Application of FNR1 in creation of heat-resistant and stable-yield rice germplasm by genetic engineering method

Abstract

The invention relates to the field of bioengineering, and discloses application of FNR1 in creation of heat-resistant and stable-yield rice germplasm by a genetic engineering method. The interaction protein of the Fd1 is screened through a yeast Y2H experiment, the FNRs protein interacting with the Fd1 is verified through BiFC, GST-Pull down and luciferase complementary experiments, and it is confirmed that the downstream electron acceptor of the Fd1 in linear electron transfer is FNR1. On the basis, it is further found through tests for the first time that after the FNR1 in the rice is over-expressed, the high-temperature tolerance of the rice can be effectively improved, the stable yield of the rice can be kept under high-temperature stress, and great significance is achieved for cultivating new varieties of the high-temperature-resistant rice.

Description

Technical Field

[0001] This invention relates to the field of bioengineering, and more particularly to... FNR1 Application of genetic engineering in the creation of heat-resistant and stable-yielding rice germplasm. Background Technology

[0002] Plants rely on photosynthesis for material transformation and energy metabolism, but high-temperature stress has a significant impact on photosynthesis. High-temperature stress can cause a series of damages to the plant's photosynthetic system, such as damaging the thylakoid membrane, the light-harvesting antenna system, the oxygen-evolving complex on the donor side, and reaction centers, as well as affecting the efficiency of electron transport on the acceptor side. High-temperature stress also causes the accumulation of reactive oxygen species in chloroplasts, resulting in oxidative stress, which affects the photosynthetic efficiency of plants by influencing the activity of enzymes involved in photosynthetic reactions such as Rubisco.

[0003] The team's previous patent CN111100867A, "Rice ferricoxin encoding gene", OsFd1 The protein encoded by this gene and its uses are disclosed in "The Protein Encoded by This Gene and Its Uses". Fd1 As the most important leaf type of rice Former Proteins are crucial for photosynthesis in rice. Building upon this foundation, our research team further discovered that overexpression of rice iron oxide protein... OsFd1 It can increase the photosynthetic capacity, carbon assimilation efficiency, growth and yield of rice under high temperature stress (not yet announced). Fd1 As a major photosynthetic electron transport protein, it can receive electrons from photosystem I and transfer electrons to... FNR Downstream electron acceptors, etc. FNR As the terminal acceptor in a linear electron transport chain, it can transfer electrons to NADP. + The reducing power generated is used for carbon fixation. However, rice has two leaf types. FNR Which one is Fd1 The direct electron acceptor, and since it enhances Fd1 While increasing the expression level can improve the heat resistance and yield stability of rice, whether increasing other electron transporters in the photosynthetic electron transport chain can achieve the same goal remains unknown. Therefore, in-depth research on this topic may bring potential practical application value. Summary of the Invention

[0004] This invention provides FNR1 Application in the creation of heat-resistant and stable-yielding rice germplasm using genetic engineering methods. This invention discovers overexpression rice... FNR1 It can effectively improve the high temperature tolerance of rice and enable rice to maintain stable yield under high temperature stress, which is of great significance for breeding new rice varieties resistant to high temperature.

[0005] The specific technical solution of the present invention includes: In a first aspect, the present invention provides FNR1 Application of genes in improving photosynthetic stability or heat tolerance in rice: overexpression of rice leaf-type ferrugin-NADP + Oxidoreductase FNR1 Methods to improve the photosynthetic stability or heat resistance of rice.

[0006] First, this invention uses yeast Y2H experiments for screening. Fd1 Interacting proteins, and verified by BiFC, GST-Pulldown, and luciferase complementation experiments. Fd1 Interactive FNRs Proteins confirmed linear electron transport. Fd1 The downstream electron acceptor is FNR1 Building upon this foundation, the present invention further discovered, through experiments, for the first time, that overexpression of [a specific ingredient] in rice... FNR1 This can effectively improve the high-temperature tolerance of rice, specifically in terms of improved photosynthetic efficiency, carbon assimilation efficiency, growth status, and rice yield under high-temperature stress.

[0007] The growth status includes plant height, number of tillers, fresh weight and dry weight of above-ground parts, etc.; the rice yield includes seed setting rate, thousand-grain weight, yield per plant and rice pollen fertility, etc.

[0008] This invention discovers through experiments that, FNR1 Compared with wild-type rice, overexpressed rice lines did not show significant advantages under normal field conditions, but they exhibited significant advantages under high-temperature stress. For example, they were significantly superior to wild-type rice in terms of plant height, number of tillers, seed setting rate, aboveground fresh weight, dry weight, thousand-grain weight, yield per plant, and rice pollen fertility at both tillering and maturity stages.

[0009] Furthermore, the overexpression of rice leaf-type ferroredoxin-NADP+ oxidoreductase FNR1 is achieved through transgenic methods or gene editing methods, etc.

