Pichia pastoris for producing honey truffle sweetening agent as well as construction method and application of pichia pastoris
By heterologously expressing the honey truffle sweetener encoding gene using a fusion signal peptide in Pichia pastoris, the problem of the difficulty in industrializing the production of honey truffle sweetener was solved, achieving efficient extracellular secretion and high-yield production of the sweetener.
Patent Information
- Application Number
- CN202511701396.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-11-19
- Publication Date
- 2026-02-06
AI Technical Summary
Traditional sugars and artificial sweeteners are harmful to health, honey truffle sweeteners are difficult to produce industrially, Pichia pastoris has limited host availability, and existing signal peptides cannot efficiently express honey truffle sweeteners.
In Pichia pastoris, a honey truffle sweetener encoding gene was heterologously expressed using a fusion signal peptide. The fusion signal peptide was linked to the Pro region of the α-mating factor via its C-terminus. The PAOX1 promoter was used to achieve efficient extracellular secretion of the honey truffle sweetener protein.
It significantly improves the transport efficiency and yield of honey truffle sweeteners, reduces extraction costs, and provides a technological foundation for industrial production.
Smart Images

Figure CN121472288A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of microbial technology, and in particular to a Pichia pastoris that produces honey truffle sweetener, its construction method, and its application. Background Technology
[0002] Because traditional sugars and artificial sweeteners are often blamed for obesity and other health problems, coupled with aspartame being classified as possibly carcinogenic to humans (IARC Group 2B), public trust in artificial sweeteners has been declining. However, the desire for sweetness persists, leading to a growing preference among consumers for green, safe, and natural sweeteners.
[0003] Honey truffle sweetener (HTS) contains 121 amino acids and is found in Hungarian sweet truffles (Mattirolomyces terfezioides), exhibiting a high sweetness profile. Compared to other natural sweeteners, honey truffle sweetener provides a clean, natural sweetness without any aftertaste, making it a clean-label natural protein sweetener. The discovery of this natural sweet protein also offers consumers a healthier option. Researchers systematically characterized this sweet protein, and after preliminary food safety assessments, including digestibility and computer-predicted allergenicity and toxicity, the sweet protein was predicted to be non-allergenic, non-toxic, and easily digestible.
[0004] However, the rarity and difficulty in cultivating Hungarian sweet truffles limit the industrial application of honey truffle sweeteners. While honey truffle sweeteners can be easily produced through precise fermentation of a host, the specific applications in the food industry severely limit host selection. Pichia pastoris, a yeast capable of growing in a basal medium with methanol as the sole carbon and energy source, had its genome sequenced in 2009 and is now widely used in research on recombinant protein expression and metabolic engineering. As a eukaryotic expression host, Pichia pastoris offers advantages such as simple gene manipulation, the ability to perform complex post-translational modifications, high-density fermentation in inorganic salt media, and strong recombinant protein secretion capacity. It is also certified as a GRAS (Generally recognized as safe) strain. Currently, there is little research on the fermentation production of honey truffle sweeteners using Pichia pastoris. Summary of the Invention
[0005] To solve the above-mentioned technical problems, the present invention connects the C-terminus of the screened signal peptide with the Pro region of the α-mating factor to obtain a fusion signal peptide, and heterologously expresses the honey truffle sweetener encoding gene through the fusion signal peptide.
[0006] The first objective of this invention is to provide a method for constructing a Pichia pastoris that produces a honey truffle sweetener, wherein a honey truffle sweetener encoding gene is heterologously expressed in a Pichia pastoris chassis strain using a fusion signal peptide, wherein the fusion signal peptide is obtained by linking the C-terminus of a signal peptide to the Pro region of an α-crossing factor, and the signal peptide is any one of SCU2, SCW10, PROSCW10, OST1, Expl KR, Expl SP, and PHO11.
[0007] Furthermore, the nucleotide sequence of the gene encoding the honey truffle sweetener is shown in SEQ ID NO.1.
[0008] Furthermore, the expression uses P AOX1 Promoter.
[0009] Furthermore, the Pichia pastoris chassis strain is Pichia pastoris X-33.
[0010] A second objective of this invention is to provide Pichia pastoris obtained by the above-described construction method.
[0011] A third objective of this invention is to provide the application of the above-mentioned Pichia pastoris in the preparation of microbial products.
[0012] The fourth object of the present invention is to provide a microbial product prepared from the above-mentioned Pichia pastoris.
