Ultraviolet-intolerant high-expression TPS engineering bacterium for controlling solenopsis invicta as well as construction method and application of ultraviolet-intolerant high-expression TPS engineering bacterium

Abstract

The invention discloses an ultraviolet-intolerant high-expression TPS engineering bacterium for controlling solenopsis invicta and a construction method and application thereof, and belongs to the technical field of biological control of pests. The method comprises the following steps: inserting a reporter gene GFP gene into a phr1 gene intron of metarhizium anisopliae through a CRISPR-Cas9 gene editing technology, and destroying an endogenous phr1 gene to obtain an intermediate strain delta phr1-GFP; and inserting the TPS gene into the coding sequence of the GFP gene in the intermediate strain delta phr1-GFP to inactivate the GFP gene, thereby obtaining the engineering bacterium with high expression of TPS. The engineering bacterium can efficiently synthesize and volatilize longifolene which has remarkable attraction activity on red imported fire ants, and the control effect on red imported fire ant nests within two weeks can reach 100%; and the photolytic enzyme gene phr1 is directionally damaged, so that the resistance of the engineering bacterium to ultraviolet radiation in the environment is greatly weakened, the spores of the engineering bacterium can be rapidly inactivated under the irradiation of external sunlight, and the possibility of survival and diffusion of the engineering bacterium in the natural environment is reduced.

Description

Technical Field

[0001] This invention belongs to the field of biological pest control technology, specifically relating to an engineered bacterium that expresses TPS and is intolerant to ultraviolet light, which controls red imported fire ants, as well as its construction method and application. Background Technology

[0002] Red imported fire ants are highly destructive invasive social insects that pose a serious threat to agricultural production, the ecological environment, public safety, and human health. Currently, their control still heavily relies on chemical pesticides, but chemical control easily leads to environmental pollution, pesticide residues, and increased pesticide resistance in red imported fire ants. Therefore, using Metarhizium anisopliae for biological control offers new hope for the sustainable management of red imported fire ants.

[0003] Metarhizium anisopliae is one of the most widely studied and applied filamentous insecticidal fungi. It boasts significant advantages such as high application safety, broad insecticidal spectrum, economical large-scale production, and no pesticide residue or environmental pollution after field application, making it an ideal alternative to chemical pesticides and an important target in the field of biological control research and development. Metarhizium anisopliae in Pingsha infects the host through body wall contact, independent of feeding behavior, demonstrating great potential in the biological control of red imported fire ants. However, in practical applications, the persistent survival and potential spread of wild-type Metarhizium anisopliae spores in the environment after application as a live microorganism poses a significant ecological safety concern. Metarhizium anisopliae and other fungal spores exhibit a certain degree of tolerance to the natural environment, especially ultraviolet radiation from sunlight. This tolerance allows some spores to survive in the environment for extended periods and spread to non-target areas by wind, rain, and insect activity, posing a potential threat to non-target insects (including beneficial pollinators such as bees and other natural enemies) and potentially disrupting the local ecological balance.

[0004] Therefore, there is an urgent need to develop a new type of engineered Metarhizium anisopliae to ensure that after completing its intended control tasks (such as infecting and killing target pests), it can be rapidly inactivated under natural light, thereby minimizing the possibility of its survival and reproduction in non-target environments. Summary of the Invention

[0005] The purpose of this invention is to overcome the shortcomings of the prior art and to provide an engineered bacterium that expresses high levels of TPS to prevent and control red imported fire ants and is intolerant to ultraviolet light, as well as its construction method and application.

[0006] The specific technical solution adopted in this invention is as follows:

[0007] In a first aspect, the present invention provides a method for constructing an engineered bacterium that highly expresses TPS and is intolerant to ultraviolet light, which is effective against red imported fire ants. The specific steps are as follows:

[0008] S1: Based on CRISPR-Cas9 gene editing technology, the reporter gene GFP was inserted into the intron of the phr1 gene of Metarhizium anisopliae, thereby destroying the endogenous phr1 gene and obtaining the intermediate strain Δphr1-GFP.

[0009] S2: Using CRISPR-Cas9 gene editing technology, the TPS gene with the nucleotide sequence shown in SEQ ID NO.1 was inserted into the coding sequence of the GFP gene in the intermediate strain Δphr1-GFP, thereby inactivating the GFP gene and obtaining an engineered bacterium that highly expresses TPS.

[0010] Preferably, the Metarhizium pingshaense strain mentioned in step S1 is the Metarhizium pingshaense TM1 strain with accession number CGMCC NO.41511 and accession date of September 18, 2024.

[0011] Furthermore, step S1 is detailed as follows:

[0012] S11: Using pPK2-bar-GFP plasmid as a template, the DNA fragment Ptef-GFP-TglaA with the nucleotide sequence shown in SEQ ID NO.2 and SEQ ID NO.9 was amplified by PCR reaction using the forward primer Pro-GFP-Ter-F and the reverse primer GFP-3HA#1-R.

[0013] S12: The target sequence of gRNA and the upstream region of PAM sequence in the phr1 gene are amplified using the forward primer 5HA#1-F and the reverse primer 5HA#1-GFP-R, as shown in SEQ ID NO.4 and SEQ ID NO.8, respectively, to obtain the first upstream homologous arm; the target sequence of gRNA and the downstream region of PAM sequence in the phr1 gene are amplified using the forward primer 3HA#1-F and the reverse primer 3HA#1-R, as shown in SEQ ID NO.6 and SEQ ID NO.7, respectively, to obtain the first downstream homologous arm;

[0014] Using the first upstream homologous arm and the first downstream homologous arm as templates, primers 5HA#1-F and 3HA#1-R, whose nucleotide sequences are shown in SEQ ID NO.4 and SEQ ID NO.7, respectively, were used to amplify the DNA fragment Ptef-GFP-TglaA in step S11 through an overlap extension PCR reaction to obtain the first donor DNA fragment.

[0015] S13: The first donor DNA fragment and the gRNA of the phr1 gene were introduced into the protoplasts of Metarhizium anisopliae via a polyethylene glycol-mediated CRISPR-Cas9 ribonucleoprotein complex delivery method to obtain an intermediate strain Δphr1-GFP that can express the GFP gene.

[0016] Furthermore, step S2 is detailed as follows:

[0017] S21: The TPS gene was inserted between the promoter Ptef and terminator TtrpC of the pPK2-Sur-T plasmid by enzyme digestion to obtain the intermediate plasmid pPK2-Sur-TPS.