[0010] Furthermore, the genetic modification method involves constructing... FNR1 The expression vector was overexpressed and transferred into rice, thereby achieving overexpression in rice. FNR1 Furthermore, the transgenic method specifically includes: PCR amplification of rice cDNA. FNR1 Gene CDS sequence (SEQ ID NO: 2), constructed FNR1 Overexpression vector; using Agrobacterium-mediated transformation, FNR1 The overexpression vector was genetically transformed into a certain rice variety to obtain... FNR1 High expression rice.

[0011] Preferably, the rice varieties include the wild-type rice variety Nipponbare, the cultivated variety Xiushui 134, or Huazhan.

[0012] Furthermore, the gene editing method utilizes a gene editing system to regulate... FNR1 Editing multiple functional elements of expression levels to improve the expression of rice FNR1 The expression level; further preferably, the gene editing method specifically includes: using gene editing technology to edit rice... FNR1 Gene editing was performed using the gene promoter sequence (SEQ ID NO: 4) to obtain... FNR1 High expression rice.

[0013] Secondly, the present invention provides FNR1 The application of genes in creating new rice germplasm with heat-resistant and stable-yielding characteristics through genetic engineering.

[0014] Furthermore, the heat-resistant and stable-yield characteristics are manifested in the improved photosynthetic capacity, carbon assimilation efficiency, growth status, or yield of rice under high-temperature stress.

[0015] Thirdly, this invention provides an overexpression method for rice leaf-type feroxin-NADP. + Oxidoreductase FNR1 Recombinant plasmids containing genes FNR1 Nucleotide fragments.

[0016] Preferably, the recombinant plasmid is pCAMBIA1300- FNR1 -GFP-flag recombinant plasmid, which contains FNR1 Nucleotide fragments.

[0017] Fourthly, the present invention provides the application of the above-mentioned recombinant plasmid in the creation of new rice germplasm with heat-resistant and stable yield characteristics.

[0018] Fifthly, the present invention provides a method for improving the photosynthetic stability or heat resistance of rice: by overexpressing rice leaf-type ferrugin-NADP. + Oxidoreductase FNR1 Methods to improve the photosynthetic capacity, carbon assimilation efficiency, growth status, or yield of rice under high temperature stress.

[0019] Compared with the prior art, the beneficial effects of the present invention are: (1) The present invention screens yeast Y2H through experiments. Fd1 Interacting proteins, and verified by BiFC, GST-Pull down, and luciferase complementation experiments. Fd1 Interactive FNRs Proteins confirmed linear electron transport. Fd1The downstream electron acceptor is FNR1 .

[0020] (2) This invention further discovered for the first time through experiments that overexpression of rice... FNR1 This can effectively improve the high-temperature tolerance of rice, enabling rice to maintain stable yield under high-temperature stress, which is of great significance for cultivating new high-temperature resistant rice varieties. Attached Figure Description

[0021] Figure 1 for Fd1 and FNR1 Interaction diagram; where: (a) detection by yeast two-hybrid experiment Fd1 and FNR1 Interaction occurs between them. Fd1 and FNR2 No direct interaction occurred between the proteins; co-transformation of pGADT7 and pGBK7 empty vectors (AD / BD) was used as a negative control; different protein combinations were transformed into yeast cells and inoculated onto selective media (SD); SD: synthetic complete agar medium; SD / -Leu / -Trp: SD medium with two deficiencies (Leu and Trp); SD / -Leu / -Trp / -His / -Ade: SD medium with four deficiencies (Leu, Trp, His, and Ade); (b) Pull-down experiment verification Fd1 and FNR1 Interaction analysis; FNR1 -MBP, a type of device tagged with MBP FNR1 Recombinant proteins; Fd1 -GST, a type of substance labeled GST. Fd1 Recombinant protein; (c) tobacco epidermal cells Fd1 and FNR1 Complementation analysis of the fibrillating luciferase (Luc); nLuc and cLuc represent the N-terminus and C-terminus of Luc, respectively; Fd1 -nLuc / cLuc means Fd1 -A fusion of nLuc and cLuc; nLuc / FNR1 -cLuc means FNR1 The fusion of -cLuc and nLuc; Fd1 -nLuc / FNR1 -cLuc means FNR1 -cLuc's C-end and Fd1 -nLuc N-terminal fusion; (d) in protoplasts Fd1 and FNR1 Detection of bimolecular complementary fluorescence (BiFC); Fd1 -nYFP, Fd1 Fusion with nYFP; FNR1 -cYFP, FNR1Fusion with cYFP. Scale bar: 100 μm.