[0013] Furthermore, the microbial product is a liquid bacterial agent or a lyophilized powder.
[0014] The fifth object of the present invention is to provide the use of the above-mentioned Pichia pastoris or the above-mentioned microbial products in the production of honey truffle sweeteners.
[0015] The sixth object of the present invention is to provide a method for producing honey truffle sweetener by adding the above-mentioned Pichia pastoris or the above-mentioned microbial agent to a fermentation system.
[0016] Furthermore, it also includes steps for purifying and desalting the fermentation products.
[0017] The beneficial effects of this invention are:
[0018] This invention utilizes a fusion signal peptide, formed by linking the C-terminus of a specific signal peptide to the Pro region of an α-crossing factor, to achieve highly efficient extracellular secretion of honey truffle sweetener protein in Pichia pastoris. This significantly improves the extracellular transport efficiency of the target protein, thereby greatly promoting the accumulation of sweetener in the fermentation supernatant. Compared to direct expression or the use of other signal peptides, the fusion signal peptide of this invention can more effectively guide newly synthesized sweetener protein into the secretion pathway and successfully release it into the extracellular culture medium, significantly increasing the total yield of the target product, honey truffle sweetener, with a shake-flask fermentation yield reaching 44 mg / L. The protein product is mainly present in the supernatant, avoiding complex cell disruption steps, reducing extraction costs and production difficulty, and also helping to maintain protein activity and stability. This lays a solid technical foundation for the industrial-scale, efficient production of honey truffle sweetener using the Pichia pastoris system. Attached Figure Description
[0019] To make the content of this invention easier to understand, the invention will be further described in detail below with reference to specific embodiments and accompanying drawings, wherein:
[0020] Figure 1 The fermentation results of the signal peptide-honey truffle sweetener in Example 2 of the present invention are shown in Figure A, where A represents the growth of different recombinant bacteria, B represents the relative fluorescence intensity of the fermentation broth, and C represents the fluorescence intensity of the fermentation broth.
[0021] Figure 2 The SDS-PAGE electrophoresis results of the optimized signal peptide-honey truffle sweetener in Example 3 of the present invention are shown. Lane M is the marker, and lanes 1-7 correspond to SUC2-pro, PROSCW10-pro, OST1-pro, SCW10-pro, PHO11-pro, Expl KR-pro, and Expl SP-pro, respectively.
[0022] Figure 3 The results of BCA protein yield detection in Example 3 of this invention are as follows: after purification and desalting of the optimized signal peptide-honey truffle sweetener. Detailed Implementation
[0023] The present invention will be further described below with reference to the accompanying drawings and specific embodiments, so that those skilled in the art can better understand and implement the present invention. However, the embodiments described are not intended to limit the present invention.
[0024] The first objective of this invention is to provide a method for constructing a Pichia pastoris that produces a honey truffle sweetener, wherein a honey truffle sweetener encoding gene is heterologously expressed in a Pichia pastoris chassis strain using a fusion signal peptide, wherein the fusion signal peptide is obtained by linking the C-terminus of a signal peptide to the Pro region of an α-crossing factor, and the signal peptide is any one of SCU2, SCW10, PROSCW10, OST1, Expl KR, Expl SP, and PHO11.
[0025] A second objective of this invention is to provide Pichia pastoris obtained by the above-described construction method.
[0026] A third objective of this invention is to provide the application of the above-mentioned Pichia pastoris in the preparation of microbial products.
[0027] The fourth object of the present invention is to provide a microbial product prepared from the above-mentioned Pichia pastoris.
[0028] The fifth object of the present invention is to provide the use of the above-mentioned Pichia pastoris or the above-mentioned microbial products in the production of honey truffle sweeteners.
[0029] The sixth object of the present invention is to provide a method for producing honey truffle sweetener by adding the above-mentioned Pichia pastoris or the above-mentioned microbial agent to a fermentation system.
[0030] The detection methods involved in the following embodiments are as follows:
[0031] Fluorescent protein detection: ELISA reader.
[0032] Bicinchoninic acid (BCA) method: BCA kit (Beyotime Biotechnology), microplate reader, 37℃ incubator.
[0033] The culture media involved in the following examples are shown below:
[0034] Liquid LB medium: 10 g tryptone, 5 g yeast extract, and 10 g sodium chloride were dissolved in 950 mL of deionized water, the pH was adjusted to 7.0, and the volume was brought to 1 L (autoclave at 121℃ for 20 min).