[0018] Using plasmid pPK2-Sur-TPS as a template, the DNA fragment TPS-TtrpC with the nucleotide sequence shown in SEQ ID NO.10 and SEQ ID NO.11 was amplified by PCR reaction using the forward primer TPS-TtrpC-F and the reverse primer Pgpd-TPS-TtrpC-R, respectively.

[0019] S22: Using the genomic DNA of Metarhizium anisopliae as a template, the promoter Pgpd of the gpd gene was amplified by PCR reaction using the forward primer Pgpd-F and the reverse primer Pgpd-R, as shown in SEQ ID NO.12 and SEQ ID NO.13, respectively.

[0020] S23: Using forward primer Pgpd-F and reverse primer Pgpd-TPS-TtrpC-R, the DNA fragment TPS-TtrpC obtained in step S21 and the promoter Pgpd obtained in step S22 are linked by overlapping extension PCR reaction to obtain DNA fragment Pgpd-TPS-TtrpC.

[0021] S24: Using the forward primer 5HA#2-F and the reverse primer 5HA#2-TPS-R shown in SEQ ID NO.14 and SEQ ID NO.17, respectively, PCR amplification was performed using the genomic DNA of the intermediate strain Δphr1-GFP as a template to obtain the second upstream homologous arm; using the forward primer 3HA#2-F and the reverse primer 3HA#2-R shown in SEQ ID NO.15 and SEQ ID NO.16, respectively, PCR amplification was performed using the genomic DNA of the intermediate strain Δphr1-GFP as a template to obtain the second downstream homologous arm;

[0022] Using the second upstream homologous arm and the second downstream homologous arm as templates, primers 5HA#2-F and 3HA#2-R, whose nucleotide sequences are shown in SEQ ID NO.14 and SEQ ID NO.16, respectively, were used to amplify the DNA fragment Pgpd-TPS-TtrpC in step S23 through an overlap extension PCR reaction to obtain the second donor DNA fragment.

[0023] S25: The second donor DNA fragment and the gRNA of the GFP gene were introduced into the protoplast of the intermediate strain Δphr1-GFP by a polyethylene glycol-mediated CRISPR-Cas9 ribonucleoprotein complex delivery method to obtain the engineered strain Mp-TPS that can express the TPS gene.

[0024] In a second aspect, the present invention provides an engineered bacterium that highly expresses TPS, obtained using the construction method described in the first aspect.

[0025] Thirdly, the present invention provides an application of the engineered bacteria with high TPS expression described in the second aspect in the control of red imported fire ants. The bait for attracting and killing red imported fire ants is applied to the surface of the red imported fire ant nest. After the bait is carried away by the ant colony, a spore suspension containing the engineered bacteria Mp-TPS with high TPS expression is added to the red imported fire ant nest. After being exposed to sunlight, the Mp-TPS spores, which are intolerant to ultraviolet light, are killed.

[0026] Compared with the prior art, the present invention has the following advantages:

[0027] (1) This invention successfully constructed the transgenic engineered bacterium Mp-TPS using a polyethylene glycol-mediated CRISPR-Cas9 ribonucleoprotein complex (RNP) delivery method. This construction method is simple to operate, has high editing efficiency, and leaves no residual integration of exogenous selection marker genes, fundamentally avoiding the environmental and ecological risks brought about by horizontal transfer of marker genes, and laying a solid foundation for biosafety.

[0028] (2) The engineered fungus Mp-TPS constructed in this invention can efficiently synthesize and volatilize longleaf ene, which has significant attraction activity for red imported fire ant workers, by introducing and stably expressing the TPS gene. This not only greatly increases the contact probability between the insecticidal fungus and the target pest, but also significantly delays the social behavior of the worker ants, thereby greatly enhancing the effectiveness of prevention and control. At the same time, by directionally destroying the photolyase gene phr1 of the strain, the resistance of the engineered fungus to ultraviolet radiation in the environment is greatly weakened. Its spores can be quickly and completely inactivated under external sunlight (such as when the ultraviolet index is 6, it only takes 4 hours). This minimizes the possibility of the engineered fungus surviving and spreading in the natural environment, and significantly improves its environmental compatibility and biosafety. Attached Figure Description

[0029] Figure 1 The results are colony PCR results of Δphr1-GFP and engineered bacteria Mp-TPS constructed in Example 1, where (A) is the colony PCR result of Δphr1-GFP; and (B) is the colony PCR result of Mp-TPS.

[0030] Figure 2 The expression of the TPS gene in the engineered bacteria Mp-TPS and Metarhizium anisopliae Mp in Example 2;

[0031] Figure 3 This is a comparison chart of the spore production of engineered bacteria Mp-TPS and Metarhizium anisopliae Mp in Example 2;

[0032] Figure 4 The change in TPS gene expression level after 5 generations of continuous culture of engineered bacteria Mp-TPS in Example 2;

[0033] Figure 5 Analysis of volatile substances in Metarhizium anisopliae Mp and engineered strain Mp-TPS in Example 2, wherein (A) is the peak area ratio of the main volatile substances in the Mp-TPS culture; (B) is the quantitative analysis of longifene in the volatile substances of Mp and Mp-TPS cultures;

[0034] Figure 6 This is a comparison of the germination rates of Metarhizium anisopliae Mp and engineered bacteria Mp-TPS spores on the surface of the worm after sun exposure in Example 2.

[0035] Figure 7 Toxicological analysis of Metarhizium anisopliae Mp and engineered bacteria Mp-TPS against red imported fire ant worker ants in Example 3;

[0036] Figure 8 The percentage of longifole volatilization in the worms infected with engineered bacteria Mp-TPS in Example 3 (A) and the quantitative analysis of longifole volatilization in the worms infected with Metarhizium anisopliae Mp and engineered bacteria Mp-TPS respectively (B).

[0037] Figure 9 The results of the preference analysis of healthy red imported fire ant worker ants for Mp-TPS stunted insects in Example 3;

[0038] Figure 10 This is a comparison of spore survival in the surface soil of the ant nest one day after different strains were injected into the nest in Example 4.

[0039] Figure 11 This is a map of the pPK2-bar-GFP plasmid used in this invention;

[0040] Figure 12 This is the pPK2-Sur-T plasmid map used in this invention;

[0041] Figure 13 This is the plasmid map of the intermediate pPK2-Sur-TPS used in this invention. Detailed Implementation

[0042] The present invention will be further described and illustrated below with reference to the accompanying drawings and specific embodiments. The technical features of each embodiment of the present invention can be combined accordingly, provided that there is no mutual conflict.