[0022] Figure 2 for FNR1 Homology analysis and FNR1 -Schematic diagram of OE line creation; where: (a) Phylogenetic tree was constructed using the neighbor-joining (NJ) method of MEGA7, Arabidopsis thaliana and rice FNRs Amino acid sequences were downloaded from the National Rice Data Center database (https: / / www.ricedata.cn / gene / ) and the TAIR database (https: / / www.arabidopsis.org / ); (b) Expression in rice FNR1 A schematic diagram of a gene vector; FNR1 (c) fusion of cDNA with GFP-flg tag; (c) RT-PCR detection FNR1 exist FNR1 -OE NIP Expression in homozygous transgenic lines. Data are presented as mean ± standard deviation (n = 3).

[0023] Figure 3 for FNR1 -OE phenotype under normal conditions; among which: (a) NIP and planted in Lingshui (LS) in 2023 FNR1 -OE NIP (a) Plant height of homozygous transgenic lines at maturity; (b) Number of tillers at maturity; (c, d) Statistical analysis of seed setting rate and yield per plant; Data are mean ± standard deviation (a, b, n=10; c, n=20; d, n=10); One-way ANOVA was used, and the letters a and b indicate significant differences; P <0.05.

[0024] Figure 4 for FNR1 -OE phenotypes under high temperature stress; where: (a) NIP and FNR1 -OE NIP (a) Whole-plant phenotype of homozygous transgenic lines at tillering and maturity stages; (b) NIP and FNR1 -OE NIP (c) Plant height statistics of homozygous transgenic lines at tillering and maturity stages, data are mean ± standard deviation (n=10); (d) Tiller number statistics at tillering and maturity stages, data are mean ± standard deviation (n=10); (e) Field temperature statistics in Chongqing during the 2023 growing season; FNR1 -OE NIP Statistical analysis of the aboveground fresh weight and aboveground dry weight of homozygous transgenic lines, data are mean ± standard deviation (n=10); (f) NIP and FNR1 -OENIP Statistical analysis of seed setting rate of homozygous transgenic lines, data are mean ± standard deviation (n=20); (g, h) NIP and FNR1 -OE NIP The yield of homozygous transgenic lines was displayed and statistically analyzed. The data are the mean ± standard deviation (n=10). All plants were grown in paddy fields. One-way ANOVA was used, and the letters a, b and c indicate significant differences. P <0.05. Scale bar, 10 cm (a); 5 cm (g).

[0025] Figure 5 for FNR1 -OE plant photosynthetic capacity assay: where: (a, b) NIP and FNR1 -OE NIP Electron transport rates ETR I and ETR II of PSI and PSII in homozygous transgenic lines; (c, d) Photochemical quantum yields YI and YII of PSI and PSII; (e) Maximum quantum yield of PSII (Fv / Fm); (f) Maximum oxidation level of PSI (Pm); (g) Non-photochemical quenching coefficient (NPQ); (h) At 400 μmol mol -1 CO2 concentration, 1500 μmol / m -2 .s -1 Variation in net photosynthetic rate under light intensity; numerical values ​​represent mean ± standard deviation (n=3); one-way ANOVA was used, with letters a, b, c, and d indicating significant differences. P <0.05.

[0026] Figure 6 Among cultivated varieties FNR1 -OE plant phenotype: Among them: (a) Xiushui 134 background FNR1 -OE XS Phenotype of mature plants from homozygous transgenic lines; (b) 400 μmol -1 CO2 and 1500 μmol m -2 .s -1 Net photosynthetic rate under light intensity (n=3); (c) FNR1 -OE XS Statistics on the yield of a single homozygous transgenic line (n=10); (d) Under the background of Chinese occupation FNR1 -OE HuaZ Mature phenotype of homozygous transgenic lines; (e) 400 μmol -1 CO2 and 1500 μmol m -2 .s -1 Net photosynthetic rate under light intensity (n=3); (f) FNR1 -OE HuaZYield analysis of homozygous transgenic lines per plant (n=10); all data are expressed as mean ± standard deviation; one-way ANOVA was used to identify significant differences between labeled groups. P <0.05; scale bar is 10 cm.

[0027] Figure 7 for FNR1 -OE plant carbon assimilation product detection: Among them: (a) NIP under natural high temperature stress in the field, FNR1 -OE NIP Transmission electron microscopy images of chloroplast structure in homozygous transgenic lines; (b) Statistical analysis of starch grains in each chloroplast; (c) Temperature settings for high-temperature treatment of rice during the booting stage; (d) Detection of glucose, fructose, and sucrose content under normal and high-temperature treatments; FHT: natural field high-temperature stress; AHT: artificial climate chamber simulation of high temperature; ACK: artificial climate chamber simulation of normal conditions; (e) Detection of starch content under normal and high-temperature treatments; Data are expressed as mean ± standard deviation (b, n=30; d, e, n=3); One-way ANOVA was used, with letters a, b, c, d, e, f, and g indicating significant differences. P <0.05.