[0035] Solid LB medium: Based on the above liquid LB medium, add an additional 2% agar powder for sterilization (autoclave at 121℃ for 20 min).
[0036] Liquid YPD medium: 20 g / L tryptone and 10 g / L yeast extract were dissolved and brought to a final volume of 960 mL deionized water (autoclaved at 121°C for 20 min). 500 g / L glucose (dissolved in deionized water and brought to a final volume of 250 mL) was sterilized separately (115°C for 20 min). The sterilized 500 g / L glucose solution was added to the previously prepared YP solution in a specific ratio, and the mixture was stirred to prepare the YPD solution (the ratio was 4 mL of 500 g / L glucose to 96 mL of YP solution).
[0037] Solid YPD medium: Based on the above liquid YP medium, add an additional 2% agar powder for sterilization (autoclave at 121℃ for 20 min). Before use, heat to dissolve, then mix at 96 mL YP: 4 mL 500 g / L glucose.
[0038] BMMY medium: Tryptone 20.0 g / L, yeast extract 10.0 g / L (calculated based on 1 L of medium volume, tryptone and yeast extract dissolved and diluted to 780 mL of deionized water, autoclaved at 121℃ for 20 min), 10xYNB 10% (filtered sterilized, stored at 4 ℃ protected from light), phosphate buffer (pH 6.0) 10% (autoclaved at 121℃ for 20 min), 50% glycerol 2% (autoclaved at 121℃ for 20 min). Mix according to the proportions before use and dispense.
[0039] BMGY medium: 20.0 g / L tryptone, 10.0 g / L yeast extract (calculated based on 1 L of medium volume, tryptone and yeast extract dissolved and diluted to 790 mL deionized water, autoclaved at 121 ℃ for 20 min), 10xYNB 10% (filtered sterilized, stored at 4 ℃ protected from light), phosphate buffer (pH 6.0) 10% (autoclaved at 121 ℃ for 20 min), 1% methanol (no sterilization required). Mix according to the proportions before use and dispense.
[0040] Example 1: Construction of a recombinant Pichia pastoris strain that secretes extracellular honey and truffle sweeteners
[0041] Based on the published protein sequence of honey truffle sweetener, codons were optimized according to the codon preference of Pichia pastoris, and the whole gene sequence was synthesized to obtain the honey truffle sweetener gene sequence. To detect whether the honey truffle sweetener is secreted extracellularly, primers HTS-GFP-R, H-GFP-F, GFP-R, and HTS-TAOX-F were used to amplify the gene fragment GFP-HTS containing both the GFP gene and the honey truffle sweetener gene sequence. The codon-optimized gene sequence of the honey truffle sweetener is shown in SEQ ID NO.1, specifically:
[0042] ATGCCAGATTTGTCTTCATTCATCACCATCAAGAACAACTCTAATCATGTCTTTACCAGAACCGCTATCTACTCCAAGTACGCTGCTGTTCAATGGAGTCCAGAACCTCAGTTGTCTATTTCTCCAGGTAAGTGGGATCTGTTTATCTTGAAAGATATTCTTAGTATTAG AGGTACTTCTGGTTACGTCCAATACAGAGTCGGTGATGGACCTGGATGGGTCAGAGTCACTTTCAGTTCTTTGGTTGGTGCAGATGAAGTGGCTGAATGGTCTTCTGGTGATTTGCCAGATGGATTTGTCTTGCAGAAGCCAGTCAGAACTGGTTCCAGACCTCTGCAA.
[0043] The primer sequences are shown below:
[0044] HTS-GFP-R: 5'-CCGCTGCCGCTACCTTGCAGAGGTCTGGAACCAGT-3';
[0045] H-GFP-F: 5'-CTGCAAGGTAGCGGCAGCGGC-3';
[0046] GFP-R: 5'-CAGTCATGTCTAAGGCTACAAACttatatttgtaCagttcatccatgccatgtg-3';
[0047] HTS-TAOX-F: 5'-ggatgaactGtacaaataaGTTTGTAGCCTTAGACATGACTGTTCC-3'.
[0048] The obtained gene fragment GFP-HTS was ligated to the pPICZα plasmid framework via a one-step fusion PCR. The ligation product pPICZα-GFP-HTS was then transformed into DH5α competent cells, cultured, and plated on LB agar plates supplemented with bleomycin. After overnight incubation at 37°C, single colonies were picked for colony PCR. Positive colonies were transferred to 2 mL LB agar (supplemented with bleomycin), incubated at 37°C for 12 hours, and then the plasmid was extracted and sequenced.