[0043] The wild-type Metarhizium pingshaense Mp used in the following examples is strain TM1 of Metarhizium pingshaense with accession number CGMCC NO.41511 and accession date of September 18, 2024. The accession information of this strain has been disclosed in the patent application manuscript with publication number CN 119265045 A.

[0044] The pPK2-bar-GFP plasmid map used in the following examples is as follows: Figure 11 As shown, the spectrum of the pPK2-Sur-T plasmid is as follows: Figure 12 As shown, the spectrum of the pPK2-Sur-TPS plasmid is as follows: Figure 13 As shown. The original plasmid vectors used in the construction are all published in the literature [Liu et al., Histone deacetylase HDAC3 regulates ergosterol production for oxidative stress tolerance in the entomopathogenic and endophytic fungus Metarhizium robertsii. mSystems 9:e00953-24].

[0045] Example 1: Construction of Mp-TPS engineered bacteria with high expression of the TPS gene

[0046] Step 1: Constructing the intermediate strain Δphr1-GFP

[0047] (1) Using pPK2-bar-GFP plasmid as a template, the DNA fragment Ptef-GFP-TglaA was amplified by PCR reaction using the forward primer Pro-GFP-Ter-F and the reverse primer GFP-3HA#1-R, which contain the promoter Ptef and the terminator TglaA, respectively, with nucleotide sequences as shown in SEQ ID NO.2 and SEQ ID NO.9.

[0048] The PCR reaction system included: 25 μL 2×PCR buffer (Phanta Mix buffer), 1 μL 10 mM dNTP premix, 2 μL 10 mM forward primer Pro-GFP-Ter-F, 2 μL 10 mM reverse primer GFP-3HA#1-R, 1 μL high-fidelity DNA polymerase (Phanta Max Super-Fidelity DNA Polymerase), 2 μL pPK2-bar-GFP plasmid, and double-distilled water to a final volume of 50 μL. The PCR reaction program was as follows: 95℃ pre-denaturation for 5 min, followed by 34 cycles of 95℃ denaturation for 15 s, 55℃ annealing for 15 s, and 72℃ extension for 2 min, and finally a final extension at 72℃ for 5 min.

[0049] (2) The target sequence of gRNA and the upstream region of the PAM sequence (ATGAGGTGGATGAGCTTCGCCGG) in the phr1 gene were amplified using the forward primer 5HA#1-F and the reverse primer 5HA#1-GFP-R, respectively, as shown in SEQ ID NO.4 and SEQ ID NO.8, to obtain the first upstream homologous arm (733 bp in length). The target sequence of gRNA and the downstream region of the PAM sequence in the phr1 gene were amplified using the forward primer 3HA#1-F and the reverse primer 3HA#1-R, respectively, as shown in SEQ ID NO.6 and SEQ ID NO.7, to obtain the first downstream homologous arm (700 bp in length).

[0050] Using the first upstream homologous arm and the first downstream homologous arm as templates, primers 5HA#1-F and 3HA#1-R, whose nucleotide sequences are shown in SEQ ID NO.4 and SEQ ID NO.7, respectively, were used to amplify the DNA fragment Ptef-GFP-TglaA from step S11 through an overlap extension PCR reaction to obtain the first donor DNA fragment.

[0051] The overlap extension PCR reaction system includes: 25 μL 2×PCR buffer, 1 μL dNTP premix at 10 mM, 2 μL primer 5HA#1-F at 10 mM, 2 μL primer 3HA#1-R at 10 mM, 100 ng DNA fragment Ptef-GFP-TglaA, 100 ng first upstream homologous arm, and 100 ng and 100 ng first downstream homologous arm, and then made up to 50 μL with double-distilled water;

[0052] The overlap extension PCR reaction procedure is as follows: Without primers 5HA#1-F and 3HA#1-R, pre-denature at 95℃ for 5 min, then repeat the following cycle 10 times: denature at 95℃ for 15 s, anneal at 55℃ for 15 s, and extend at 72℃ for 1 min, and finally extend at 72℃ for 5 min. Then add 2 μL of each of the above primers, pre-denature at 95℃ for 5 min, then repeat the following cycle 20 times: denature at 95℃ for 15 s, anneal at 55℃ for 15 s, and extend at 72℃ for 1 min, and finally extend at 72℃ for 5 min.

[0053] (3) The first donor DNA fragment and the gRNA of the phr1 gene were introduced into the protoplasts of Metarhizium anisopliae using a polyethylene glycol-mediated CRISPR-Cas9 ribonucleoprotein complex delivery method to obtain the intermediate strain Δphr1-GFP that can express the GFP gene, as detailed below:

[0054] 1) Collect protoplasts of *Metarhizium anisopliae*:

[0055] Spores of *Metarhizium anisopliae* obtained after 14 days of culture on PDA (potata dextrose agar) medium were scraped and prepared into a spore suspension in 0.01% (v / v) Triton X-100. The concentration was determined by a hemocytometer, and 10... 8 One spore was added to 100 mL of SDY (sabouraud dextrose broth supplanted with 1% Yeast Extract) liquid medium. After culturing on a shaker (26℃, 220 rpm) for 36 h, the hyphae were collected by filtration through three layers of lens paper in a clean bench. The hyphae were rinsed with plenty of sterile water and then with 0.6 M KCl solution. A small amount of hyphae was picked and added to 20 mL of 0.6 M KCl solution containing 2.2 g of vinotaste, and incubated on a shaker (26℃, 60 rpm) for 2–4 h to degrade the cell wall and prepare protoplasts.

[0056] The lysis buffer was filtered through three layers of lens paper, and the filtrate was collected in a sterile 50 mL centrifuge tube. The tube was centrifuged for 10 min (3000 rpm, 4 °C) to collect the protoplasts. The protoplasts were resuspended in 30 mL of STC buffer and centrifuged again for 10 min to collect the protoplasts. This process was repeated once.

[0057] 2) In vitro synthesis of the RNP complex

[0058] Add 11 μL Nuclease-Free Water, 2 μL Cas9 NLS Reaction Buffer (10×), 5 μL Cas9 NLS at a concentration of 20 μM and 2 μL phr1 gene gRNA at a concentration of 50 μM to a centrifuge tube, mix and incubate at room temperature for 20 min to obtain the RNP complex.

[0059] 3) Polyethylene glycol (PEG)-mediated conversion

[0060] Resuspend protoplasts in STC buffer to 5 × 10⁻⁶. 6 Take 200 μL of protoplasts and mix them with the pre-prepared RNP complex and 2.5 μg of the first donor DNA. Mix gently and incubate at room temperature for 20 min.

