the tyrosine ammonia-lyase tal-encoding gene is derived from Saccharimonospora sp. (GenBank No. YP_001 1 1 1 1 1 1 ); Saccharothrix espanaensis the 4-coumarate-CoA ligase 4cl-encoding gene is derived from Arabidopsis thaliana (GenBank No. YP_001 1 1 1 1 1 1 ); Arabidopsis thaliana the chalcone synthase chs-encoding gene is derived from Petunia hybrida (GenBank No. YP_001 1 1 1 1 1 1 ); Petunia hybrida the chalcone isomerase chi-encoding gene is derived from Arabidopsis thaliana (GenBank No. YP_001 1 1 1 1 1 1 ); Arabidopsis thaliana the flavone synthase fns-encoding gene is derived from Petroselinum crispum (GenBank No. YP_001 1 1 1 1 1 1 ); Petroselinum crispum the flavonoid 3'-hydroxylase f3'h-encoding gene is derived from Arabidopsis thaliana (GenBank No. YP_001 1 1 1 1 1 1 ); Arabidopsis thaliana the stilbene synthase sts-encoding gene is derived from Vitis vinifera (GenBank No. YP_001 1 1 1 1 1 1 ); Vitis vinifera the resveratrol 3'-hydroxylase HpaB and HpaC-encoding genes are derived from Escherichia coli.
[0013] Furthermore, in step one, the method for preparing the genetically engineered photosynthetic microorganism is as follows: 1) Constructing a recombinant plasmid for the synthesis of luteolin pSyn_ptdh_tal_4cl_chs_chi_fns_f3'h Or construct a recombinant plasmid for the synthesis of paclitaxel. pSyn_ptdh_tal_4cl_sts_HpaB_HpaC ; 2) The recombinant plasmid obtained in step 1) was introduced into Synechococcus host cells and cultured on BG11 solid selection medium supplemented with spectinomycin to screen for transformants; 3) After expanding the culture of the transformants, genomic DNA was extracted, and the exogenous gene was successfully integrated into the neutral site 1 (NSI) of the Synechococcus genome by PCR, thereby obtaining the genetically engineered photosynthetic microbial strain S-Lut that produces luteolin, or the genetically engineered photosynthetic microbial strain S-Pic that produces paclitaxel.
[0014] Furthermore, in step two, the culture medium for liquid fermentation is 5xBG liquid medium.
[0015] Furthermore, in step two, the conditions for liquid fermentation culture are as follows: 32°C, continuous introduction of 3% CO2 gas by volume, and initial light intensity of 80 μE·s. -1 ·m -2 150 μE·s after 1 day -1 ·m -2 It increased to 400 μE·s after 2 days. -1 ·m -2 , and cultivate for 15 days.
[0016] Furthermore, on day 7, a KH2PO3 solution with a concentration of 120.1 g / L was added, at a volume of 5 mL / L.
[0017] Furthermore, the method is applied in the preparation of luteolin or paclitaxel.
[0018] In a preferred embodiment 1 of the present invention, the expression plasmid is described in detail. pSyn_ptdh_tal_4cl_chs_chi_ fns_f3'h The construction process; In another preferred embodiment 2 of the present invention, the expression plasmid is described in detail. pSyn_ptdh_tal_4cl_sts_ HpaB_HpaC The construction process; In another preferred embodiment 3 of the present invention, the preparation process of the engineered Synechococcus is described in detail; In another preferred embodiment 4 of the present invention, the process of producing luteolin using the engineered bacteria S-Lut of Synechococcus is described in detail. In another preferred embodiment 5 of the present invention, the process of producing paclitaxel using the engineered bacteria S-Pic of Synechococcus is described in detail. Technical effects: 1. This invention genetically modifies photosynthetic microorganisms such as cyanobacteria, modularly assembling the biosynthetic pathways of luteolin or paclitaxel with the reducing power regeneration pathway represented by phosphite dehydrogenase in photosynthetic microorganisms. The resulting genetically engineered photosynthetic microorganisms can directly and efficiently convert inexhaustible solar energy, greenhouse gas CO2, and phosphite into high-value luteolin or paclitaxel, avoiding the consumption of organic carbon sources such as food crops and the complex steps and environmental pollution of traditional plant extraction or chemical synthesis.