[0049] The correctly sequenced plasmid was linearized and electroporated into Pichia pastoris X33 competent cells. After culturing, the cells were plated on YPD plates supplemented with bleomycin and cultured at 30°C until single colonies appeared. Single colonies were picked for colony PCR. Positive single colonies and blank control colonies were transferred to 2 mL of YPD (with bleomycin) and cultured overnight.
[0050] Inoculate 2 mL of the seed culture into a 250 mL Erlenmeyer flask containing 25 mL of BMMY medium. Incubate at 30°C and 220 rpm for 24 hours. Centrifuge the fermentation broth (4000×g, 5 minutes), discard the supernatant, resuspend the cells in 10 mL of sterile water, centrifuge again under the same conditions, discard the supernatant, add 25 mL of BMMY medium, resuspend the cells, transfer to a 250 mL Erlenmeyer flask, and induce culture with methanol at 30°C and 220 rpm for 5 days, adding 1% (v / v) methanol every 24 hours.
[0051] Centrifuge the fermentation broth (4000×g, 5 minutes), collect the supernatant, and detect the fluorescence value using a microplate reader. The excitation wavelength of the eGFP fluorescent protein was 488 nm, the emission wavelength was 523 nm, and the gain was 50. No fluorescence was observed, indicating that the α-MF signal peptide inherent in plasmid pPICZα could not induce secretory expression of the protein.
[0052] Example 2: Signal peptide screening promotes extracellular secretion of honey and truffle sweeteners
[0053] Based on literature review and Signal IP 6.0 prediction, it was determined that honey truffle sweetener itself does not contain a signal peptide sequence. Eleven signal peptides were screened, and their sequences are shown in Table 1. Using 12 pairs of primers, the corresponding signal peptides and their expression frames for honey truffle sweeteners containing green fluorescent protein (GFP) were amplified, namely α-MF-GFP-HTS (control group), ExpL KR-GFP-HTS, ExpLSP-GFP-HTS, UTH1-GFP-HTS, SUC2-GFP-HTS, PROSCW10-GFP-HTS, SCW10-GFP-HTS, PHO11-GFP-HTS, OST1-GFP-HTS, MEL1-GFP-HTS, and INU1-GFP-HTS.
[0054] Table 1 Signal Peptide Names and Sequences
[0055] Signal peptide name Signal peptide sequence α-MF (SEQ ID NO.2) ATGAGATTTCCTTCAATTTTTACTGCTGTTTTATTCGCAGCATCCTCCGCATTAGCTGCTCCAGTCAACACTACAACAGAAGATGAAACGGCACAAATTCCGGCTGAAGCTGTCATCGGTTACTCAGATTTAGAAGGGGATTTCGATGTTGCTGTTTTGCCATTTTCCAACAGCACAAATAACGGGTTATTGTTTATAAATACTACTATTGCCAGCATTGCTGCTAAAGAAGAAGGGGTATCTCTCGAGAAAAGAGAGGCTGAAGCT ExpL KR (SEQ ID NO.3) ATGAAGCTCTCCACCAATTTGATTCTAGCTATTGCAGCAGCTTCCGCCGTTGTCTCAGCTGCTCCAGTTGCTCCAGCCGAAGAGGCAGCAAACCACTTGCACAAGCGT ExpL SP (SEQ ID NO.4) ATGAAGCTCTCCACCAATTTGATTCTAGCTATTGCAGCAGCTTCCGCCGTTGTCTCAGCT UTH1 (SEQ ID NO.5) ATGAAATCTCAACTTATCTTTATGGCTCTTGCCTCTCTGGTGGCCTCC SUC2 (SEQ ID NO.6) ATGCTTTTGCAAGCTTTCCTTTTCCTTTTGGCTGGTTTTGCAGCCAAAATATCTGCA PROSCW (SEQ ID