[0028] Figure 8 for FNR1 - Pollen fertility testing of OE homozygous transgenic plants: including (a) NIP under normal temperature and high temperature stress, FNR1 -OE NIP (a) K2-KI staining of pollen grains from homozygous transgenic lines; (b) Statistical analysis of pollen grain fertility; data are mean ± standard deviation (n=30); FHT: natural field heat stress; AHT: simulated high temperature in an artificial climate chamber; ACK: simulated normal conditions in an artificial climate chamber; one-way ANOVA was used, with letters a, b, c, d, and e indicating significant differences. P <0.05; scale bar is 100 μm (a). Detailed Implementation

[0029] The present invention will be further described below with reference to embodiments.

[0030] General Implementation Examples In a first aspect, the present invention provides FNR1 Application of genes in improving photosynthetic stability or heat tolerance in rice: overexpression of rice leaf-type ferrugin-NADP + Oxidoreductase FNR1 Methods to improve the photosynthetic stability or heat resistance of rice.

[0031] Furthermore, the photosynthetic stability or heat resistance of rice includes the photosynthetic capacity, carbon assimilation efficiency, growth status, or yield of rice under high temperature stress.

[0032] The growth status includes plant height, number of tillers, fresh weight and dry weight of above-ground parts, etc.; the rice yield includes seed setting rate, thousand-grain weight, yield per plant and rice pollen fertility, etc.

[0033] Furthermore, the overexpression of rice leaf-type ferredoxin-NADP+ oxidoreductase... FNR1 The methods are either genetic modification or gene editing.

[0034] Furthermore, the genetic modification method involves constructing... FNR1 The expression vector was overexpressed and transferred into rice, thereby achieving overexpression in rice. FNR1 Furthermore, the transgenic method specifically includes: PCR amplification of rice cDNA. FNR1 Gene CDS sequence (SEQ ID NO: 2), constructed FNR1 Overexpression vector; using Agrobacterium-mediated transformation, FNR1 The overexpression vector was genetically transformed into a certain rice variety to obtain... FNR1 High expression rice.

[0035] Preferably, the rice varieties include the wild-type rice variety Nipponbare, the cultivated variety Xiushui 134, or Huazhan.

[0036] Furthermore, the gene editing method utilizes a gene editing system to regulate... FNR1 Editing multiple functional elements of expression levels to improve the expression of rice FNR1 The expression level; further preferably, the gene editing method specifically includes: using gene editing technology to edit rice... FNR1 Gene editing was performed using the gene promoter sequence (SEQ ID NO: 4) to obtain... FNR1 High expression rice.

[0037] Secondly, the present invention provides FNR1 The application of genes in creating new rice germplasm with heat-resistant and stable-yielding characteristics through genetic engineering.

[0038] Furthermore, the heat-resistant and stable-yield characteristics are manifested in the improved photosynthetic capacity, carbon assimilation efficiency, growth status, or yield of rice under high-temperature stress.

[0039] Thirdly, this invention provides an overexpression method for rice leaf-type feroxin-NADP. + Oxidoreductase FNR1 Recombinant plasmids containing genes FNR1 Nucleotide fragments.

[0040] Preferably, the recombinant plasmid is pCAMBIA1300- FNR1-GFP-flag recombinant plasmid, which contains FNR1 Nucleotide fragments.

[0041] Fourthly, the present invention provides the application of the above-mentioned recombinant plasmid in the creation of new rice germplasm with heat-resistant and stable yield characteristics.

[0042] Fifthly, the present invention provides a method for improving the photosynthetic stability or heat resistance of rice: by overexpressing rice leaf-type ferrugin-NADP. + Oxidoreductase FNR1 Methods to improve the photosynthetic capacity, carbon assimilation efficiency, growth status, or yield of rice under high temperature stress. Specific Implementation This invention verified the following through experiments: Y2H, pull-down, BiFC, and luciferase complementation (Luc). FNR1 and Fd1 Interaction, results show FNR1 yes Fd1 Downstream electron acceptor, another in rice FNR homologous gene-encoded proteins FNR2 and Fd1 They do not interact directly. (Build) FNR1 Rice was transformed with the overexpression vector, and the results were obtained using Li-6800 and Dual PAM 100. FNR1 The photosynthetic rate and photosynthetic parameters of rice with high expression were measured, and the results showed that under high temperature stress... FNR1 Overexpressing plants exhibited higher photosynthetic capacity, with superior photosynthetic rate and chloroplast fluorescence parameters compared to the wild type; agronomic trait studies showed that under high-temperature field conditions... FNR1 The overexpression lines exhibited significantly higher plant height, tiller number, biomass, and yield per plant compared to the wild type. Further verification is needed. FNR1 Application in heat-resistant breeding: This invention utilizes an artificial climate chamber to regulate the tillering peak stage... FNR1 -OE NIP Homozygous transgenic lines and wild-type lines were subjected to high-temperature treatment, and the carbon assimilation products and pollen fertility under high-temperature treatment and normal temperature were detected and statistically analyzed. FNR1 The gDNA nucleotide sequence is shown in SEQ ID NO:1; FNR1 The cDNA nucleotide sequence is shown in SEQ ID NO:2; FNR1 The amino acid sequence of the protein is shown in SEQ ID NO:3.