[0061] Add 1 mL of PSTC buffer, mix gently, and incubate at room temperature for 20 min. Add 5 mL of RM liquid medium to a sterile 15 mL centrifuge tube, then add all the incubated protoplasts to the medium. Incubate on a shaker (26℃, 160 rpm) for 12–16 h to regenerate the protoplasts. Dilute the regenerated protoplasts with STC buffer to a concentration of 1–5 × 10⁻⁵. 3 The sample was taken at a concentration of 100 μL and spread evenly on RM solid medium. After incubation at 26°C upside down for 4 days, positive transformants were observed and picked.

[0062] The STC buffer consists of: 1 M sorbitol, 50 mM Tris, 50 mM CaCl2, pH=8.0; the PSTC buffer consists of: 50 mM Tris-HCl, pH=7.0, 50 mM CaCl2, 60% PEG 3350, 20% sucrose; the RM liquid medium consists of: 239.6 g / L sucrose, 0.5 g / L yeast extract, and the RM solid medium is supplemented with 10 g / L agar.

[0063] 4) After delivery and incubation at 26°C for 4 days, the plate was placed under a stereofluorescence microscope to screen for colonies that produced green fluorescence. These colonies were then transferred to new PDA medium for further culture. Positive transformants in which the GFP gene was inserted into the target position of the phr1 gene were identified by colony PCR and sequencing of PCR products. The intermediate strain Δphr1-GFP was then constructed.

[0064] The colony PCR reaction system is as follows: 10 μL 2× KOD buffer, 4 μL dNTP premix solution with a concentration of 2 mM, 0.6 μL forward primer F-1 with a concentration of 10 mM, 0.6 μL reverse primer R-1 with a concentration of 10 mM, 0.4 μL KOD FX, 2 μL template, and double-distilled water to a final volume of 20 μL.

[0065] The template is the cultured bacterial solution after expansion. Forward primer F-1: TCATCGACGCGATCGAGCCT; Reverse primer R-1: GATCACTCTCGGCATGGACG.

[0066] Step 2: Constructing the engineered strain Mp-TPS

[0067] (1) The TPS gene was inserted between the promoter Ptef and the terminator TtrpC of the pPK2-Sur-T plasmid by enzyme digestion to obtain the intermediate plasmid pPK2-Sur-TPS.

[0068] (2) Using the intermediate plasmid pPK2-Bar-TPS as a template, the DNA fragment TPS-TtrpC was amplified by PCR reaction using the forward primer TPS-TtrpC-F and the reverse primer Pgpd-TPS-TtrpC-R, respectively, with nucleotide sequences as shown in SEQ ID NO.10 and SEQ ID NO.11.

[0069] Using genomic DNA of *Metarhizium anisopliae* as a template, the promoter Pgpd of the gpd gene was amplified by PCR using the forward primer Pgpd-F and the reverse primer Pgpd-TPS-TtrpC-R, as shown in SEQ ID NO.12 and SEQ ID NO.11, respectively. The PCR amplification reaction system and procedure were similar to those in step one.

[0070] (3) Using forward primer Pgpd-F and reverse primer Pgpd-TPS-TtrpC-R, the DNA fragment TPS-TtrpC obtained in step S21 and the promoter Pgpd obtained in step S22 were linked by overlapping extension PCR reaction to obtain DNA fragment Pgpd-TPS-TtrpC.

[0071] The overlap extension PCR reaction system is as follows: 25 μL 2×PCR buffer, 1 μL 10 mM dNTP premix, 2 μL 10 mM forward primer Pgpd-F, 2 μL 10 mM reverse primer TPS-TtrpC-R, 100 ng Pgpd fragment and 100 ng TPS-TtrpC fragment, and double-distilled water to make up to 50 μL;

[0072] The overlap extension PCR reaction procedure is as follows: Without the forward primer Pgpd-F and the reverse primer TPS-TtrpC-R, pre-denature at 95℃ for 5 min, then cycle 10 times with the following procedure: denaturation at 95℃ for 15 s, annealing at 55℃ for 15 s, extension at 72℃ for 1 min, and finally extension at 72℃ for 5 min. Then add 2 μL each of the forward and reverse primers, pre-denature at 95℃ for 5 min, then cycle 20 times with the following procedure: denaturation at 95℃ for 15 s, annealing at 55℃ for 15 s, extension at 72℃ for 1 min, and finally extension at 72℃ for 5 min.

[0073] (4) Using the forward primer 5HA#2-F and the reverse primer 5HA#2-TPS-R shown in SEQ ID NO.14 and SEQ ID NO.17, respectively, with the genomic DNA of the intermediate strain Δphr1-GFP as a template, PCR amplification was performed on the target sequence of gRNA in the GFP gene and the upstream region of the PAM sequence (GAAGGGCATCGACTTCAAGGAGG) to obtain the second upstream homologous arm (752 bp in length); using the forward primer 3HA#2-F and the reverse primer 3HA#2-R shown in SEQ ID NO.15 and SEQ ID NO.16, respectively, with the genomic DNA of the intermediate strain Δphr1-GFP as a template, PCR amplification was performed to obtain the second downstream homologous arm (611 bp in length).

[0074] Using the second upstream homologous arm and the second downstream homologous arm as templates, primers 5HA#2-F and 3HA#2-R, whose nucleotide sequences are shown in SEQ ID NO.14 and SEQ ID NO.16, respectively, were used to amplify the DNA fragment Pgpd-TPS-TtrpC in step S23 through an overlap extension PCR reaction to obtain the second donor DNA fragment.

[0075] The overlap extension PCR reaction system consisted of: 25 μL 2×PCR buffer, 1 μL 10 mM dNTP premix, 2 μL 10 mM primer 5HA#2-F, 2 μL 10 mM primer 3HA#2-R, 100 ng DNA fragment Pgpd-TPS-TtrpC, 100 ng second upstream homologous arm, 100 ng second downstream homologous arm, and 100 ng each of the second and third downstream homologous arms, with the volume made up to 50 μL with double-distilled water.

[0076] The overlap extension PCR reaction procedure is as follows: Without primers 5HA#2-F and 3HA#2-R, pre-denature at 95℃ for 5 min, then repeat the following cycle 10 times: denature at 95℃ for 15 s, anneal at 55℃ for 15 s, and extend at 72℃ for 1 min, and finally extend at 72℃ for 5 min. Then add 2 μL of each of the above primers, pre-denature at 95℃ for 5 min, then repeat the following cycle 20 times: denature at 95℃ for 15 s, anneal at 55℃ for 15 s, and extend at 72℃ for 1 min, and finally extend at 72℃ for 5 min.