NO.7) ATGCAAGTTAAATCTATCGTTAACCTACTGTTGGCATGTTCGTTGGCCGTGGCCAGACCTTTGGAGCACGCCCACCATCAACATGACAAGAGA SCW10 (SEQ ID NO.8) ATGCAAGTTAAATCTATCGTTAACCTACTGTTGGCATGTTCGTTGGCCGTGGCC PHO11 (SEQ ID NO.9) ATGTTGAAGTCAGCCGTTTATTCAATTTTAGCCGCTTCTTTGGTTAATGCA OST1 (SEQ ID NO.10) ATGAGGCAGGTTTGGTTCTCTTGGATTGTGGGATTGTTCCTATGTTTTTTCAACGTGTCTTCTGCT MEL1 (SEQ ID NO.11) ATGAGAGCTTTCTTGTTTCTCACCGCATGCATCAGTTTGCCAGGCGTTTTTGGG INU1 (SEQ ID NO.12) ATGAAGTTAGCATACTCCCTCTTGCTTCCATTGGCAGGAGTCAGTGCTTCAGTTATCAATTACAAGAGA 0030 (SEQ ID NO.13) ATGAAGTTCGCAATTTCAACACTTCTTATTATCCTACAGGCTGCCGCTGTTTTTGCTGCC
[0056] The primer sequences (5’-3’) are as follows:
[0057] PAOX-UTH-R: GATTTCATCGTTTCGAATAATTAGTTGTTTTTTGATCTTCTCAAG;
[0058] UTH-F: GAAGATCAAAAAACAACTAATTATTCGAAACGATGAAATCTCAACTTATCTTTATGGCTC;
[0059] UTH-R: TGAAGACAAATCTGGCATGGAGGCCACCAGAGAGG;
[0060] UTH-H-F: GGCCTCCATGCCAGATTTGTCTTCATTCATCACC;
[0061] HTS-GFP-R: CCGCTGCCGCTACCTTGCAGAGGTCTGGAACCAGT;
[0062] H-GFP-F: CTGCAAGGTAGCGGCAGCGGC;
[0063] PAOX-SUC-R: AGGAAAGCTTGCAAAAGCATCGTTTCGAATAATTAGTTGTTTTTTGATCTTCTCAA;
[0064] SUC-F: TCGAAACGATGCTTTTGCAAGCTTTCCTTTTCC;
[0065] SUC-R: GAATGAAGACAAATCTGGCATTGCAGATATTTTGGCTGCAAAACCA;
[0066] SUC-H-F: GCCAAAATATCTGCAATGCCAGATTTGTCTTCATTCATCACC;
[0067] PAOX-SCW10PRO-R: AACGATAGATTTAACTTGCATCGTTTCGAATAATTAGTTGTTTTTTGATCTTCTCAAG;
[0068] SCW10PRO-F:GATCAAAAAACAACTAATTATTCGAAACGATGCAAGTTAAATCTATCGTTAACCTACTG;
[0069] SCW10PRO-R:TCTGGCATTCTCTTGTCATGTTGATGGTGGG;
[0070] SCW10PRO-H-F:CCACCATCAACATGACAAGAGAATGCCAGATTTGTCTTCATTCATCACC;
[0071] SCW10-R:CTGGCATGGCCACGGCCAACG;
[0072] SCW10-H-F:GGCCGTGGCCATGCCAGATTTGTCTTCATTCATCACC;
[0073] PAOX-PHO-R:ACGGCTGACTTCAACATCGTTTCGAATAATTAGTTGTTTTTTGATCTTCTCA;
[0074] PHO-F:CAAAAAACAACTAATTATTCGAAACGATGTTGAAGTCAGCCGTTTATTCAATTT;
[0075] PHO-R:GTGATGAATGAAGACAAATCTGGCATTGCATTAACCAAAGAAGCGG;
[0076] PHO-H-F:GGTTAATGCAATGCCAGATTTGTCTTCATTCATCACC;
[0077] PAOX-OST-R:CCTGCCTCATCGTTTCGAATAATTAGTTGTTTTTTGATCTTCTCAAG;
[0078] OST-F:AGATCAAAAAACAACTAATTATTCGAAACGATGAGGCAGGTTTGGTTCTCT;
[0079] OST-R:ATGAAGACAAATCTGGCATAGCAGAAGACACGTTGAAAAAACAT;
[0080] OST-HF:CGTGTCTTCTGCTATGCCAGATTTGTCTTCATTCATCACC;
[0081] PAOX-MEL-R:AAGAAAGCTCTCATCGTTTCGAATAATTAGTTGTTTTTTGATCTTCTCAAGTT;
[0082] MEL-F:GAGAAGATCAAAAAACAACTAATTATTCGAAACGATGAGCTTTCTTGTTTCTCACCG;
[0083] MEL-R:TGGCATCCCAAAAAACGCCTGGCA;
[0084] MEL-HF:GCCAGGCGTTTTTGGGATGCCAGATTTGTCTTCATTCATCACC;
[0085] PAOX-INU-R:GCAAGAGGGAGTATGCTAACTTCATCGTTTCGAATAATTAGTTGTTTTTTGATCTTCTCAAG;
[0086] INU1-F:CGAAACGATGAAGTTAGCATACTCCCCTTGCTTC;
[0087] INU-R:GAAGACAAATCTGGCATTCTCTTGTAATTGATAACTGAAGCACTGAC;
[0088] INU-HF:GCTTCAGTTATCAATTACAAGAATGCCAGATTTGTCTTCATTCATCACC;
[0089] PAOX-KR-R:GGTGGAGAGCTTCATCGTTTCGAATAATTAGTTGTTTTTTGATCTTCTCAAG;
[0090] KR-F:CAAAAAACAACTAATTATTCGAAACGATGAAGCTCTCCACCAATTTGATTC;
[0091] KR-R:AATCTGGCATACGCTTGTGCAAGTGGTTTG;
[0092] KR-HF: CCACTTGCACAAGCGTATGCCAGATTTGTCTTTCATTCATCACC;
[0093] PAOX-SP-R: GGTGGAGAGCTTCATCGTTTCGAATAATTAGTTGTTTTTTGATCTTCTCA;