[0044] Example 1: FNR1 and Fd1 Mutual verification (1) Screening by yeast Y2H experiment Fd1 Interacting proteins: Fd1 -pGBKT7 and FNR1 The pGADT7 plasmid was co-transfected into AH109 cells. The cells were then plated on plates with two- and four-cell deficiencies. pGBKT7-p53+pGADT7-Larget and pGBKT7-laminc+pGADT7-Larget served as positive and negative controls, respectively.

[0045] (2) GST-Pull down verification: Fd1 The CDS sequence was cloned into the pGEX-4T-1 vector. FNR1 The CDS sequence was cloned into the pmal-c5x (MBP) vector. Expression was induced in *E. coli* BL21 (DE3) strain by IPTG in a shaker at 28°C. Fd1 -GST and FNR1 -MBP recombinant protein. In vitro purification. FNR1 -MBP and Fd1 -pGEX-4T-GST protein. Will contain... Fd1 -GST or glutathione beads of GST protein and FNR1 After mixing with MBP, the beads were incubated in buffer at 4°C for 4 hours. The beads were then washed with buffer, followed by elution of proteins with GST elution buffer. The mixture was boiled and analyzed by Western blot (WB) with GST and MBP antibodies.

[0046] (3) Luciferase complementation experiment verification FNR1 and Fd1 Interaction relationship: By dividing Luciferase into two functional segments, N-terminus and C-terminus, and... FNR1 and Fd1 CDS sequences were ligated into the vector. The constructed vector was transformed into tobacco using Agrobacterium, and luciferase activity was detected using luciferin as a substrate.

[0047] (4) Verification via BiFC: Fd1 The CDS sequence was cloned into the pSAT4A-nEYFP vector. FNR1 The CDS sequence was cloned into the pSAT4A-cEYFP vector. Fd1 -nYFP and FNR1 GV3101 co-transformed with -cYFP was introduced into rice protoplasts. Subsequently, fluorescence signals were observed using a laser confocal microscope under excitation light at a wavelength of 514 nm. (5) Data on the relationship between rice and Arabidopsis thaliana were obtained from the National Rice Data Center database (https: / / www.ricedata.cn / gene / ) and the TAIR database (https: / / www.arabidopsis.org / ). FNR1 Homologous amino acid sequences. A phylogenetic tree was constructed using the amino acid sequences of AtFNRs and OsFNRs. Figure 2 a). It was found in the evolutionary tree that... FNR1 Leaf type FNR ( LFNR Rice has two leaf types. FNR : LFNR1 and LFNR2 .

[0048] (6) Results: OsFd1 and OsFNR1 Direct interaction, with OsFNR2 Do not interact directly ( Figure 1 ), OsFNR1 It plays a major role in linear electron transport.

[0049] Example 2: FNR1 Creation of gene overexpression materials FNR1 Creation of gene overexpression materials: through the construction of FNR1 The expression vector was used to transform the japonica rice variety Nipponbare, the cultivar Japonica rice Xiushui 134, and the indica rice restorer line Huazhan.

[0050] (one) FNR1 Construction of overexpression vectors (1) FNR1 Cloning of gene fragments according to FNR1 Primer pairs were designed based on the coding sequence for overexpression vector construction. Based on the multiple cloning site on the pCAMBIA1300-GFP-flag plasmid, primer ends were introduced... Kpn I. Restriction site for enzyme digestion; PCR was performed using cDNA from the rice sequencing variety Nipponbare (NIP) as a template to amplify... FNR1 A gene fragment of 1131 bp in length (SEQ ID NO: 2); primer sequences are as follows: Forward primer: ttctgcaggagctcggtaccATGGCCGCCGTGAACACA; Reverse primer: tcgctcatggatccggtacc AGCCAGTCGATGCCTACATA; The amplification program was as follows: 95℃ for 5 min; 95℃ for 30 sec, 56℃ for 30 sec, 68℃ for 2 min, 30 cycles; 72℃ for 70 sec; The PCR amplification products were subjected to 1% agarose gel electrophoresis, and the band of about 1168 bp was recovered and purified using the Spide gel recovery kit.

[0051] (2) Construction of recombinant expression vector use Kpn The pCAMBIA1300-GFP-flag plasmid was digested with enzyme I to obtain the linear pCAMBIA1300-GFP-flag vector; FNR1 The CDS sequence was ligated into the pCAMBIA1300-GFP-flag vector via homologous recombination; the ligation product was heat-shocked and transformed into E. coli DH5α strain, cultured overnight at 37°C, and positive clones were selected for sequencing; the recombinant plasmid pCAMBIA1300- was obtained. FNR1 -GFP-flag ( Figure 2 b).