[0077] (5) The second donor DNA fragment and the gRNA of the GFP gene were introduced into the protoplast of the intermediate strain Δphr1-GFP by the polyethylene glycol-mediated CRISPR-Cas9 ribonucleoprotein complex delivery method to obtain the engineered strain Mp-TPS that can express the TPS gene.

[0078] After delivery and incubation at 26°C for 4 days, the plates were placed under a stereofluorescence microscope to screen for colonies that did not produce green fluorescence. This indicated that the GFP gene of the intermediate strain Δphr1-GFP was destroyed. The colonies were then picked onto new PDAs for further culture. The positive transformants with the TPS gene inserted into the target position in the GFP gene were identified by colony PCR and PCR product sequencing. These were the engineered strains Mp-TPS.

[0079] Figure 1 In the diagram, (A) and (B) represent the colony PCR results of the Δphr1-GFP strain constructed in step one and the engineered strain Mp-TPS strain constructed in step two, respectively. Based on... Figure 1 (A) indicates that the GFP gene successfully inserted into the intron of the phr1 gene. Figure 1 (B) It can be seen that the TPS gene was successfully inserted into the target site in the GFP gene.

[0080] Example 2: Determination of key biological characteristics of engineered bacteria Mp-TPS

[0081] (1) Expression determination of TPS encoding gene in Mp-TPS strain

[0082] RNA was extracted from the successfully validated recombinant strain Mp-TPS in Example 1 and reverse transcribed into cDNA. Using cDNA as a template and gpd as an internal control, RT-PCR was used to verify that the TPS encoding gene was transcribed and expressed. The wild-type strain Mp was used as a parallel control.

[0083] The RNA extraction methods for each strain are as follows: Take 1 g of fresh mycelium and grind it into powder using liquid nitrogen in a mortar. Collect an appropriate amount of powdered sample in a 1.5 mL RNase-free EP tube, add 1 mL of Trizol (Invitrogen, USA) RNA extraction reagent, vortex to mix, and incubate at room temperature for 5 min. Centrifuge at 12000 rpm for 15 min at 4℃. Take 800 µL of the supernatant into a new 1.5 mL RNase-free EP tube, add 160 µL of chloroform, vortex thoroughly to mix, incubate on ice for 5 min, and centrifuge at 12000 rpm for 15 min at 4℃. Transfer 350 µL of the supernatant to a new 1.5 mL RNase-free EP tube, add an equal volume of isopropanol, incubate on ice for 10 min, and centrifuge at 12000 rpm for 10 min. Discard the supernatant, add 1 mL of 75% ethanol (prepared with DEPC water) to wash the precipitate, centrifuge at 12000 rpm for 5 min at 4°C, discard the supernatant, invert the EP tube onto dry absorbent paper, and after the alcohol evaporates, add an appropriate amount of DEPC water to dissolve the RNA. Take 3 µL of the dissolved RNA sample, mix it with DNA loading buffer, and check the integrity of the RNA by 1.2% agarose gel electrophoresis. Then, determine the concentration of the RNA sample using a nucleic acid microplate. Reverse transcription was performed using the ReverTraAce qPCRRTMaster Mix with gDNA Remover kit (TOYOBO, Japan). Add an appropriate amount of Nuclease-free water to the successfully extracted RNA sample to bring the total RNA volume to 800 ng (12 µL for water and RNA). Then add 4 µL of 4× DNA Master Mix (with gDNA remover added), mix thoroughly by pipetting, and incubate at 37°C for 5 min in a PCR instrument to remove genomic DNA. Next, add 4 µL of 5× RTMaster Mix II, mix well, and continue the reaction in the PCR instrument. The reaction program is 37°C for 15 min, then 98°C for 5 min. After reverse transcription, using cDNA as a template and gpd as an internal control, RT-PCR was used to confirm the transcriptional expression of the TPS-encoding gene. The results are as follows: Figure 2 As shown.

[0084] (2) Sporulation analysis of Mp-TPS strain

[0085] The sporulation rate of the Mp-TPS strain on PDA medium was analyzed. The method was as follows: 1×10⁻⁶ spores were prepared... 7100 μL of Mp and Mp-TPS suspensions at spore / mL were evenly spread onto PDA medium and incubated upside down at 26℃ for 14 days. Three mycelial cakes were randomly selected using a 5 mm inner diameter punch and placed in 1.5 mL centrifuge tubes containing 1 mL of 0.01% Triton X-100 solution and an appropriate amount of steel beads. The cells were thoroughly ground using a high-speed vibratory grinder and counted using a hemocytometer. The results are as follows: Figure 3 As shown.

[0086] according to Figure 3 It can be seen that the spore production of the engineered bacteria Mp-TPS constructed in this invention is not significantly different from that of the original Metarhizium anisopliae Mp.

[0087] (3) Analysis of the expression stability of TPS gene in Mp-TPS strain

[0088] The expression level of the TPS gene in the engineered strain Mp-TPS after continuous culture on a PDA was determined by RT-qPCR. The method was as follows: RNA was extracted from the cultured strain and reverse transcribed into cDNA. Using cDNA as a template and gpd as an internal control, the reaction was prepared according to the instructions of Thunderbird SYBR qPCR Mix without ROX (TOYOBO, Japan). The system consisted of 10 μL SYBR qPCR Mix, 6.4 μL ddH2O, 2 μL cDNA, and 0.8 μL each of forward and reverse primers. The amplification program was: 95℃ pre-denaturation for 3 min, 95℃ denaturation for 10 s, 55℃ annealing for 10 s, 72℃ extension for 30 s, for 40 cycles. After the cycles, the reaction was carried out at 95℃ for 10 s, then cooled to 65℃ for 5 s, followed by heating and reading the fluorescence signal to obtain the melting curve. −ΔΔCt The relative expression level was calculated using this method. The results are as follows: Figure 4 As shown.

[0089] Figure 4 In this context, G0 represents the engineered bacterium Mp-TPS constructed in Example 1, while G1, G3, and G5 represent the 1st, 3rd, and 5th generations obtained through continuous culture on PDA medium, respectively. Figure 4 It can be seen that the expression level of the TPS gene did not decrease significantly, indicating that it can be expressed stably.