[0019] 2. When the genetically engineered photosynthetic microorganisms of the present invention are photoautotrophically cultured in a phosphite-containing medium, the genetically engineered photosynthetic microorganisms significantly improve the supply of intracellular reducing power by utilizing the additional reducing power provided by phosphite, thereby efficiently producing luteolin or paclitaxel. The products can be used in food additives, pharmaceutical preparations, cosmetic ingredients, and functional health products, and have broad industrial application prospects.
[0020] 3. The method provided by this invention greatly reduces the cost of raw materials and can also absorb the greenhouse gas CO2. It provides a promising technical approach to replace traditional production methods that rely on plant extraction, chemical synthesis or heterotrophic fermentation, and has important practical significance and industrial application value.
[0021] The following will further explain the concept, specific structure, and technical effects of the present invention in conjunction with the accompanying drawings, so as to fully understand the purpose, features, and effects of the present invention. Attached Figure Description
[0022] Figure 1 This is a schematic diagram illustrating the principle of the method of the present invention; Figure 2 This is a schematic diagram of exogenous gene integration in a preferred embodiment 3 of the present invention; Figure 3 This is a graph showing the change in titer of luteolin produced by the engineered bacteria S-Lut of Synechococcus in a preferred embodiment of the present invention over time. Figure 4 This is a graph showing the change in titer of paclitaxel produced by the engineered bacteria S-Pic of Synechococcus in a preferred embodiment of the present invention over time. Detailed Implementation
[0023] The following description, with reference to the accompanying drawings, illustrates several preferred embodiments of the present invention to make its technical content clearer and easier to understand. The present invention can be embodied in many different forms, and the scope of protection of the present invention is not limited to the embodiments mentioned herein.
[0024] The strains and growth conditions used in this invention are as follows: The cloning host DH5α was purchased from Invitrogen. All E. coli were cultured in LB medium containing 100 mg / L spectinomycin at 37°C.
[0025] Synechococcus elongatus PCC7942 was purchased from the American Type Culture Collection. During the construction phase, Synechococcus was grown in BG11 liquid medium with 3% agar powder added to the solid medium. Culture conditions were: 32°C, light intensity 100 μE·s. -1 ·m -2 And continuously introduce 1% (v / v) C Gas. For the production of luteolin or paclitaxel from transformed genetically engineered algal strains, they were cultured in 5×BG phosphite liquid medium supplemented with 20 mg / L spectinomycin. Culture conditions: 32°C, with continuous 3% (v / v) C gas aeration. Gas, initial light intensity 80 μE·s -1 ·m -2 It increased to 150 μE·s after 1 day. -1 ·m -2 Two days later, it further increased to 400 μE·s -1 ·m -2 .
[0026] The LB medium formula is as follows: peptone 10 g / L; yeast extract 5 g / L; NaCl 5 g / L; pH 7.0; The formula for BG11 liquid culture medium is as follows: 10 mL of BG11 stock solution; 1 mL of ferric ammonium citrate solution (6 g / L); 1 mL of Na2CO3 solution (20 g / L); 1 mL of K2HPO4 solution (30.5 g / L); and distilled water to a final volume of 1 L. The formula for the above BG11 mother liquor is as follows: NaNO3 149.6 g; MgSO4·7H2O 7.5 g; CaCl2·2H2O 3.6 g; citric acid 0.6 g; EDTA-2Na solution (pH 8.0, concentration 0.25 M) 12 mL; 100 mL trace element solution; distilled water to a final volume of 1 L; The formula for the above trace element solution is as follows: H3BO3 2.86 g; MnCl2·7H2O 81 g; ZnSO4·7H2O 0.22 g; Na2MoO4·2H2O 0.39 g; CuSO4·5H2O 0.079 g; Co(NO3)2·6H2O 0.049 g; distilled water to a final volume of 1 L; The formulation of the 5xBG phosphite liquid culture medium is as follows: 50 mL of BG11 stock solution; 5 mL of ferric ammonium citrate solution (6 g / L); 5 mL of Na2CO3 solution (20 g / L); 5 mL of KH2PO3 solution (120.1 g / L); and distilled water to a final volume of 1 L.
[0027] All plasmids were pSyn_6 (purchased from Invitrogen) derived plasmids, used to express the target gene by homologous recombination integration into the genome of Synechococcus.