[0052] (II) Stable transformation of rice mediated by Agrobacterium EHA105 (1) Transformation of Agrobacterium: Agrobacterium was transformed using the electroporation method. The specific operation was as follows: Take out 50 μL of frozen competent cells, thaw them, add 2 μL of the above recombinant plasmid, and gently tap the tube wall to mix. Transform them in an electroporator, then transfer the electroporated competent cells into 1.5 mL EP tubes, add 600 μL of LB (antibiotic-free) liquid medium, and shake at 28°C at low speed (150 r / min) for 5 h. Centrifuge at 4000 r / min for 30 sec, discard the supernatant, add 100 μL of LB liquid medium, suspend the cells, and plate them (containing 50 mg / mL kanamycin). Incubate at 28°C until single colonies grow, and obtain the EHA105 strain containing the binary plasmid vector.

[0053] (2) Rice transformation mediated by Agrobacterium EHA105 Mature wild-type Nipponbare seeds were selected, shelled, and disinfected with 70% alcohol and 30% sodium hypochlorite solution. After drying in a clean bench, they were cultured on induction medium for 3 weeks. Vigorously growing callus tissue was selected as the recipient for transformation. Rice callus was infected with the EHA105 strain containing a binary plasmid vector and co-cultured at 25°C in the dark for 3 days. Then, it was cultured on selection medium containing 300 mg / L hygromycin. Resistant callus was screened and cultured on pre-differentiation medium containing 250 mg / L hygromycin for 10 days. The pre-differentiated callus was transferred to differentiation medium and cultured under light. Resistant transgenic plants were obtained after one month. PCR identification of the plants yielded... FNR1 -OENIP Homozygous transgenic plants.

[0054] (three) FNR1 Gene expression level detection (1) Material acquisition: The materials used in the experiment are; FNR1 -OE NIP Homozygous transgenic plants were grown in the field.

[0055] (2) mRNA isolation: Rice tissue was ground into powder in liquid nitrogen, and total RNA was extracted from rice leaves using the Total RNA Miniprep kit (Axygene, China) according to the kit's operating steps for RT-qPCR.

[0056] (3) Reverse transcription to cDNA: The extracted mRNA was reverse transcribed into cDNA using the TaKaRa reverse transcription kit.

[0057] (4) Real-time quantitative PCR analysis: The SuperReal PreMix Plus (SYBR Green) kit from TIANGEN was used. The specific experimental method is as follows: 0.2 μL of the cDNA template obtained in the previous step, 0.2 μL each of the forward and reverse primers, 5 μL of 2x SuperReal PreMix Plus, and 4.4 μL of ddH2O were added to a 10 μL system; the amplification program was: 95℃, 15 min; 95℃, 10 sec; 60℃, 34 sec, 40 cycles; 65℃, 5 sec, 95℃, 5 sec; where: The forward primer is: AGCTCCTGAAGAAGGACCAC; The reverse primer is: ACTTCCACGTTCCATTGCTC.

[0058] (5) Results: FNR1 -OE NIP In homozygous transgenic plants FNR1 Upregulation of expression ( Figure 2 c).

[0059] Through the above-described transgenic technology, the results show that: the present invention has obtained... FNR1 Genetically modified rice with overexpression.

[0060] Example 3: FNR1 Agronomic trait analysis of overexpression transgenic rice (1) Phenotypic observation and statistics during the growth period: FNR1 -OE NIP Statistical observations were conducted on traits such as plant height and tiller number during the growth period of homozygous transgenic lines.

[0061] (2) Observation and statistics of phenotypes at maturity: FNR1 -OE NIP The traits of homozygous transgenic lines at maturity, such as plant height, number of tillers, aboveground biomass, and yield, were statistically observed.

[0062] (3) Results: The plants grown in Lingshui (LS) FNR1 -OE NIP Compared with WT, homozygous transgenic lines still showed advantages in mature plant height, tiller number, seed setting rate, and yield per plant, but the differences were not significant under high temperature stress. Figure 3 High temperature stress FNR1 -OE NIP Statistical analysis of the field phenotypes of homozygous transgenic lines showed that... FNR1 -OE NIP The homozygous transgenic lines showed a significant growth advantage over WT lines. Fd1 -OE NIP Homozygous transgenic lines showed similar phenotypes under high-temperature stress. Under high-temperature field conditions in Chongqing in 2023 (… Figure 4 d) During the tillering and maturity stages... FNR1 -OE NIP plant height of homozygous transgenic lines ( Figure 4 a, b), number of tillers ( Figure 4 Statistical analysis was performed on a and c), and the results showed that... FNR1 -OE NIP The homozygous transgenic lines showed significant superiority over WT. Statistical analysis of the fresh and dry weights of the aboveground parts showed... FNR1 -OE NIP The growth of homozygous transgenic lines was significantly higher than that of wild-type lines. Figure 4 e). Regarding FNR1 -OE NIP Statistical analysis of the seed setting rate of homozygous transgenic lines revealed three... FNR1 -OE NIP The seed setting rate of homozygous transgenic lines increased by 16%, 11%, and 11% respectively relative to WT. Figure 4 f). Regarding FNR1 -OE NIP Statistical analysis of the yield per plant of homozygous transgenic lines revealed the following results: FNR1 -OE NIP On average, homozygous transgenic lines increased yield by about 17%. Figure 4 g, h).