[0090] (4) Analysis and determination of volatile compounds in Mp-TPS strain

[0091] BRH (bran-husk-rice) culture was collected and placed in a 20 mL vial. A 50 / 30 µm DVB / CAR / PDMS extraction head was inserted into the vial for adsorption extraction for 40 min, with heating in a 40 °C water bath throughout the process. After extraction, the sample was manually injected, and the sample was analyzed at 250 °C for 3 min. The chromatographic column was a 30 m × 0.25 mm, 0.25 µm DB-5MS column; the column temperature was initially set at 40 °C, held for 2 min, then increased to 180 °C at 5 °C / min, and then increased to 270 °C at 10 °C / min, held for 10 min.

[0092] Based on the total ion current (TIC) chromatogram, and by comparing the mass spectrometry data of the chromatographic peaks with the mass spectrometry library, preliminary predictions of the compounds in the chromatographic peaks are made. Chemically synthesized standards are purchased according to the CAS numbers of the compounds provided in the mass spectrometry library, and the standards are compared with C7-C using the above procedure. 40 A mixture of n-alkane standards was analyzed by GC-MS. The linear retention index (LRI) was calculated using the formula:

[0093] RI x =100×z+100×(RT x -RT z ) / (RT) z+1 -RT z )

[0094] Among them, RI x Let t be the linear retention exponent of target component x, z be the number of carbon atoms in the n-alkane before the efflux of target component x, and RT be the linear retention exponent. x RT is the retention time of the target component x. z RT represents the retention time of the z-th carbon n-alkane. z+1 The retention time is for the (z+1)th carbon n-alkane. The retention index confirmed that the compound and the standard were the same substance. Finally, the volatilization amount of longifolene was calculated based on the confirmed peak area. The results are as follows... Figure 5 As shown.

[0095] according to Figure 5 It was found that on BRH medium, the spores of wild-type strain Mp released very little longifolene, while Mp-TPS spores could produce this red imported fire ant attractant, and longifolene was the most important volatile substance (accounting for 37%), with a volatilization amount of 606 ng / g, which was 29 times that of strain Mp. The difference between the two was significant (t=-20.319, P<0.001).

[0096] (5) Determination of the tolerance of Mp-TPS strain conidia to UV-B ultraviolet radiation

[0097] 1) Inoculate Mp and Mp-TPS onto PDA plates and incubate at 25℃ for 7 days. Wash conidia off the plates with 0.02% Tween 80 and prepare 1×10⁻⁶ conidia. 7 A spore suspension of 1 spore / mL was prepared. 60 μL of the suspension was inoculated into a 3 cm diameter petri dish containing 3 mL of 0.0125% YE, and then placed in a Bio-Sun chamber (Vilber Lourmat, Marne-la-Vallée, France) at 312 nm (280–320 nm) UV-B wavelength with a concentration of 0.1–0.3 J / cm². 2 The culture dish was irradiated with energy. After irradiation, the culture dish was transferred to a humidified environment at 26℃ and 12:12 h light conditions for 24 h. Germinated and ungerminated spores were observed and counted under a microscope to determine the germination rate, i.e., the viable spore rate. Each strain was treated three times for each dose, with the viable spore rate of the unirradiated strain serving as a control.

[0098] Table 1. Germination rate of wild-type Mp and transgenic strain Mp-TPS spores after UV irradiation.

[0099]

[0100] By measuring the germination rate of wild-type strain Mp and engineered strain Mp-TPS spores after ultraviolet (UV) irradiation, it was found that the engineered strain Mp-TPS had poor UV tolerance. As shown in Table 1, when the UV radiation intensity was 0.1 J / cm²... 2 At that time, the spore germination rate of the wild-type strain Mp was 92.24%, while the spore germination rate of the engineered strain Mp-TPS was significantly reduced to only 80.69%. This difference widened further with increasing ultraviolet radiation intensity, reaching a peak at 0.2 J / cm². 2 Under ultraviolet radiation, the spore germination rate of the wild-type strain Mp remained at 47.27%, but the spore germination rate of the engineered strain Mp-TPS dropped sharply to 19%. When the ultraviolet radiation intensity reached 0.3 J / cm², the germination rate decreased further. 2 At that time, the spore germination rate of the wild-type strain Mp was 27%, while the spore germination rate of the engineered strain Mp-TPS was less than 10%.

[0101] 2) Further, the survival rate of Mp and Mp-TPS on worker ants infected with Mp and Mp-TPS was tested by placing the spore-covered cadavers under natural sunlight. The method was as follows: Worker ant carcasses infected with Mp and Mp-TPS were placed on glass slides and cultured in a humid environment (26±1℃, 90±5%RH). After 96 h, the cadavers with Metarhizium anisopliae hyphae and spores on their bodies were placed in a laboratory area exposed to sunlight (UV index 6). After 4 h of irradiation, the cadavers were transferred to 1 mL of 0.01% Triton X-100 solution and vortexed for 2 min. The entire 1 mL suspension was then spread onto PDA plates. After 5 days of culture, colony growth was observed, and the number of colonies was calculated. Each cadaver was considered a replicate, with 15 replicates. The results are as follows: Figure 6 As shown.

[0102] according to Figure 6 It can be seen that after being exposed to sunlight (UV index of around 6) for 4 hours, the Mp spores on the surface of the worms were still alive. The proportion of worms with surviving spores was 100%, and the spore survival rate was 75.33±2.72%. However, all Mp-TPS spores were inactivated, and the proportion of colonies that grew was 0.

[0103] Therefore, compared with the wild-type strain Mp, the engineered strain Mp-TPS exhibits more severe inhibition of spore germination under ultraviolet radiation, and its tolerance to ultraviolet radiation is significantly reduced. In field applications, the survival time of engineered Mp-TPS spores under high temperature and ultraviolet radiation is extremely limited. The small number of spores remaining outside the nest during planting and subsequently overflowing are quickly killed by sunlight, resulting in a relatively low environmental safety risk.

[0104] Example 3: Test of the ability of engineered bacteria Mp-TPS to control red imported fire ants

[0105] (1) Toxicity determination

[0106] Spores of the engineered strain Mp-TPS, cultured on PDA medium for 14 days, were placed in 0.01% Triton X-100 solution. After vortexing and homogenization, the spore suspension was obtained by filtration through a glass wool filter. The spore concentration of the suspension was determined using a hemocytometer and then diluted to 10⁻⁶. 7A concentration of 1 spore / mL was used for inoculating red imported fire ants. Inoculation was performed by immersion: worker ants were selected and placed in a 50 mL centrifuge tube containing 15 mL of spore suspension. The tube was gently shaken for 15 seconds to ensure all worker ants were submerged. They were then quickly transferred to absorbent paper to dry their bodies. Ten worker ants were grouped together and placed in rearing boxes at 25°C with a 12 h:12 h light / dark cycle. Honey water was provided as food, and the water was replaced with fresh honey water every two days. Mortality was observed daily, and dead ants were promptly removed and kept in a humid environment for 3-5 days to observe for the formation of *Metarhizium anisopliae* worms. Worms that formed were counted as dead ants. The toxicity test was repeated three times, with 100 ants tested each time. 0.01% Triton X-100 was used as a blank control. Results are as follows: Figure 7 As shown.