[0028] Example 1: Construction of expression plasmid pSyn _ptdh_tal_4cl_chs_chi_fns_f3'h
[0029] (1) Extraction of pSyn_6 plasmid: Escherichia coli DH5α containing pSyn_6 plasmid was inoculated at a 1% inoculum into 5 mL of LB liquid medium containing 100 mg / L spectinomycin and incubated at 37°C for 12 h. Plasmids were then extracted from the cultured bacterial cells using a standard plasmid mini-extraction kit (Tiangen Biotech Co., Ltd.) according to the instructions.
[0030] (2) Synthesis ptdh , tal , 4cl , chs, chi , fns , f3'h Genes and terminators-promoter fragments
[0031] Using the online software JCat, codon optimization was performed on the following genes based on the codon preferences of *Synechococcus*: *Pseudomonas schrenckii* phosphite dehydrogenase (ptdh), *Sacchariformis fasciatus* tyrosine ammonia-lyase (tal), *Arabidopsis thaliana* 4-coumaroyl-CoA ligase (4cl), *Petunia jasminoides* chalcone synthase (chs), *Arabidopsis thaliana* chalcone isomerase (chi), *Parsley* flavonoid synthase (fns), and *Arabidopsis thaliana* flavonoid 3'-hydroxylase (f3'h). The optimized nucleotide sequences are shown in SEQ ID NO: 1-7, respectively. The terminator-promoter (TP) fragment nucleotide sequence is shown in SEQ ID NO: 11. All sequences were synthesized by Genewiz.
[0032] (3) Amplifying gene fragments
[0033] Using the gene synthesized in step (2) as a template, recombinant PCR amplification was performed according to the method described in *Molecular Cloning: A Laboratory Manual (Third Edition)*. The PCR primers and sequences for each fragment are as follows: Segment 1: ptdh(SEQ ID NO: 1) Upstream primer ptdh.F: GAAGGAGCGTCAGATCTCATATGCTGCCGAAACTGGTTATCA CTC; Downstream primer ptdh.R: tacctcctttagaatagtttcgagTTAACATGCGGCCGGCTC.
[0034] Segment 2: tal (SEQ ID NO: 2)
[0035] Upstream primer tal.F: aaactattctaaaggaggtaaactATGACCCAAGTGGTGGAACGC; Downstream primer tal.R: tacctcctttagaatagtttcgagTTAGCCAAAATCTTTGCCATCGGCT.
[0036] Segment 3: 4cl (SEQ ID NO: 3)
[0037] Upstream primer 4cl.F: aaactattctaaaggaggtaaactATGGTGCTGCAACAACAAACCC; Downstream primer 4cl.R: ctagatcgagTTATTTACTACACATGGTTTCCAGTTTGGCG.
[0038] Segment 4: chs (SEQ ID NO: 4)
[0039] Upstream primer chs.F: CAGATCTCATATGGTGACCGTGGAAGAATACCG; Downstream primer chs.R: tacctcctttagaatagtttcgagTTAGGTGGCCACACTGTGCAG.
[0040] Segment 5: chi (SEQ ID NO: 5)
[0041] Upstream primer chi.F: aaactattctaaaggaggtaaactATGAGTAGTAGTAATGCCTGTGCCAGTC; Downstream primer chi.R: tacctcctttagaatagtttcgagTTAATTTTCTTTGGCCAGTTTTTCTTCCACACTG.
[0042] Segment 6: fns (SEQ ID NO: 6)
[0043] Upstream primer fns.F: aaactattctaaaggaggtaaactATGGCCCCCACCACCATTAC; Downstream primer fns.R: tacctcctttagaatagtttcgagTTAGGCCAGATTTTCATCGGCACTTTTACTTTTC.
[0044] Segment 7: f3’h (SEQ ID NO: 7)
[0045] Upstream primer f3h.F: aaactattctaaaggaggtaaactATGGCCACCCTGTTTCTGACC; Downstream primer f3h.R: TTGCCTGGTACCGCGGATCCTTAGCCACTGCCCAGGCC.
[0046] Fragment 8: TP (SEQ ID NO: 11)
[0047] Upstream primer TP.F: TAGTAAATAActcgatctagagtcgacctgcagg; Downstream primer TP.R: CGGTCACCATATGAGATCTGACGCTCCTTCGAGG.