[0094] SP-F: AACAACTAATTATTCGAAACGATGAAGCTCTCCACCAATTTGATTCT;
[0095] SP-R: CTGGCATAGCTGAGACAACGGCGG;
[0096] SP-HF: CGCCGTTGTCTCAGCTATGCCAGATTTGTCTTTCATTCATCACC;
[0097] PAOX-0030-R: GCGAACTTCATCGTTTCGAATAATTAGTTGTTTTTTGATCTTCTCAAG;
[0098] 0030-F: GAGAAGATCAAAAAACAACTAATTATTCGAAACGATGAAGTTCGCAATTTCAACACTTCTTATTTTC;
[0099] 0030-R: GAAGACAAATCTGGCATGGCAGCAAAAACAGCGGC;
[0100] 0030-HF:GTTTTGCTGCCATGCCAGATTTGTCTCATTCATCACC.
[0101] The gene fragments obtained above were ligated to the plasmid framework (using pPICZα plasmid as the backbone, with the α-MF signal peptide removed) via one-step fusion PCR. The ligation product was then transferred into DH5α competent cells, cultured, and plated on LB agar plates supplemented with bleomycin. After overnight incubation at 37°C, single colonies were picked for colony PCR. Positive colonies were transferred to 2 mL LB agar (supplemented with bleomycin), incubated at 37°C for 12 hours, and then the plasmid was extracted for sequencing.
[0102] The correctly sequenced plasmid was linearized and electroporated into Pichia pastoris X33 competent cells. After culturing, the cells were plated on YPD plates supplemented with bleomycin and cultured at 30°C until single colonies appeared. Single colonies were picked for colony PCR. Positive single colonies and blank control colonies were transferred to 2 mL of YPD (with bleomycin) and cultured overnight.
[0103] Inoculate 2 mL of the seed culture into a 250 mL Erlenmeyer flask containing 25 mL of BMMY medium. Incubate at 30°C and 220 rpm for 24 hours. Centrifuge the fermentation broth (4000×g, 5 minutes), discard the supernatant, resuspend the cells in 10 mL of sterile water, centrifuge again under the same conditions, discard the supernatant, add 25 mL of BMMY medium, resuspend the cells, transfer to a 250 mL Erlenmeyer flask, and induce culture with methanol at 30°C and 220 rpm for 5 days, adding 1% (v / v) methanol every 24 hours.
[0104] After fermentation, 100 μL of the fermentation broth was taken and diluted 1:100, and the OD was measured using a UV spectrophotometer. 600 The entire fermentation broth was then centrifuged (4000×g, 5 minutes), and 200 μL of the supernatant was collected. The fluorescence value was detected using a microplate reader. The excitation wavelength of eGFP fluorescent protein was 488 nm, the emission wavelength was 523 nm, and the gain was 50. The results are as follows: Figure 1 As shown, the signal peptides SUC2, PROSCW10, OST1, SCW10, and UTH1 can induce the secretion of honey truffle sweeteners extracellularly. The signal peptides PHO11, Expl KR, and Expl SP enable the intracellular expression of honey truffle sweeteners, but they cannot be transported in a timely manner and require modification. MEL1 and INU1 showed no fluorescent characterization, indicating that they cannot express HTS at all.