[0107] (2) Detection of the volatilization of longleaf thallium in *Bombyx mori*

[0108] After worker ants of red imported fire ants, inoculated with wild-type strain Mp and engineered strain Mp-TPS respectively, died, their carcasses were disinfected with sodium hypochlorite solution (0.4%) and cultured in a moist environment for 7 days to form mummified worms covered with mycelium. 0.5 g of the mummified worms were placed in a sample vial and inserted into an extraction head (50 / 30 μm DVB / CAR / PDMS) for adsorption for 40 min, during which the vial was kept in a 40℃ water bath. The volatile substances adsorbed on the extraction head were then analyzed by SPME-GC-MS. Manual injection was used at the injection port temperature of 250℃ for 3 min, followed by analysis using a DB-5MS column (30 m × 0.25 mm, 0.25 μm). The amount of longifole volatiles in the mummified worms infected with wild-type strain Mp and engineered strain Mp-TPS was calculated, and the results are as follows: Figure 8 As shown.

[0109] (3) Determination of the attraction of the stunted insect to red imported fire ant workers

[0110] A two-way selection method was used to detect the attractiveness of mummified worms to healthy red imported fire ant workers. A 15cm diameter petri dish was divided into four quadrants. Mummified worms infected with the wild-type strain *Metarhizium anisopliae* Mp (control) and the engineered strain Mp-TPS (control) strain were placed in the first and third quadrants, respectively. Twenty healthy, active red imported fire ant workers were then placed in the center of the petri dish. After 10 minutes, the distribution of workers in the petri dish was observed and recorded. Those that remained in the quadrant containing either the Mp or Mp-TPS strain were designated as selected, while those remaining in the blank quadrant were designated as unselected. The preference percentage (%) was calculated using the following formula:

[0111] Preference percentage = Number of worker ants choosing the Mp worm (or Mp-TPS worm) / (Number of worker ants choosing the Mp worm side + Number of worker ants choosing the Mp-TPS worm side) × 100%. Results are as follows: Figure 9 As shown.

[0112] according to Figure 7 It can be seen that the toxicity of the Mp-TPS strain with disrupted photolyase gene phr1 to red imported fire ant workers is not significantly different from that of the wild-type Mp strain.

[0113] according to Figure 8 It was found that the longleaf volatiles formed by the Mp-TPS strain after infecting worker ants released longleaf volatiles. The average amount of longleaf volatiles in the 7-day moist cultured ants was 6.31 ng / cadaver, which was 132 times higher than that of wild-type Mp (0.04 ng / cadaver; t=-6.375, P<0.001).

[0114] according to Figure 9 It can be seen that the mummified ants formed by infection with the engineered strain Mp-TPS have a strong attraction to healthy worker ants (t=6.667, P<0.001).

[0115] Example 4: Test of combined use of engineered bacteria Mp-TPS and flufenoxuron bait for the control of red imported fire ants.

[0116] The experiment to control red imported fire ant nests was set up as follows: each treatment group consisted of 50 ant nests, with the engineered strain Mmd-TPS, which highly expresses the longifole synthase protein gene, serving as a control. The engineered strain Mmd-TPS has been disclosed in patent application manuscript CN119265045 A.

[0117] The processing groups are as follows:

[0118] (1) Treatment with 0.73% flufenoxuron bait (10g per nest, evenly sprinkled on the nest, the same below), recorded as baiting;

[0119] (2) Treat with 0.73% flufenoxuron bait, and inject 1×10 liters of bait after 3 days. 7 Mp spore suspension at spores / mL, 2L per nest, is recorded as feeding + Mp;

[0120] (3) Treat with 0.73% flufenoxuron bait, and inject 1×10 liters of bait after 3 days. 7 Mp-TPS spore suspension at spore / mL, 2L per nest, is recorded as feeding + Mp-TPS;

[0121] (4) Treat with 0.73% flufenoxuron bait, and inject 1×10 liters of bait after 3 days. 7 Mmd-Tps spore suspension at spores / mL, 2L per nest, is recorded as feeding + Mmd-Tps;

[0122] (5) Inject 0.01% Triton X-100, 2L per nest. This treatment is a blank control and is recorded as the control.

[0123] Observe the mortality of ant nests before treatment and at 3, 7, 14, 21, and 28 days after treatment. Gently tap the surface of the ant mound for 1 minute; if fewer than 3 worker ants emerge during this time, the nest is considered dead. Simultaneously observe the migration and swarming of the treated ant nests. Calculate the ant nest control effect based on the ant nest mortality, migration, and swarming results. Ant nest control effect (%) = (1 - number of live ant nests after treatment / number of live ant nests before treatment) × 100.

[0124] In addition, 10 hours after the nest was filled (6 hours of sunlight exposure with an ultraviolet index of about 5-6), a soil sample of 1-2 cm from the surface of the ant nest was taken with a small shovel, brought back to the laboratory, and 0.01% Triton X-100 solution was added. After shaking and mixing, the sample was spread on a PDA plate. The plate was observed 5 days later and the number of Metarhizium anisopliae colonies in the soil sample was calculated.

[0125] The experimental results are shown in Table 2. The combined treatment of applying Mp-TPS or Mmd-Tps to the nest after baiting showed the best control effect on red imported fire ants, significantly better than simple baiting or applying Mp after baiting. The control efficacy was 80% after 3 days of application, reaching 90% after one week, and 100% after two weeks, with all 50 nests dead. The control efficacy was high and fast-acting. The control efficacy after baiting was only 44% after 3 days, increasing to 54% after one week, and only 58% after four weeks, showing a relatively low overall efficacy. The control efficacy after applying Mp after baiting was 50% on the 3rd day, slightly higher than baiting alone, reaching 74% after one week and 82% after four weeks. The control efficacy was significantly better than baiting alone, but significantly lower than applying Mp-TPS or Mmd-Tps after baiting.

[0126] Table 2. Results of efficacy determination of engineered strain Mp-TPS combined with flufenoxuron bait against red imported fire ants.