[0048] (4) The pSyn_6 plasmid extracted in step (1) was double-digested with NEB restriction endonucleases NdeI and BamHI. The digested plasmid was then recovered using the AxyPrep DNA Gel Extraction Kit from Axygen, following the method described in the instruction manual. The plasmid obtained in step (3) ptdh , tal , 4cl , chs , chi , fns , f3'h The TP fragment and the recovered pSyn_6 plasmid were seamlessly cloned using the Vazyme ClonExpress Ultra One Step Cloning Kit according to the method described in the instruction manual to obtain the recombinant plasmid. pSyn_ptdh_tal_4cl_chs_chi_fns_f3' h .
[0049] Example 2: Construction of expression plasmid pSyn_ptdh_tal_4cl_sts_HpaB_HpaC
[0050] (1) Extraction of pSyn_6 plasmid
[0051] Escherichia coli DH5α containing pSyn_6 plasmid was inoculated at a 1% inoculum into 5 mL of LB liquid medium containing 100 mg / L spectinomycin and incubated at 37°C for 12 h. Plasmids were then extracted from the cultured bacterial cells using a standard plasmid mini-extraction kit (Tiangen Biotech Co., Ltd.) according to the instructions.
[0052] (2) ptdh , tal , 4cl , sts , HpaB , HpaC Genes and terminators-promoter fragments
[0053] Using the online software JCat, codon optimization was performed on the following genes based on codon preferences: *Pseudomonas schlegelii* encoding phosphite dehydrogenase (ptdh), *Sacchariphys lasioides* encoding tyrosine ammonia-lyase (tal), *Arabidopsis thaliana* encoding 4-coumaroyl-CoA ligase (4cl), *Vitis stilbene* encoding stilbene synthase (sts), and *Escherichia coli* encoding resveratrol 3'-hydroxylases (HpaB and HpaC). The optimized nucleotide sequences are shown in SEQ ID NO: 1-3 and 8-10. The terminator-promoter (TP) fragment nucleotide sequence is shown in SEQ ID NO: 11. All sequences were synthesized by Genewiz.
[0054] (3) Amplifying gene fragments
[0055] Using the gene synthesized in step (2) as a template, recombinant PCR amplification was performed according to the method described in *Molecular Cloning: A Laboratory Manual (Third Edition)*. The PCR primers and sequences for each fragment are as follows: Segment 1: ptdh (SEQ ID NO: 1) Upstream primer ptdh.F: GAAGGAGCGTCAGATCTCATATGCTGCCGAAACTGGTTATCA CTC; Downstream primer ptdh.: tacctcctttagaatagtttcgagTTAACATGCGGCCGGCTC.
[0056] Segment 2: tal (SEQ ID NO: 2)
[0057] Upstream primer tal.F: aaactattctaaaggaggtaaactATGACCCAAGTGGTGGAACGC; Downstream primer tal.R: tacctcctttagaatagtttcgagTTAGCCAAAATCTTTGCCATCGGCT.
[0058] Segment 3: 4cl (SEQ ID NO: 3)
[0059] Upstream primer 4cl.F: aaactattctaaaggaggtaaactATGGTGCTGCAACAACAAACCC; Downstream primer 4cl.R: ctagatcgagTTATTTACTACACATGGTTTCCAGTTTGGCG.
[0060] Segment 4: sts (SEQ ID NO: 8)
[0061] Upstream primer sts.F: CAGATCTCATATGGCCAGTGTGGAAGAATTTCGC; Downstream primer sts.R: tacctcctttagaatagtttcgagTTAATTGGTCACGGTGGGAATACTGTGC.
[0062] Segment 5: HpaB (SEQ ID NO: 9)
[0063] Upstream primer HpaB.F: aaactattctaaaggaggtaaactATGAAACCCGAAGATTTTCGCGC; Downstream primer HpaB.R: tacctcctttagaatagtttcgagTTATTTCAGCAGTTTATCCAGCATATTAATATCATCATTATTGTGCAG.