[0105] Example 3: Signal peptide structure optimization promotes extracellular secretory expression of honey and truffle sweeteners
[0106] Based on the transmembrane secretion capacity of the pro region of the α-MF signal peptide in the signal peptide segment predicted by Signal IP 6.0, the C-terminus of the signal peptides (SUC2, PROSCW10, OST1, SCW10, PHO11, ExpL KR and ExplSP, of which UTH1 would restrict the growth of the strain and therefore was not further modified) screened in Example 2 was linked to the pro region of the α-MF signal peptide and then combined. The honey truffle sweetener strain with fused signal peptide was constructed according to the methods of Example 1 and Example 2.
[0107] Positive single colonies and blank control colonies were transferred to 2 mL of YPD (with bleomycin added) and cultured overnight.
[0108] Inoculate 2 mL of the seed culture into a 250 mL Erlenmeyer flask containing 25 mL of BMMY medium. Incubate at 30°C and 220 rpm for 24 hours. Centrifuge the fermentation broth (4000×g, 5 minutes), discard the supernatant, resuspend the cells in 10 mL of sterile water, centrifuge again under the same conditions, discard the supernatant, add 25 mL of BMMY medium, resuspend the cells, transfer to a 250 mL Erlenmeyer flask, and induce culture with methanol at 30°C and 220 rpm for 5 days, adding 1% (v / v) methanol every 24 hours.
[0109] SDS-PAGE was performed on the supernatant of the fermentation broth on day 5, and the results are as follows. Figure 2 As shown.
[0110] The fermentation broth was collected in a 50 mL sterile centrifuge tube and centrifuged at 5000 rpm and 4 °C for 10 min. The supernatant was collected and filtered through a 0.22 μm filter membrane. The fermentation broth was purified using a nickel column with PBS + 250 mM imidazole as the elution buffer. The purified protein solution was then filtered through a 0.22 μm filter membrane. The filtered purified protein solution was desalted using a desalting column with sterile deionized water as the desalting solution. 1 mL of purified protein solution required 3 mL of sterile deionized water for desalting.
[0111] After purification and desalting of the fermentation broth supernatant, protein yield was detected using a BCA assay kit. The results are as follows: Figure 3 As shown, the fusion signal peptide can achieve extracellular secretory expression of honey truffle sweetener, but the yield varies. Among them, the yield of honey truffle sweetener expressed using the fusion signal peptide SCW10-pro reached 44 mg / L.
[0112] Obviously, the above embodiments are merely illustrative examples for clear explanation and are not intended to limit the implementation. Those skilled in the art will recognize that other variations or modifications can be made based on the above description. It is neither necessary nor possible to exhaustively list all possible implementations here. However, obvious variations or modifications derived therefrom are still within the scope of protection of this invention.
Claims
1. A method for constructing Pichia pastoris that produces honey truffle sweetener, characterized in that: The honey truffle sweetener encoding gene was heterologously expressed using a fusion signal peptide in a Pichia pastoris chassis strain. The fusion signal peptide was obtained by linking the C-terminus of a signal peptide to the Pro region of an α-mating factor. The signal peptide was any one of SCU2, SCW10, PROSCW10, OST1, Expl KR, Expl SP, and PHO11.
2. The construction method according to claim 1, characterized in that: The nucleotide sequence of the gene encoding the honey truffle sweetener is shown in SEQ ID NO.
1.
3. The construction method according to claim 1, characterized in that: The expression uses P AOX1 Promoter.
4. The construction method according to claim 1, characterized in that: The Pichia pastoris chassis strain is Pichia pastoris X-33.
5. Pichia pastoris obtained by any of the construction methods described in claims 1-4.
6. The use of Pichia pastoris as described in claim 5 in the preparation of microbial products.
7. A microbial product prepared from the Pichia pastoris as described in claim 5.
8. The use of the Pichia pastoris of claim 5 or the microbial product of claim 7 in the production of honey truffle sweetener.
9. A method for producing honey truffle sweetener, characterized in that: The Pichia pastoris of claim 5 or the microbial agent of claim 7 is added to the fermentation system.
10. The method according to claim 9, characterized in that: It also includes steps for purifying and desalting the fermentation products.