[0127]

[0128] Figure 10 A comparison of spore survival in the surface soil of ant nests 10 hours after different bacterial strains were injected into the nest. Based on... Figure 10 It was found that after 6 hours of low-index ultraviolet irradiation following Mp-TPS nest filling, a large number of spores died. No *Metarhizium anisopliae* was isolated from soil samples from 7 ant nests, with an average of only 39 CFUs per gram of soil, significantly lower than the existing engineered strain Mmd-Tps. Figure 10 (Z=-3.476, P<0.001) and wild-type strain Mp (Z=-3.911, P<0.001).

[0129] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the invention. Those skilled in the art can make various changes and modifications without departing from the spirit and scope of the invention. Therefore, all technical solutions obtained through equivalent substitution or transformation fall within the protection scope of the present invention.

Claims

1. A method for constructing an engineered bacterium that highly expresses TPS and is intolerant to ultraviolet light, characterized in that, The specific steps are as follows: S1: Based on CRISPR-Cas9 gene editing technology, the reporter gene GFP was inserted into the intron of the phr1 gene of Metarhizium anisopliae, thereby destroying the endogenous phr1 gene and obtaining the intermediate strain Δphr1-GFP. S2: Using CRISPR-Cas9 gene editing technology, the TPS gene with the nucleotide sequence shown in SEQ ID NO.1 was inserted into the coding sequence of the GFP gene in the intermediate strain Δphr1-GFP, thereby inactivating the GFP gene and obtaining an engineered bacterium that highly expresses TPS.

2. The method for constructing engineered bacteria with high TPS expression according to claim 1, characterized in that, The Metarhizium pingshaense strain mentioned in step S1 is the Metarhizium pingshaense TM1 strain with accession number CGMCC NO.41511 and accession date of September 18, 2024.

3. The method for constructing engineered bacteria with high TPS expression according to claim 2, characterized in that, Step S1 is detailed as follows: S11: Using pPK2-bar-GFP plasmid as a template, the DNA fragment Ptef-GFP-TglaA with the nucleotide sequence shown in SEQ ID NO.2 and SEQ ID NO.9 was amplified by PCR reaction using the forward primer Pro-GFP-Ter-F and the reverse primer GFP-3HA#1-R. S12: The target sequence of gRNA and the upstream region of PAM sequence in the phr1 gene are amplified using the forward primer 5HA#1-F and the reverse primer 5HA#1-GFP-R, as shown in SEQ ID NO.4 and SEQ ID NO.8, respectively, to obtain the first upstream homologous arm; the target sequence of gRNA and the downstream region of PAM sequence in the phr1 gene are amplified using the forward primer 3HA#1-F and the reverse primer 3HA#1-R, as shown in SEQ ID NO.6 and SEQ ID NO.7, respectively, to obtain the first downstream homologous arm; Using the first upstream homologous arm and the first downstream homologous arm as templates, primers 5HA#1-F and 3HA#1-R, whose nucleotide sequences are shown in SEQ ID NO.4 and SEQ ID NO.7, respectively, were used to amplify the DNA fragment Ptef-GFP-TglaA in step S11 through an overlap extension PCR reaction to obtain the first donor DNA fragment. S13: The first donor DNA fragment and the gRNA of the phr1 gene were introduced into the protoplasts of Metarhizium anisopliae via a polyethylene glycol-mediated CRISPR-Cas9 ribonucleoprotein complex delivery method to obtain an intermediate strain Δphr1-GFP that can express the GFP gene.

4. The method for constructing engineered bacteria with high TPS expression according to claim 2, characterized in that, Step S2 is detailed as follows: S21: The TPS gene was inserted between the promoter Ptef and terminator TtrpC of the pPK2-Sur-T plasmid by enzyme digestion to obtain the intermediate plasmid pPK2-Sur-TPS. Using plasmid pPK2-Sur-TPS as a template, the DNA fragment TPS-TtrpC with the nucleotide sequence shown in SEQ ID NO.10 and SEQ ID NO.11 was amplified by PCR reaction using the forward primer TPS-TtrpC-F and the reverse primer Pgpd-TPS-TtrpC-R, respectively. S22: Using the genomic DNA of Metarhizium anisopliae as a template, the promoter Pgpd of the gpd gene was amplified by PCR reaction using the forward primer Pgpd-F and the reverse primer Pgpd-R, as shown in SEQ ID NO.12 and SEQ ID NO.13, respectively. S23: Using forward primer Pgpd-F and reverse primer Pgpd-TPS-TtrpC-R, the DNA fragment TPS-TtrpC obtained in step S21 and the promoter Pgpd obtained in step S22 are linked by overlapping extension PCR reaction to obtain DNA fragment Pgpd-TPS-TtrpC. S24: Using the forward primer 5HA#2-F and the reverse primer 5HA#2-TPS-R shown in SEQ ID NO.14 and SEQ ID NO.17, respectively, PCR amplification was performed using the genomic DNA of the intermediate strain Δphr1-GFP as a template to obtain the second upstream homologous arm; using the forward primer 3HA#2-F and the reverse primer 3HA#2-R shown in SEQ ID NO.15 and SEQ ID NO.16, respectively, PCR amplification was performed using the genomic DNA of the intermediate strain Δphr1-GFP as a template to obtain the second downstream homologous arm; Using the second upstream homologous arm and the second downstream homologous arm as templates, primers 5HA#2-F and 3HA#2-R, whose nucleotide sequences are shown in SEQ ID NO.14 and SEQ ID NO.16, respectively, were used to amplify the DNA fragment Pgpd-TPS-TtrpC in step S23 through an overlap extension PCR reaction to obtain the second donor DNA fragment. S25: The second donor DNA fragment and the gRNA of the GFP gene were introduced into the protoplast of the intermediate strain Δphr1-GFP by a polyethylene glycol-mediated CRISPR-Cas9 ribonucleoprotein complex delivery method to obtain the engineered strain Mp-TPS that can express the TPS gene.

5. An engineered bacterium that highly expresses TPS, obtained using any one of the construction methods described in claims 1 to 4.

6. The application of the engineered bacterium highly expressing TPS as described in claim 5 in the control of red imported fire ants, characterized in that, The bait used to kill red imported fire ants was applied to the surface of the red imported fire ant nest. After the ant colony had carried the bait away, a spore suspension containing the engineered bacteria Mp-TPS, which highly expresses TPS, was added to the red imported fire ant nest. After being exposed to sunlight, the Mp-TPS spores of the engineered bacteria, which are intolerant to ultraviolet light, are killed.

Images