[0064] Segment 6: HpaC (SEQ ID NO: 10)
[0065] Upstream primer HpaC.F: aaactattctaaaggaggtaaactATGCAACTGGATGAACAACGCCTG; Downstream primer HpaC.R: TTGCCTGGTACCGCGGATCCTTAAATGGCGGCTTCCATTTC
[0066] CAGC.
[0067] Fragment 7: TP (SEQ ID NO: 11)
[0068] Upstream primer TP.F: TAGTAAATAActcgatctagagtcgacctgcagg; Downstream primer TP2.R: CACTGGCCATATGAGATCTGACGCTCCTTCGAGG.
[0069] (4) The pSyn_6 plasmid extracted in step (1) was double-digested with NEB restriction endonucleases XhoI and BamHI. The digested plasmid was then recovered using the AxyPrep DNA Gel Extraction Kit from Axygen, following the method described in the instruction manual. The plasmid obtained in step (3) ptdh, tal, 4cl, sts, HpaB, HpaC The TP gene fragment and the recovered pSyn_6 plasmid were seamlessly cloned using the Vazyme ClonExpress Ultra One Step Cloning Kit according to the method described in the instructions to obtain the recombinant plasmid pSyn. _ptdh_tal_4cl_sts_HpaB_HpaC .
[0070] Example 3: Algal strain transformation and acquisition of engineered Synechococcus strains
[0071] (1) Transformation of Synechococcus strains
[0072] Take the logarithmic growth phase (OD) 730 10 mL of *Synechococcus elongatus* cells (gravitational age 0.4-0.8) were centrifuged at 5000 rpm for 5 minutes to collect the cells. The cells were washed once with sterile 10 mM NaCl and then resuspended in 5 mL of fresh BG11 medium. 500 μL of the bacterial culture was transferred to an EP tube, and the recombinant plasmid (pSyn) prepared in Example 1 or Example 2 was added to a final concentration of 100 ng / mL. _ptdh_tal_4cl_chs_chi_fns_f3'h or pSyn _ptdh_tal_4cl_sts_ HpaB_HpaC After mixing, incubate at 30°C in the dark for 12-18 hours. Spread the mixture onto BG11 solid medium (containing 20 μg / mL spectinomycin) and incubate at 32°C, 100 μE·s. -1 ·m -2 Cultured under continuous light intensity for 10-14 days until a single clone appears on the solid culture medium.
[0073] (2) Obtaining engineered Synechococcus strains
[0074] Positive transformants were picked from the solid culture medium after transformation as described in step (1) and inoculated into 5 mL of fresh BG11 liquid culture medium (containing 20 μg / mL spectinomycin) and placed at 32°C and 100 μE·s. -1 ·m -2 The microorganisms were cultured under continuous light intensity for 7-10 days. Genomic DNA of the genetically engineered photosynthetic microorganisms was prepared using conventional methods, which can be found in the small-scale preparation methods of biological genomes in the "Concise Guide to Molecular Biology" published by Science Press. Using this genome as a template, PCR amplification was performed using primers for amplifying the exogenous gene on the recombinant plasmid.
[0075] PCR results showed that the recombinant plasmid pSyn _ptdh_tal_4cl_chs_chi_fns_f3'h pSyn _ptdh_tal_ 4cl_sts_HpaB_HpaC The exogenous gene has been integrated into the neutral site 1 (NSI) of the Synechococcus genome via homologous recombination, such as... Figure 2 As shown. Thus, engineered Synechococcus strains S-Lut and S-Pic were obtained, respectively.
[0076] (3) Preservation of engineered Synechococcus strains S-Lut and S-Pic
[0077] The S-Lut and S-Pic strains obtained in step (2) were inoculated into BG11 liquid medium containing 20 μg / mL spectinomycin and incubated at 32°C and 100 μE·s. -1 ·m -2 Under continuous light intensity, culture for 7-10 days. Under aseptic conditions, add 1 mL of the overnight culture to a sterile 5 mL centrifuge tube and centrifuge at 5000 rpm for 3 min. Discard the supernatant, resuspend the bacterial pellet in sterile 15% glycerol solution to prepare glycerol stock tubes, which can be stored at -20°C for 6 months to 1 year. Every 6 months, remove the genetically engineered photosynthetic microorganisms stored in the glycerol stock tubes for activation and re-store the glycerol stock tubes.
[0078] Example 4: Production of luteolin using the engineered strain S-Lut from Synechococcus.