[0063] Example 4: FNR1 Detection of photosynthetic capacity of transgenic rice overexpression To test FNR1 -OE NIPThe photosynthetic capacity of homozygous transgenic lines under natural high-temperature stress in the field during the tillering stage. FNR1 -OE NIP The photosynthetic rate and chlorophyll fluorescence parameters of homozygous transgenic lines and WT were detected, and the results showed that... FNR1 -OE NIP The homozygous transgenic lines showed better photosynthetic capacity compared to WT. FNR1 -OE NIP The homozygous transgenic lines PSI and PSII showed significant advantages in electron transport rates ETR I and ETR II, and photochemical quantum yields YI and YII. Figure 5 a, b, c, d). The maximum quantum yield of PSII, Fv / Fm, and the maximum redox level of PSI, P700, were significantly higher than those of the wild type. Figure 5 e, f). The non-photochemical quenching coefficient is significantly smaller than WT ( Figure 5 g), at the same time, the net photosynthetic rate under saturated light intensity increases by about 20% relative to WT, which indicates FNR1 -OE NIP The enhanced photosynthetic capacity of homozygous transgenic lines improved the photosynthetic capacity of rice under high temperatures, thereby increasing the heat resistance and yield stability of rice.

[0064] Example 5: Overexpression in the main cultivated varieties Huazhan and Xiushui 134 FNR1 Improve its heat resistance and production stability NIPs, as classic receptors for rice genetic research, are widely used in rice functional genomics studies. However, due to differences in background, some receptors that yield excellent phenotypes in NIPs may not perform well in other contexts. To verify this... FNR1 To explore whether overexpression has functional universality in different materials and expand its application prospects, this application constructed [a specific method / mechanism] in the main cultivated varieties Huazhan and Xiushui 134. FNR1 Overexpression lines were used to detect agronomic traits and photosynthetic rates of multiple independent lines under natural high-temperature field conditions in Hangzhou (HZ) in 2024, against a background of Huazhan. FNR1 -OE NIP The net photosynthetic rate of homozygous transgenic lines increased by 20% relative to WT and by 21% under the Xiushui 134 background. Figure 6 b, e). Statistical analysis of the yield per plant was conducted, and the results showed that under the background of Xiushui 134... FNR1 -OE XS On average, homozygous transgenic lines increased yield by about 20%. Figure 6 a, c). In the context of the Chinese occupation FNR1 -OE HuaZ Homozygous transgenic lines can increase yield by about 10% ( Figure 6 d, f). The above experimental results show that by improving FNR1Expression levels can also improve the heat resistance of main varieties, providing new ideas for the creation of heat-resistant and stable rice varieties.

[0065] Example 6: FNR1 Detection of carbon assimilation products in transgenic rice overexpression In order to determine FNR1 The impact of high-temperature stress on carbon assimilation products: We transferred rice in its tillering stage into an artificial climate chamber to simulate high-temperature treatment in the field. The treatment temperature in the climate chamber was as follows: Figure 7 As shown in c, leaf tissue samples of flag leaves of rice during the booting stage were collected under natural high temperature in the field, simulated high temperature in the climate chamber, and normal temperature for the detection of soluble sugars (glucose, fructose, sucrose) and starch content.

[0066] (1) Detection of soluble sugar content: To detect the soluble sugar content, leaf tissue samples of rice flag leaves were collected during the booting stage and frozen in liquid nitrogen. Then, 0.1 g of plant sample was homogenized by adding 1 mL of 80% (v / v) ethanol solution to a 2 mL Eppendorf tube. The sample was sonicated in a water bath for 30 minutes and then heated at 12,000 °C at room temperature. g Centrifuge for 10 minutes to remove insoluble residues. Purify the sample through a Millipore 0.22 μm filter. Sugar content in the filtrate is measured using an Angilent 1200 high-performance liquid chromatography system (Angilent Technologies). The concentrations of various soluble sugars are analyzed using a standard curve.

[0067] (2) Starch content detection: Starch content was determined using a starch content assay kit (Grace, Suzhou, China) and analyzed using an ELISA reader (Tecan Infinite M200, Mannedorf, Switzerland) with a wavelength of 510 nm.