[0079] (1) Solid culture: The engineered Synechococcus strain S-Lut prepared in Example 3 was inoculated onto BG11 solid medium containing 20 μg / mL spectinomycin and cultured at 32°C and 100 μE·s. -1 ·m -2 S-Lut single colonies were obtained by continuous culturing under light intensity for 10-15 days.
[0080] (2) Seed culture: The S-Lut single colony cultured in step (1) was inoculated into 50 mL of 5xBG phosphite liquid medium (containing 20 μg / mL spectinomycin) for strain activation, and cultured at 30°C and 100 μE·s. -1 ·m -2 Seed culture was prepared by continuous illumination under light intensity for 7-10 days.
[0081] (3) Fermentation culture: The seed culture obtained in step (2) was inoculated into a plate-type photoreactor at an inoculation rate of 1% (volume ratio), and cultured in 5xBG phosphite liquid medium. The culture conditions were: 32 °C, continuous introduction of 3% (volume ratio) CO2 gas, and initial light intensity of 80 μE·s. -1 ·m -2 150 μE·s after 1 day -1 ·m -2 It increased to 400 μE·s after 2 days. -1 ·m -2 After culturing for 15 days, on the 7th day, add 5 mL / L of KH2PO3 solution (120.1 g / L).
[0082] (4) Sample processing and detection: Every three days, take samples of culture medium to measure OD. 730 The culture supernatant was collected and the yield was analyzed by HPLC. The results are as follows: Figure 3 As shown, the concentration of luteolin was 16 mg / L after 15 days of cultivation.
[0083] Example 5: Production of Paclitaxel using the engineered bacteria S-Pic from Synechococcus
[0084] (1) Solid culture: The engineered Synechococcus strain S-Pic was inoculated onto BG11 solid medium containing 20 μg / mL spectinomycin and cultured at 32°C and 100 μE·s. -1 ·m -2 S-Pic single colonies were obtained by continuous culturing under light intensity for 10-15 days.
[0085] (2) Seed culture: The S-Pic single colony cultured in step (1) was inoculated into 50 mL of 5xBG phosphite liquid medium (containing 20 μg / mL spectinomycin) for strain activation, and cultured at 30°C and 100 μE·s -1 ·m -2 Seed culture was prepared by continuous illumination under light intensity for 7-10 days.
[0086] (3) Fermentation culture: The seed culture obtained in step (2) was inoculated into a plate-type photoreactor at an inoculation rate of 1% (volume ratio), and cultured in 5xBG phosphite liquid medium. The culture conditions were: 32°C, continuous introduction of 3% (volume ratio) CO2 gas, and initial light intensity of 80 μE·s. -1 ·m -2 150 μE·s after 1 day -1 ·m -2 It increased to 400 μE·s after 2 days. -1 ·m -2 After culturing for 15 days, on the 7th day, add 5 ml / L of KH2PO3 solution (120.1 g / L).
[0087] (4) Sample processing and detection: Every three days, take samples of culture medium to measure OD. 730 The supernatant of the culture medium was collected and analyzed for yield and optical purity using HPLC. For example... Figure 4 As shown, the concentration of paclitaxel was 166 mg / L after 15 days of culture.
[0088] The principle of this invention is as follows: This invention addresses the problem of insufficient carbon flux allocation in photosynthetic autotrophic systems by innovatively introducing a complete set of synthetic enzymes for the target product, along with the encoding gene for phosphite dehydrogenase (Ptdh), into photosynthetic microorganisms (such as cyanobacteria), and continuously supplying phosphite in the culture medium. In this system, the phosphite dehydrogenase expressed by the genetically engineered photosynthetic microorganisms of this invention oxidizes phosphite to phosphate, generating an additional reducing power supply independent of photosynthesis. This additional reducing power is introduced into the cell's central carbon metabolism, significantly enhancing the efficiency of carbon dioxide fixation in the Calvin cycle. This increases the overall carbon fixation rate of the cell, allowing for a more abundant total carbon flux to be allocated, thus ensuring cell growth while providing rich carbon precursors for the synthesis of L-tyrosine and malonyl-CoA. This solves the problem of insufficient precursor supply caused by competition for carbon flux between growth and product synthesis. Simultaneously, it lays the technical foundation for high-yield de novo synthesis; economically, it improves the carbon source utilization efficiency of expensive biosynthetic pathways by utilizing inexpensive inorganic salts.