[0068] (3) Preparation and observation of chloroplasts for transmission electron microscopy: Take FNR1 -OE NIPThe flag leaf of the homozygous transgenic line and the wild-type spike-in stage were cut into small pieces; the cut sample pieces were placed in 2 mL centrifuge tubes, 2.5% glutaraldehyde solution (pH 7.2) was added, and vacuum was applied in a vacuum instrument until the leaves completely sank. Rinse three times with 0.1 M phosphoric acid every 15 minutes, then fix with 1% osmium tetroxide for 3 hours until the sample turns black. Dehydrate the sample sequentially with 50%, 70%, and 90% ethanol solutions, treating for 20 minutes at each concentration. Then treat with a 1:1 ethanol and acetone solution for 20 minutes, all at 4°C. Finally, treat the sample with pure acetone at room temperature for 20 minutes. Incubate the sample in a 3:1 mixture of anhydrous acetone and embedding agent for 4 hours, then in a 1:1 mixture of anhydrous acetone and embedding agent for 3 hours, and finally in pure embedding agent for 12 hours. Place the sample in an embedding cassette and incubate overnight at 37°C, then for 12 hours at 45°C, and finally for 24 hours at 60°C to obtain the embedded sample. Cut the embedded sample into 60-70 mm pieces using an ultramicrotome. Ultrathin sections of approximately nm were prepared, stained with lead citrate solution for 10 minutes, then stained with uranium acetate solution for 30 minutes, washed three times with double-distilled water, and air-dried. The sections were then observed using a Hitachi H-7650 transmission electron microscope, and photographed at a clear magnification.

[0069] (4) Results: FNR1 -OE NIP Homozygous transgenic lines have a higher soluble sugar content compared to wild-type lines ( Figure 7 d) and starch ( Figure 7 The accumulation of carbon assimilation products (a, b, e) increases, especially under high temperature stress. In stark contrast, the photosynthetic capacity of WT is inhibited and the accumulation of carbon assimilation products decreases under high temperature stress, while the overexpression lines remain at stable levels.

[0070] Example 7: FNR1 Analysis of pollen fertility of transgenic rice overexpression (1) Pollen K2-KI detection: In order to determine FNR1 To investigate the effect of high-temperature stress on rice pollen fertility, we transferred rice plants in the tillering stage into an artificial climate chamber to simulate high-temperature treatment in the field. We then stained the anthers with K2-KI and counted the percentage of fertile anthers.

[0071] (2) Results: FNR1 -OE NIP The pollen fertility of homozygous transgenic lines remained stable under high temperature stress. Figure 8 a, b). High temperatures in the field also include high-temperature treatment in artificial climate chambers. FNR1 -OE NIP Homozygous transgenic lines consistently exhibited superior pollen fertility. Pollen fertility is inextricably linked to the accumulation and distribution of carbon assimilation products. FNR1 -OENIP The photosynthetic capacity and carbon assimilation product accumulation of homozygous transgenic lines are more likely to be... FNR1 -OE NIP The reason why homozygous transgenic lines have an advantage in maintaining pollen fertility.

Claims

1. FNR1 Its application in improving the photosynthetic stability or heat resistance of rice is characterized by: Overexpression of rice leaf-type ferrugin-NADP + Oxidoreductase FNR1 Methods to improve the photosynthetic stability or heat resistance of rice.

2. The application as described in claim 1, characterized in that: The photosynthetic stability or heat resistance of rice includes the photosynthetic capacity, carbon assimilation efficiency, growth status, or yield of rice under high temperature stress.

3. The application as described in claim 2, characterized in that: The growth status includes at least one of plant height, number of tillers, fresh weight of above-ground parts, and dry weight; The rice yield includes at least one of the following: seed setting rate, thousand-grain weight, yield per plant, and rice pollen fertility.

4. The application as described in any one of claims 1-3, characterized in that: The overexpression of rice leaf-type ferrugin-NADP + Oxidoreductase FNR1 The methods are either genetic modification or gene editing.

5. FNR1 Application in creating new rice germplasm with heat resistance and stable yield through genetic engineering.

6. The application as described in claim 5, characterized in that: The heat-resistant and stable-yield characteristics are manifested in the improved photosynthetic capacity, carbon assimilation efficiency, growth status, or yield of rice under high-temperature stress.

7. An overexpression of rice leaf-type ferrugin-NADP + Oxidoreductase FNR1 Recombinant plasmids of genes are characterized by: The recombinant plasmid contains FNR1 Nucleotide fragments.

8. The recombinant plasmid according to claim 7, characterized in that: The recombinant plasmid is pCAMBIA1300- FNR1 -GFP-flag recombinant plasmid, which contains FNR1 Nucleotide fragments.

9. The application of the recombinant plasmid as described in claim 7 or 8 in the creation of new rice germplasm with heat resistance and stable yield characteristics.

10. A method for improving the photosynthetic stability or heat resistance of rice, characterized in that: Overexpression of rice leaf-type ferrugin-NADP + Oxidoreductase FNR1 Methods to improve the photosynthetic capacity, carbon assimilation efficiency, growth status, or yield of rice under high temperature stress.

Images