[0089] This invention further designs a phosphite dehydrogenase system, enabling it to operate in parallel with the photosynthetic system, constructing a dual reducing power supply system. The total reducing power supply within the genetically engineered photosynthetic microbial cells of this invention is provided by two parallel pathways: first, the photosynthetic system absorbs light energy to generate reducing power; second, phosphite dehydrogenase oxidizes phosphite to generate reducing power. These two reducing powers converge into the cell's reducing power pool, forming an extremely abundant total reducing power supply. This vast reducing power supply pool is sufficient to simultaneously meet the high-throughput operational demands of both the Calvin cycle and product synthesis. Through the dual input of light energy and phosphite, reducing power far exceeding the cell's basic needs is provided, eliminating the bottleneck of competition for reducing power between product synthesis and cell growth. This allows the genetically engineered strains to maintain rapid growth while also performing high-throughput de novo synthesis of complex products, ultimately achieving the efficient synthesis of luteolin or paclitaxel.
[0090] Technical advantages of the present invention: 1. The genetically engineered photosynthetic microorganisms constructed in this invention use inexpensive and readily available light energy, greenhouse gas carbon dioxide, and industrial-grade phosphite as main raw materials, thus eliminating the dependence of traditional heterotrophic fermentation on expensive sugar substrates, reducing raw material costs, and achieving green and sustainable production.
[0091] 2. This invention innovatively utilizes the phosphite dehydrogenase system to simultaneously solve the two core bottlenecks in photosynthetic autotrophic systems: "insufficient supply of carbon flux precursors" and "competition between the synthetic pathway and growth for reducing power," thereby achieving synergistic progress in cell growth and de novo synthesis of complex products.
[0092] 3. In terms of performance indicators, since the limitations of precursor supply and reducing power are removed, this invention can achieve efficient production of luteolin or paclitaxel, while improving carbon dioxide fixation efficiency and carbon conversion rate.
[0093] 4. In terms of production implementation, the process flow of this invention is clear, easy to control and operate continuously, and can be directly scaled up and produced on a large scale in a standard photobioreactor.
[0094] In summary, the technical solution of this invention provides a novel and efficient industrial solution for the direct de novo synthesis of high-value complex natural products from carbon dioxide using photosynthetic microorganisms.
[0095] The preferred embodiments of the present invention have been described in detail above. It should be understood that those skilled in the art can make numerous modifications and variations based on the concept of the present invention without creative effort. Therefore, all technical solutions that can be obtained by those skilled in the art based on the concept of the present invention through logical analysis, reasoning, or limited experimentation on the basis of existing technology should be within the scope of protection defined by the claims.
Claims
1. A method for biosynthesizing luteolin or paclitaxel using CO2, characterized in that, Includes the following steps: Step 1: Introduce exogenous genes into the genome of wild-type photosynthetic microorganisms to construct and obtain genetically engineered photosynthetic microorganisms; The exogenous gene exists in the engineered Synechococcus bacteria in a tandem expression structure; the exogenous gene includes a synthase encoding gene and a phosphite dehydrogenase ptdh encoding gene that have been codon-optimized and are suitable for the photosynthetic microorganism, and the nucleotide sequence of the phosphite dehydrogenase ptdh encoding gene is shown in SEQ ID NO: 1; the synthase encoding gene includes an upstream gene module and a downstream gene module; the upstream gene module is composed of a tyrosine ammonia-lyase T1 encoding gene and a 4-coumaroyl-CoA ligase 4cl encoding gene, and their nucleotide sequences are shown in SEQ ID NO: 2 and 3, respectively; When luteolin is synthesized, the downstream gene module contains the chs encoding gene of chalcone synthase, the chi encoding gene of chalcone isomerase, the fns encoding gene of flavonoid synthase, and the f3'h encoding gene of flavonoid 3'-hydroxylase, the nucleotide sequences of which are shown in SEQ ID NO: 4-7, respectively. When paclitaxel is synthesized, the downstream gene module contains the gene encoding stilbene synthase sts, the gene encoding resveratrol 3'-hydroxylase HpaB, and the gene encoding resveratrol 3'-hydroxylase HpaC, the nucleotide sequences of which are shown in SEQ ID NO: 8-10, respectively. The wild-type photosynthetic microorganism is Synechococcus (… Synechococcus elongatus ); Step 2: After activating the prepared genetically engineered photosynthetic microorganisms, they are cultured in liquid under light conditions. During the culture process, CO2 is provided as the sole carbon source, and phosphite is supplemented to synthesize luteolin or paclitaxel.
2. The method for biosynthesizing luteolin or paclitaxel using CO2 as described in claim 1, characterized in that, In step one, the tandem expression structure contains a promoter that is operatively linked to the first gene in the tandem structure, and the promoter is psbA2.
3. The method for biosynthesizing luteolin or paclitaxel using CO2 as described in claim 1, characterized in that, In step one, each gene in the tandem expression structure has its own independently operably linked promoter, the promoter being psbA2; the promoter is implemented through a terminator-promoter, i.e., a TP fragment; the nucleotide sequence of the TP fragment is shown in SEQ ID NO:
11.
4. The method for biosynthesizing luteolin or paclitaxel using CO2 as described in claim 1, characterized in that, In step one, the phosphite dehydrogenase ptdh encoding gene is derived from *Pseudomonas stearothermii* (…). Pseudomonas stutzeri ).
5. The method for biosynthesizing luteolin or paclitaxel using CO2 as described in claim 1, characterized in that, In step one, the gene encoding the tyrosine ammonia-lyase T1 is derived from *Sacchariformis spp.* (Spanish syringa). Saccharothrix espanaensis The gene encoding the 4-coumaroyl-CoA ligase 4cl is derived from Arabidopsis thaliana ( ). Arabidopsis thaliana The chalcone synthase chs encoding gene is derived from petunia ( Petunia hybrida The chalcone isomerase chi gene is derived from Arabidopsis thaliana ( ); Arabidopsis thaliana The flavonoid synthase fns encoding gene is derived from parsley ( Petroselinum crispum The gene encoding the flavonoid 3'-hydroxylase f3'h is derived from Arabidopsis thaliana ( ). Arabidopsis thaliana The stilbene synthase sts encoding gene is derived from grape ( ); Vitis vinifera The resveratrol 3'-hydroxylase HpaB and HpaC encoding genes are derived from Escherichia coli.
6. The method for biosynthesizing luteolin or paclitaxel using CO2 as described in claim 1, characterized in that, In step one, the preparation method of the genetically engineered photosynthetic microorganism is as follows: 1) Constructing the recombinant plasmid pSyn for the synthesis of luteolin _ptdh_tal_4cl_chs_chi_fns_f3'h Alternatively, construct the recombinant plasmid pSyn for the synthesis of paclitaxel. _ptdh_tal_4cl_sts_HpaB_HpaC ; 2) The recombinant plasmid obtained in step 1) was introduced into Synechococcus host cells and cultured on BG11 solid selection medium supplemented with spectinomycin to screen for transformants; 3) After expanding the culture of the transformants, genomic DNA was extracted, and the exogenous gene was successfully integrated into the neutral site 1 (NSI) of the Synechococcus genome by PCR, thereby obtaining the genetically engineered photosynthetic microbial strain S-Lut that produces luteolin, or the genetically engineered photosynthetic microbial strain S-Pic that produces paclitaxel.
7. The method for biosynthesizing luteolin or paclitaxel using CO2 as described in claim 1, characterized in that, In step two, the culture medium for liquid fermentation is 5xBG phosphite liquid medium.
8. The method for biosynthesizing luteolin or paclitaxel using CO2 as described in claim 1, characterized in that, In step two, the conditions for liquid fermentation culture are as follows: 32°C, continuous introduction of 3% CO2 gas (by volume), and initial light intensity of 80 μE·s. -1 ·m -2 150 μE·s after 1 day -1 ·m -2 It increased to 400 μE·s after 2 days. -1 ·m -2 , and cultivate for 15 days.
9. The method for biosynthesizing luteolin or paclitaxel using CO2 as described in claim 8, characterized in that, On day 7, a KH2PO3 solution with a concentration of 120.1 g / L was added, at a volume of 5 mL / L.
10. The use of the method of claim 1 in the preparation of luteolin or paclitaxel.